Introduction
Leishmaniasis, caused by protozoan trypanosomatid parasites of genus Leishmania, is essentially a neglected tropical disease. The parasites multiply within host macrophages, afflicting skin (cutaneous), mucous membranes (mucocutaneous), or internal organs (visceral).1,2 About 350 million people live at risk of leishmaniasis in 98 countries across five continents.3,4 Based on estimates by Alvar and others (2012),5 the annual global incidence of visceral leishmaniasis (VL) is 0.2–0.4 million cases compared with 0.7–1.2 million cases for cutaneous leishmaniasis (CL) and mucocutaneous leishmaniasis combined (MCL).
A region extending from central Asia to Middle East contributes 226,200–416,400 of the global CL cases annually. In Pakistan, around 21,000–35,000 cases of both anthroponotic (ACL) and zoonotic (ZCL) forms of CL are reported.5 ACL is apparently sporadic and Leishmania tropica has been implicated as its causative agent in the country.6–8 It is commonly reported from urban centers of Punjab, Baluchistan, Azad Jammu Kashmir (AJK), Khyber Pakhtunkhwa (KP) and the surrounding tribal belt, known as the Federally Administrated Tribal Areas (FATA).5,9 In KP, the northwest province of Pakistan, leishmaniasis is characterized by intermittent epidemics attributed to L. tropica.6,8,10 The ZCL form, attributed to infection by Leishmania major, is more common further south, being described from rural and semi-urban areas of Punjab, Baluchistan, and Sindh provinces, where its transmission is possibly maintained through reservoir populations in wild mammals, particularly gerbils such as Rhombomys opimus.11,12
There have been several reports from studies in Pakistan of atypical manifestations of the disease either due to unusual sites of lesions or their unusual morphology. Lesions on atypical sites lead to difficulty in differential diagnosis, for example, lips or genitalia (chancriform), toes and fingers (paronychial), pulp of finger (whitlow), eyelid, scalp, palm/sole (palmoplantar), and others.13–16 Similarly, many unusual clinical configurations of lesions are described including lupoid, keloidal, psoriasiform, erysipeloid, verrucous, zosteriform, tumorous, eczematoid, and acneform and so on.16–19 These studies of atypical manifestation in Pakistan have failed to provide molecular confirmation of the infecting Leishmania species.
This study aimed to assess the demographic and clinical aspects of CL in KP Province of Pakistan. We also set out to identify the causative species of CL in the province and attempted to distinguish any species-specific clinical variants within KP. Different diagnostic approaches comprising microscopy (including histopathology), parasite culture, and polymerase chain reaction (PCR) were compared to evaluate their sensitivity and specificity. In addition, the diagnostic accuracy of presumptive clinical diagnosis, as performed in the participating hospitals, was examined using the above-mentioned diagnostic means.
Materials and Methods
Study design and subjects.
The study was conducted in the dermatology outpatient units at Kuwait Teaching Hospital (KWH), Khyber Teaching Hospital (KTH), and Combined Military Hospital (CMH) in Peshawar, KP. CMH commonly catered for army personnel who acquired CL while deployed in the tribal areas of FATA. The other two civilian hospitals treated patients from local and other adjoining regions in the outskirts of Peshawar. Clinical data and biological samples were collected from 125 CL patients (suspected and confirmed) visiting these major health-care facilities of Peshawar from May 2010 to September 2010.
CL patients were recruited for the study based on standard diagnostic procedures practiced at these hospitals. KWH performed clinical diagnosis only. CMH also practiced clinical diagnosis, often followed by confirmatory microscopy (histopathology or exudate smears). At KTH, clinical diagnosis was considered inadequate and a positive microscopy of lesion smears was required before administering treatment. However, for this study, all suspected (microscopy negative) and confirmed CL patients (microscopy positive) from KTH were included. All participants gave written informed consent to participate in the study. Ethics Committees at University of Peshawar (ref. no. 28/Pharm, May 2010) and the London School of Hygiene and Tropical Medicine (LSHTM) (ref. no. 5677, March 2010) approved the study documentation.
Sample collection and DNA extraction.
Selected patient lesions (the most recent, in case of multiple lesions) were first photographed and standard clinical descriptions for these lesions were obtained from dermatologists. Lesions were punctured with sterile lancets and collected exudates were dispensed in to a biphasic culture medium containing rabbit blood agar and M199 medium (Sigma-Aldrich, Gillingham, UK) supplemented with 10% heat-inactivated fetal calf serum. Positive cultures with Leishmania viable promastigotes observed were expanded and cryopreserved before transfer to LSHTM for genetic analysis. Aliquots of each culture were thawed, spun at 2,000 rpm at 4°C for 10 minutes, the pellet washed with phosphate-buffered saline, and DNA extracted using the DNeasy Blood and Tissue Kit (QIAGEN, North Manchester, UK).
At the same time, coarse porosity filter paper discs (Fisher Scientific, Loughborough, UK) were used to obtain lesion and biopsy impressions from each patient. Filter papers were wrapped individually in airtight resealable bags with silica gel and stored at 4°C until further processing: 2–3 sections of the filter papers were punched using a Harris Uni-Core hole punch (at least 2 mm diameter) and DNA extracted using a resin-based Chelex® method.20
Diagnostic PCR.
Three PCR methods, targeting minicircle kinetoplast DNA (kDNA),6 ribosomal DNA (rDNA),21 or internal transcribed spacer 2 region (ITS2)22 were used for Leishmania species identification and discrimination in cultures and on filter paper samples. rDNA provided Leishmania genus-level identification, whereas kDNA and ITS2 PCRs aided in species-level diagnosis of the samples (Table 1). Leishmania species discrimination from cultured parasites was performed using only kDNA PCR, whereas samples on filter papers were subjected to all three diagnostic PCRs.
Primers and reaction conditions used in diagnostic PCRs
| PCR | Forward (F) primer/reverse (R) primer (5′–3′) | PCR mixture | Cycling conditions |
|---|---|---|---|
| rDNA21 | Nest1 F: GCTGTAGGTGAACCTGCAGCAGCTGGATCATT | 50 μL reaction; 5 μL DNA from filter papers (or 5 μL N1), 25 μL QIAGEN HotStar Taq Master Mix (QIAGEN), 0.3 μM primers | 95°C, 15 minutes |
| Nest1 R: GCGGGTAGTCCTGCCAAACACTCAGGTCTG | 35–40 cycles | ||
| Nest2 F: GCAGCTGGATCATTTTCC | 94°C, 0.5 minutes | ||
| Nest2 R: AACACTCAGGTCTGTAAAC | 58°C, 0.5 minutes | ||
| 72°C, 1.5 minutes | |||
| 60°C, 1 minutes | |||
| 75°C, 10 minutes | |||
| ITS222 | F: GGGAGAAGCTCTATTGTG | 25 μL reaction; 1 μL N2 product from rDNA PCR, KCl buffer (15 mM MgCl2, Bioline, London, UK), 2 mM deoxynucleotide triphosphates, 0.4 μM primers, 1U Taq polymerase | 94°C, 2 minutes |
| R: ACACTCAGGTCTGTAAAC | 40 cycles | ||
| 94°C, 20 seconds | |||
| 53°C, 30 seconds | |||
| 72°C, 1 minutes | |||
| 72°C, 10 minutes | |||
| kDNA6 | Nest1 F: C/GA/GTA/GCAGAAAC/TCCCGTTCA | 50 μL reaction; 5 μL DNA from filter papers (OR 5 μL N1), 25 μL QIAGEN HotStar Taq Master Mix, 0.3 μM primers | 95°C, 15 minutes |
| Nest1 R: ATTTTTCG/CGA/TTTT/CGCAGAACG | 30 cycles at | ||
| Nest2 F: ACTGGGGGTTGGTGTAAAATAG | 94°C, 1 minutes | ||
| Nest2 R: TCGCAGAACGCCCCT | 55°C, 1 minutes | ||
| 72°C, 1.5 minutes | |||
| 60°C, 1 minutes | |||
| 75°C, 10 minutes |
kinetoplast DNA = kDNA; PCR = polymerase chain reaction.
Data analysis.
For analysis, KTH and KWH were treated as a single group of civilian hospitals (KTH + KWH, N = 54) distinct from CMH, a military hospital (N = 71). Calculation of proportions, Pearson χ2 test, and comparison of means by the Wilcoxon–Mann–Whitney test were carried out in STATA v.12.
Sensitivity, specificity, positive predictive value (PPV), negative predictive value (NPV), and McNemar's marginal homogeneity were calculated for each diagnostic method.23 Since there is no known gold standard outlined for diagnosis of CL, a “consensus standard” was defined for this study. All samples were considered confirmed positives if they were positive parasitologically (by culture or microscopy) or by at least two PCR methods. Samples were considered confirmed negatives if they were negative by all PCR and parasitological methods or when only one PCR method was positive.24–26
Results
A total of 125 patients with skin lesions were diagnosed as cases of CL, and treated according to local guidelines and protocols operating in the three participating hospitals. Our study did not contribute to decisions regarding management of these patients.
Site of disease acquisition was concluded from patient travel history, taking in to account the incubation period and patient information. Overall, 56.1% of patients acquired the disease when traveling/working away from home, both in and outside KP, whereas the rest acquired the disease indigenously. The civilian hospitals (KWH and KTH) mainly received patients from Peshawar and adjoining tribal regions of Khyber Agency (mostly Jamrud, Bara, and Landi Kotal). Military personnel serving in north and south Waziristan (especially Miramshah and Wana) were observed at CMH (Figure 1).
Geographical distribution of cutaneous leishmaniasis (CL) cases reported in the study. Map shows adjoining regions of Khyber Pakhtunkhwa Province. Areas shaded gray are agencies within the Federally Administrated Tribal Areas (FATA). Dot on the map represents the isolation site of one or more strains. Size of the dot is proportional to number of strains represented by it.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Geographical distribution of cutaneous leishmaniasis (CL) cases reported in the study. Map shows adjoining regions of Khyber Pakhtunkhwa Province. Areas shaded gray are agencies within the Federally Administrated Tribal Areas (FATA). Dot on the map represents the isolation site of one or more strains. Size of the dot is proportional to number of strains represented by it.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Geographical distribution of cutaneous leishmaniasis (CL) cases reported in the study. Map shows adjoining regions of Khyber Pakhtunkhwa Province. Areas shaded gray are agencies within the Federally Administrated Tribal Areas (FATA). Dot on the map represents the isolation site of one or more strains. Size of the dot is proportional to number of strains represented by it.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Comparative performance of diagnostic methods.
Samples in cultures and on filter papers were successfully acquired from 119 and 111 of 125 patients, respectively. Although 51 of the total 119 lesions were culture positive, only 34 of these could be established and propagated so that they could be further subjected to species-specific PCRs. Microscopy data were provided for 45 of the 71 patients at CMH and all the 16 patients examined at KTH (Table 2). Microscopy was not performed at KWH.
Comparative performance of diagnostic methods used to identify Leishmania infections among 125 patients
| Diagnostic method | No. of positives (% positivity) | Sensitivity (%) (95% CI) | Specificity (%) (95% CI) | PPV (%) | NPV (%) | P value* |
|---|---|---|---|---|---|---|
| kDNA PCR (N = 111) | 69 (62.2) | 86.5 (76.5–93.3) | 86.5 (71.2–95.5) | 92.8 | 76.2 | 0.197 |
| ITS2 PCR (N = 111) | 52 (46.8) | 70.3 (58.5–80.3) | 100 | 100 | 62.7 | < 0.01 |
| rDNA PCR (N = 111) | 79 (71.2) | 78.4 (67.3–87.1) | 43.2 (27.1–60.5) | 73.4 | 50 | 0.411 |
| Microscopy (N = 61)† | 26 (42.6) | 60.5 (44.4–75) | 100 | 100 | 51.4 | < 0.01 |
| Culture (N = 119)†‡ | 51 (42.9) | 67.1 (55.4–77.5) | 100 | 100 | 63.2 | < 0.01 |
CI = confidence interval; ITS2 = internal transcribed spacer 2 region; kinetoplast DNA = kDNA; NPV= negative predictive value; PCR = polymerase chain reaction; PPV = positive predictive value; rDNA = ribosomal DNA.
For McNemar's test of marginal homogeneity.
Both the methods contributed to formulating the “consensus” standard as no gold standard method exists.
For culture, sensitivity figure is equivalent to isolation rate.
The highest estimated prevalence of Leishmnania spp. infection, derived from PCR amplification of clinical samples on filter papers, was 71.2% by rDNA PCR, followed by 62.2% (kDNA), and 46.8% (ITS2). Culture and microscopy methods provided lower estimates of prevalence among the patients tested (42.9% and 42.6%, respectively) (Table 2).
Sensitivity and specificity of each diagnostic PCR assay on filter paper samples was assessed against the consensus standard. kDNA PCR showed the highest sensitivity (86.5%) and specificity (86.5%). This PCR method was also least prone to producing false negatives (NPV = 76.2%). rDNA PCR was the second most sensitive method (78.4%), although suffered from poor specificity (43.2%). ITS2 PCR was the least sensitive (70.3%) but outperformed other methods in specificity (100%). Parasite culture and microscopy provided sensitivity estimates of 67.1% and 60.5%, respectively. Only kDNA and rDNA PCR provided significant statistical equivalence with the consensus standard (McNemar's test; P > 0.05) (Table 2).
Clinical examination was a standard means of CL diagnosis at CMH and KWH. About 80.7% (N = 88) of the clinically diagnosed CL patients (N = 109) were confirmed as parasite positive by at least one other diagnostic method (microscopy, culture, or PCR). On the other hand in KTH, eight of the 16 patients not recommended for treatment (due to negative microscopy) were positive by culture or PCR methods used for the purpose of this study.
Leishmania species in KP, Pakistan.
Of the total of 125 examined patients, 104 were validated Leishmania cases by one or more of the diagnostic methods used in this study. Thirty were identified to genus level (positive only by microscopy, culture, or rDNA PCR).
Of the 74 samples identified to species level, 66 were L. tropica (89.2%), five were L. major (6.8%), and three were Leishmania infantum. Three of the L. major patients had recently traveled to Baluchistan, whereas the other two had travel histories to Punjab and Sindh. To date L. infantum has not previously been reported to cause CL in Pakistan. Two of these cases were army officers who contracted the disease in north Waziristan. The third case was a female of 60 years diagnosed at AJK with no long-term travel history except to seek medical attention (Table 3).
Types and number of lesions in relation to Leishmania species identified in the region
| Dry/wet* (%) | Leishmania tropica (N = 59) | Leishmania major (N = 4) | Leishmania infantum (N = 3) | P value† |
|---|---|---|---|---|
| Dry | 24 (40.7) | 2 (50.0) | 1 (33.3) | 0.171 |
| Mixed | 28 (47.5) | 0 | 1 (33.3) | |
| Wet | 7 (11.9) | 2 (50.0) | 1 (33.3) | |
| No. of lesions (%) | L. tropica (N = 66) | L. major (N = 5) | L. infantum (N = 3) | |
| Single | 38 (57.6) | 2 (40.0) | 3 (100) | 0.241 |
| Multiple | 28 (42.4) | 3 (60.0) | 0 |
Includes only those samples for which clinical description was available.
Calculated for Pearson χ2 test.
Disease description and clinical diversity.
Clinical profiles for all the patients in the study (N = 125) were assessed for different parameters as seen in Tables 3 and 4. Additional clinical characteristics studied were based on lesion descriptions as provided by the clinician. A total of 99 lesions were represented by photographs of sufficient quality to be adequately described. Briefly, the description included whether the lesion was dry, wet, or mixed types; if ulcerated whether typical or atypical leishmaniasis lesion; if atypical, its description based on its similarity to a certain dermatological condition (Figure 2).
Patient information and clinical data from lesions
| Study center | P value* | |||
|---|---|---|---|---|
| All (N = 125) | CMH (N = 71) | KTH + KWH (N = 16 + 38 = 56) | ||
| Median age of patients (interquartile range) | 24 (17–32) | 26 (22–32) | 16 (7–30) | – |
| Sex of patients | ||||
| Male (%) | 84.8 | 97.2 | 68.5 | – |
| Female (%) | 15.2 | 2.8 | 31.5 | – |
| No. of lesions per patient | ||||
| Mean | 2.2 (95% CI 1.4–2.9) | 2.6 (95% CI 1.2–3.9) | 1.6 (95% CI 1.3–2.0) | – |
| Range | 1–47 | 1–7 | 1–47 | – |
| Singular lesion (%) | 59.7 | 48.6 | 74.1 | 0.004 |
| Multiple lesion (%) | 40.3 | 51.4 | 25.9 | |
| Duration of disease at presentation (months)† | ||||
| Mean | 3.5 (95% CI 3.1–4.0) | 3.4 (95% CI 3.0–3.9) | 3.7 (95% CI 2.8–4.6) | 0.362 |
| Range | 0.36–12 | 0.75–10 | 0.36–12 | |
| Size of lesion at presentation (cm)‡ | ||||
| Mean (N = 108) | 2.0 (95% CI 1.8–2.2) | 2.1 (95% CI 1.8–2.4) | 2.0 (95% CI 1.7–2.3) | 0.392 |
| Range | 0.5–6 | 0.5–6 | 0.5–6 | |
| Site (%)§ | ||||
| Upper extremity | 41.6 | 47.9 | 33.3 | 0.102 |
| Lower extremity | 24.8 | 21.1 | 29.6 | 0.276 |
| Lesions on both extremities | 10.4 | 15.5 | 3.7 | 0.032 |
| Lesions on and above neck | 29.6 | 23.9 | 37.4 | 0.112 |
CI = confidence interval; CMH = Combined Military Hospital; KTH = Kuwait Teaching Hospital; KWH = Khyber Teaching Hospital.
Calculated for Pearson χ2 test except for lesion duration and lesion size where the P values are for Wilcoxon–Mann–Whitney test.
Earliest appearing lesion was considered in case of multiple lesions.
Size of lesion that was selected for sampling. The analysis excludes lesions that could not be measured due to absence of clearly defined lesion boundaries (N = 17).
Percentages will not add up to 100% because of patients with multiple lesions at multiple sites (e.g., on upper extremities and face).
Atypical forms of cutaneous leishmaniasis (CL) lesions reported. (A) Psoraisiform, (i and ii) dry type, (iii) mixed type; (B) ecthymatous, mixed-type; (C) (i and ii) cellulitis like, mixed type. (D) (i and ii) Verruciform, dry type; (E) mycetomatous, mixed type; (F) lupoid, (i) mixed type and (ii) dry type; (G) keloidal, dry type; (H) squamous cell carcinoma like, wet type; (I) discoid lupus erythematosus like, dry type; (J) paronychial, dry type; (K) chanciform, wet type; (L) basal cell carcinoma like, mixed type; (M) erysipeloid, dry type; (N) typical (i and ii) wet type; and (O) typical (i and ii) mixed-type. LT = Leishmania tropica; LM = Leishmania major; LF = Leishmania infantum; L = Leishmania spp.; NA = no spp. identified.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Atypical forms of cutaneous leishmaniasis (CL) lesions reported. (A) Psoraisiform, (i and ii) dry type, (iii) mixed type; (B) ecthymatous, mixed-type; (C) (i and ii) cellulitis like, mixed type. (D) (i and ii) Verruciform, dry type; (E) mycetomatous, mixed type; (F) lupoid, (i) mixed type and (ii) dry type; (G) keloidal, dry type; (H) squamous cell carcinoma like, wet type; (I) discoid lupus erythematosus like, dry type; (J) paronychial, dry type; (K) chanciform, wet type; (L) basal cell carcinoma like, mixed type; (M) erysipeloid, dry type; (N) typical (i and ii) wet type; and (O) typical (i and ii) mixed-type. LT = Leishmania tropica; LM = Leishmania major; LF = Leishmania infantum; L = Leishmania spp.; NA = no spp. identified.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Atypical forms of cutaneous leishmaniasis (CL) lesions reported. (A) Psoraisiform, (i and ii) dry type, (iii) mixed type; (B) ecthymatous, mixed-type; (C) (i and ii) cellulitis like, mixed type. (D) (i and ii) Verruciform, dry type; (E) mycetomatous, mixed type; (F) lupoid, (i) mixed type and (ii) dry type; (G) keloidal, dry type; (H) squamous cell carcinoma like, wet type; (I) discoid lupus erythematosus like, dry type; (J) paronychial, dry type; (K) chanciform, wet type; (L) basal cell carcinoma like, mixed type; (M) erysipeloid, dry type; (N) typical (i and ii) wet type; and (O) typical (i and ii) mixed-type. LT = Leishmania tropica; LM = Leishmania major; LF = Leishmania infantum; L = Leishmania spp.; NA = no spp. identified.
Citation: The American Society of Tropical Medicine and Hygiene 95, 5; 10.4269/ajtmh.16-0343
Duration of disease and size of lesion at presentation did not significantly vary between the two hospital types (Mann-Whitney Wilcoxon test, P > 0.05). Presence of singular lesions was significantly higher in the civilian hospitals (Pearson χ2, P = 0.004). Upper extremities were the most common lesion site (41.6%). Most of the presented lesions were dry type (48.5%) followed by mixed (37.4%) and wet type (14.1%) (Table 4). The findings suggested that infecting species did not affect the number of lesions per patient, nor the dry/wet/mixed presentation (Table 3).
About 26.2% of ulcerated lesions (N = 84) presented typical morphology for CL (central crust with raised indurated edges) as described previously.35 Among the rest, fourteen atypical forms were described (Figure 2). All the lesions with Cellulitis-like atypical morphology were caused by L. tropica (N = 6). No conclusions could be drawn for species specificity for other atypical types, as they were present in more than one Leishmania species, one or more of their samples were PCR negative, or were identified to genus level only (Supplemental Table 1).
Discussion
Old World CL is a largely neglected disease. In most studies, the causative agent is either not reported or a particular species is assumed by convention to be present based on previously reported investigations. In this study, a combination of clinical, in vitro, and molecular diagnostic methods show that although three different species of Leishmania were found in the study area, the diversity of clinical presentations encountered could not be explained by species differences.
Demographic characteristics of CL patients.
Overall, the patients seen were predominantly male, and many of them were diagnosed and treated at a military hospital. Civilian hospital patients were also more likely to be males, occurring with twice the frequency of females. Similar sex-wise differences have been previously reported from other primary care hospitals of Peshawar15,27 and from active studies in neighboring Kabul, Afghanistan.28 These observations may indicate that men are at higher odds of acquiring CL, resulting from their occupational exposure and activities such as traveling or the practice of sleeping outside.29,30 In addition, there may also exist differences in attitudes toward seeking and providing treatment.31
Both local hospitals observed high proportions of CL in people from western tribal regions of the province, particularly the Khyber Agency, and also among local Peshawaris. Khyber Agency borders Afghanistan with frequent movement of people to and from Kabul City. These individuals, probably exposed to higher transmission intensity across the border, provide reservoirs for the consequent anthroponotic transmission of the disease when they return to their home regions in Pakistan. The mean age of leishmaniasis patients in both the civilian and military centers (CMH = 28.5, KTH + KWH = 20.8) was in general agreement with other CL studies in the region.15,27 However, the civilian centers observed a majority of patients under 24 years of age, suggesting long-term development of immunity in a region (Khyber Agency) with established endemicity for the disease,32 or perhaps different treatment-seeking behavior in older age groups.
Proficiency of different diagnostic methods in KP.
Comparing the diagnostic performance of different methods in this study showed that both the sensitivity of microscopy and the isolation rate of culture were satisfactory at 66% and 67%, respectively (Table 2). Previous studies in KP observed lower sensitivity of these techniques (36–43%) compared with parasite culture.8 However, countries from Latin America and central Asia witnessed a better performance of microscopy against PCR (78–90%).33–35 A major issue with culture-based diagnosis for CL is the high risk of contamination,36 as was observed in this study (9.2% of cultured isolates). Several factors may account for such variations in sensitivities including low parasite burden (e.g., chronic CL) and variation in number and distribution of the parasites in samples.37,38
Filter papers have been used as source of clinical material in Afro-Eurasian CL, American CL, MCL, and extensively in VL studies.24,39–41 Using filter paper as clinical samples, kDNA-targeted PCR was the most sensitive of all the methods used, as corroborated by others.24 kDNA assays are demonstrated to be more sensitive than PCR of rDNA targets due to higher copy number (10, 000 minicircles per parasite as compared with 40–200 copies of the rDNA genes).6,24,42 Poor performance of ITS2 observed herein might be attributed to PCR inhibition since nested amplification from rDNA PCR was used. Studies have, however, demonstrated low sensitivity of ITS2 PCR on clinical samples (21.2%).43,44 Sequence variation at primer sites may play a role here. Lack of PCR positivity in some parasitologically positive specimens might have been due to heterogeneous distribution of the parasite across the filter paper. This condition would be exacerbated in cases of low parasitemia.
Presumptive clinical diagnosis, as performed in the participating hospitals, was shown to be effective in this endemic setting.8 Thus, although several atypical forms of the disease were prevalent, experienced local clinicians provided diagnoses of high accuracy, a reassuring finding since microscopy has the limitations of decreased sensitivity and dependence on trained technical staff.3
Our combined diagnostic approach identified three parasite species as causative agents of leishmaniasis in our study hospitals: L. tropica (89.2%), L. major (6.8%), and L. infantum (4.1%). Leishmania tropica has been previously identified as the causative agent of ACL in KP, neighboring AJK, Quetta, Baluchistan, and south Punjab.7,8,45,46 All L. tropica samples were isolated from patients from KP province, substantiating the endemicity of the species in this region.6–8 All five L. major cases in this study were probably imported into the region, since the patients had travel histories to regions from Baluchistan, Punjab, and Sindh. All these provinces have endemic gerbil populations, and are suspected or known to have L. major transmission.46–48 However, this does not overlook possible ZCL transmission of L. major in KP, since its incriminated vector Phlebotomus papatasi exists here although not as widespread as in Baluchistan.49 This study reported the first cutaneous cases of L. infantum in Pakistan. Although one patient contracted the disease in AJK, which is a focus of VL by L. infantum,50–52 the other two cases reported here were from KP. There are no reports of L. infantum causing CL circulating in KP. As the patients in this study were not examined for symptoms of VL, we cannot rule the possibility that VL does occur in our study area.
Clinical features of CL in KP.
The presence of singular lesions was significantly associated with the region of disease origin and type of hospital. Housing conditions and vocational behavior of the patients may account for the variation in number of lesions, since the military personnel visiting CMH live in tents and barracks and had duty hours making them more susceptible to multiple bites. A probable explanation can also lie in host immunity toward the disease as it has been observed that nonindigenous people are prone to having acute, severe, and more lesions than seen in indigenous cases.53 Mean lesion duration and lesion size at presentation were 3.5 months and 2.02 cm, respectively. The reported values were comparable to those presented by others (6–10 months; 1.2–1.7 cm).35,54,55 Overall, the most commonly afflicted sites effected by CL were exposed upper extremities and face of patients since they are the more consistently exposed parts.9,28,35,55
The majority of L. tropica lesions observed here were dry or mixed type lesions. Leishmania tropica has been previously associated with production of dry type lesions, whereas wet/moist lesions are reported to be initiated by L. major infections.56,57 Studies in L. tropica–endemic regions of the country extensively report dry type lesions (in KP 57.6% by Bari and others54; in Multan, Punjab, 100% by Mujtaba and Khalid58; Larkana, Sindh, 97.6% by Bhutto and others12). Clinically dry and wet types of lesions were observed in all the three species detected in this study and we thus found no evidence of species-specific clinical manifestations. Similar conclusions were also drawn by Myint and others46 in Baluchistan. We also failed to find any evidence that atypical lesion morphology could be associated with a specific Leishmania species.16,17,19
It is important to consider that the clinical outcome of CL does not only depend on the Leishmania species responsible. Rare clinical manifestations may be affected by host immune response, nutritional status of the host, hormonal factors, or differences in size and site of inoculation. Unusual morphology related to atypical site might also be because of variation in the skin barrier (e.g., fragility of facial skin) or the topography of the site of the sand fly bite (e.g., Fissure leishmaniasis when the lesion is in the center point of the lip, on the face59).
Conclusion
Our study provides a platform for future species typing of CL patients in KP and other provinces, utilizing a combination of in vitro culture and molecular diagnostics. Identifying potential hosts and vectors for L. infantum in the region now must be addressed.
ACKNOWLEDGMENTS
We thank all the field workers involved in the study. We are grateful to Safeer Ullah Shah for his assistance in construction of the area map.
- 1.↑
Hotez PJ, Molyneux DH, Fenwick A, Ottesen E, Ehrlich Sachs S, Sachs JD, 2006. Incorporating a rapid-impact package for neglected tropical diseases with programs for HIV/AIDS, tuberculosis, and malaria. PLoS Med 3: e102.
- 2.↑
Hotez PJ, Remme JH, Buss P, Alleyne G, Morel C, Breman JG, 2004. Combating tropical infectious diseases: report of the Disease Control Priorities in Developing Countries Project. Clin Infect Dis 38: 871–878.
- 3.↑
Desjeux P, 2004. Leishmaniasis: current situation and new perspectives. Comp Immunol Microbiol Infect Dis 27: 305–318.
- 4.↑
WHO, 2010. Control of the Leishmaniases: Report of a Meeting of the WHO Expert Committee on the Control of Leishmaniases. Geneva, Switzerland: World Health Organization.
- 5.↑
Alvar J, Velez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M, 2012. Leishmaniasis worldwide and global estimates of its incidence. PLoS One 7: e35671.
- 6.↑
Noyes HA, Reyburn H, Bailey JW, Smith D, 1998. A nested-PCR-based schizodeme method for identifying Leishmania kinetoplast minicircle classes directly from clinical samples and its application to the study of the epidemiology of Leishmania tropica in Pakistan. J Clin Microbiol 36: 2877–2881.
- 7.↑
Rab MA, al Rustamani L, Bhutta RA, Mahmood MT, Evans DA, 1997. Cutaneous leishmaniasis: iso-enzyme characterisation of Leishmania tropica. J Pak Med Assoc 47: 270–273.
- 8.↑
Rowland M, Munir A, Durrani N, Noyes H, Reyburn H, 1999. An outbreak of cutaneous leishmaniasis in an Afghan refugee settlement in northwest Pakistan. Trans R Soc Trop Med Hyg 93: 133–136.
- 9.↑
Noor SM, Hussain D, 2004. Cutaneous leishmaniasis in Sadda, Kurram agency, Pakistan. J Pak Assoc Dermatol 14: 114–117.
- 10.↑
WHO, 2001. Afghanistan Crisis-Special Report: Leishmaniasis in Pakistan. Geneva, Switzerland: World Health Organization.
- 11.↑
Afghan AK, Kassi M, Kasi PM, Ayub A, Kakar N, Marri SM, 2011. Clinical manifestations and distribution of cutaneous leishmaniasis in Pakistan. J Trop Med 2011: 359145.
- 12.↑
Bhutto AM, Soomro RA, Nonaka S, Hashiguchi Y, 2003. Detection of new endemic areas of cutaneous leishmaniasis in Pakistan: a 6-year study. Int J Dermatol 42: 543–548.
- 14.
Bari AU, 2012. Clinical spectrum of cutaneous leishmaniasis: an overview from Pakistan. Dermatol Online J 18: 4.
- 15.↑
Rahman S, Abdullah FH, Khan JA, 2009. The frequency of old world cutaneous leishmaniasis in skin ulcers in Peshawar. J Ayub Med Coll Abbottabad 21: 72–75.
- 16.↑
Raja KM, Khan AA, Hameed A, Rahman SB, 1998. Unusual clinical variants of cutaneous leishmaniasis in Pakistan. Br J Dermatol 139: 111–113.
- 17.↑
Bari AU, Rahman SB, 2008. Many faces of cutaneous leishmaniasis. Indian J Dermatol Venereol Leprol 74: 23–27.
- 18.
Bari AU, Raza N, 2010. Lupoid cutaneous leishmaniasis: a report of of 16 cases. Indian J Dermatol Venereol 76: 85.
- 19.↑
Shamsuddin S, Mengal JA, Gazozai S, Mandokhail ZK, Kasi M, Muhammad N, 2006. Atypical presentation of cutaneous leishmaniasis in native population of Baluchistan. J Pak Assoc Dermatol 16: 196–200.
- 20.↑
Plowe CV, Djimde A, Bouare M, Doumbo O, Wellems TE, 1995. Pyrimethamine and proguanil resistance-conferring mutations in Plasmodium falciparum dihydrofolate reductase: polymerase chain reaction methods for surveillance in Africa. Am J Trop Med Hyg 52: 565–568.
- 21.↑
Parvizi P, Mauricio I, Aransay AM, Miles MA, Ready PD, 2005. First detection of Leishmania major in peridomestic Phlebotomus papatasi from Isfahan province, Iran: comparison of nested PCR of nuclear ITS ribosomal DNA and semi-nested PCR of minicircle kinetoplast DNA. Acta Trop 93: 75–83.
- 22.↑
Bulle B, Millon L, Bart J-M, Gallego M, Gambarelli F, Portus M, Schnur L, Jaffe CL, Fernandez-Barredo S, Alunda JM, Piarroux R, 2002. Practical approach for typing strains of Leishmania infantum by microsatellite analysis. J Clin Microbiol 40: 3391–3397.
- 23.↑
Parikh R, Mathai A, Parikh S, Chandra Sekhar G, Thomas R, 2008. Understanding and using sensitivity, specificity and predictive values. Indian J Ophthalmol 56: 45–50.
- 24.↑
Bensoussan E, Nasereddin A, Jonas F, Schnur LF, Jaffe CL, 2006. Comparison of PCR assays for diagnosis of cutaneous leishmaniasis. J Clin Microbiol 44: 1435–1439.
- 25.
Chargui N, Bastien P, Kallel K, Haouas N, Akrout FM, Masmoudi A, Zili J, Chaker E, Othman AD, Azaiez R, Crobu L, Mezhoud H, Babba H, 2005. Usefulness of PCR in the diagnosis of cutaneous leishmaniasis in Tunisia. Trans R Soc Trop Med Hyg 99: 762–768.
- 26.↑
Weigle KA, Labrada LA, Lozano C, Santrich C, Barker DC, 2002. PCR-based diagnosis of acute and chronic cutaneous leishmaniasis caused by Leishmania (Viannia). J Clin Microbiol 40: 601–606.
- 28.↑
Reithinger R, Mohsen M, Aadil K, Sidiqi M, Erasmus P, Coleman PG, 2003. Anthroponotic cutaneous leishmaniasis, Kabul, Afghanistan. Emerg Infect Dis 9: 727–729.
- 29.↑
Bashaye S, Nombela N, Argaw D, Mulugeta A, Herrero M, Nieto J, Chicharro C, Canavate C, Aparicio P, Velez ID, Alvar J, Bern C, 2009. Risk factors for visceral leishmaniasis in a new epidemic site in Amhara Region, Ethiopia. Am J Trop Med Hyg 81: 34–39.
- 30.↑
Mengesha B, Endris M, Takele Y, Mekonnen K, Tadesse T, Feleke A, Diro E, 2014. Prevalence of malnutrition and associated risk factors among adult visceral leishmaniasis patients in northwest Ethiopia: a cross sectional study. BMC Res Notes 7: 75.
- 31.↑
Kassi M, Afghan AK, Rehman R, Kasi PM, 2008. Marring leishmaniasis: the stigmatization and the impact of cutaneous leishmaniasis in Pakistan and Afghanistan. PLoS Negl Trop Dis 2: e259.
- 32.↑
Brooker S, Mohammed N, Adil K, Agha S, Reithinger R, Rowland M, Ali I, Kolaczinski J, 2004. Leishmaniasis in refugee and local Pakistani populations. Emerg Infect Dis 10: 1681–1684.
- 33.↑
Kolaczinski J, Brooker S, Reyburn H, Rowland M, 2004. Epidemiology of anthroponotic cutaneous leishmaniasis in Afghan refugee camps in northwest Pakistan. Trans R Soc Trop Med Hyg 98: 373–378.
- 34.
Ramirez JR, Agudelo S, Muskus C, Alzate JF, Berberich C, Barker D, Velez ID, 2000. Diagnosis of cutaneous leishmaniasis in Colombia: the sampling site within lesions influences the sensitivity of parasitologic diagnosis. J Clin Microbiol 38: 3768–3773.
- 35.↑
Uzun S, Durdu M, Culha G, Allahverdiyev AM, Memisoglu HR, 2004. Clinical features, epidemiology, and efficacy and safety of intralesional antimony treatment of cutaneous leishmaniasis: recent experience in Turkey. J Parasitol 90: 853–859.
- 36.↑
Singh S, Dey A, Sivakumar R, 2005. Applications of molecular methods for Leishmania control. Expert Rev Mol Diagn 5: 251–265.
- 38.↑
Reithinger R, Dujardin JC, 2007. Molecular diagnosis of leishmaniasis: current status and future applications. J Clin Microbiol 45: 21–25.
- 39.↑
Boggild AK, Valencia BM, Espinosa D, Veland N, Ramos AP, Arevalo J, Llanos-Cuentas A, Low DE, 2010. Detection and species identification of Leishmania DNA from filter paper lesion impressions for patients with American cutaneous leishmaniasis. Clin Infect Dis 50: e1–e6.
- 40.
da Silva ES, Gontijo CM, Pacheco R da S, Brazil RP, 2004. Diagnosis of human visceral leishmaniasis by PCR using blood samples spotted on filter paper. Genet Mol Res 3: 251–257.
- 41.↑
Miranda A, Saldana A, Gonzalez K, Paz H, Santamaria G, Samudio F, Calzada JE, 2012. Evaluation of PCR for cutaneous leishmaniasis diagnosis and species identification using filter paper samples in Panama, Central America. Trans R Soc Trop Med Hyg 106: 544–548.
- 42.↑
Ovalle Bracho C, Porras de Quintana L, Muvdi Arenas S, Rios Parra M, 2007. Polymerase chain reaction with two molecular targets in mucosal leishmaniasis' diagnosis: a validation study. Mem Inst Oswaldo Cruz 102: 549–554.
- 43.↑
de Almeida ME, Steurer FJ, Koru O, Herwaldt BL, Pieniazek NJ, da Silva AJ, 2011. Identification of Leishmania spp. by molecular amplification and DNA sequencing analysis of a fragment of rRNA internal transcribed spacer 2. J Clin Microbiol 49: 3143–3149.
- 44.↑
Schonian G, Nasereddin A, Dinse N, Schweynoch C, Schallig HDFH, Presber W, Jaffe CL, 2003. PCR diagnosis and characterization of Leishmania in local and imported clinical samples. Diagn Microbiol Infect Dis 47: 349–358.
- 45.↑
Ayub S, Gramiccia M, Khalid M, Mujtaba G, Bhutta RA, 2003. Cutaneous leishmaniasis in Multan: species identification. J Pak Med Assoc 53: 445–447.
- 46.↑
Myint CK, Asato Y, Yamamoto Y-i, Kato H, Bhutto AM, Soomro FR, Memon MZ, Matsumoto J, Marco JD, Oshiro M, Katakura K, Hashiguchi Y, Uezato H, 2008. Polymorphisms of cytochrome b gene in Leishmania parasites and their relation to types of cutaneous leishmaniasis lesions in Pakistan. J Dermatol 35: 76–85.
- 47.
Bhutto AM, Soomro FR, Baloch JH, Matsumoto J, Uezato H, Hashiguchi Y, Katakura K, 2009. Cutaneous leishmaniasis caused by Leishmania (L.) major infection in Sindh province, Pakistan. Acta Trop 111: 295–298.
- 48.↑
Marco JD, Bhutto AM, Soomro FR, Baloch JH, Barroso PA, Kato H, Uezato H, Katakura K, Korenaga M, Nonaka S, Hashiguchi Y, 2006. Multilocus enzyme electrophoresis and cytochrome B gene sequencing-based identification of Leishmania isolates from different foci of cutaneous leishmaniasis in Pakistan. Am J Trop Med Hyg 75: 261–266.
- 49.↑
Shakila A, Bilqees FM, Salim A, Moinuddin M, 2006. Geographical distribution of cutaneous leishmaniasis and sand flies in Pakistan. Turkiye Parazitol Derg 30: 1–6.
- 50.↑
Rab MA, Iqbal J, Azmi FH, Munir MA, Saleem M, 1989. Visceral leishmaniasis: a seroepidemiological study of 289 children from endemic foci in Azad Jammu and Kashmir by indirect fluorescent antibody technique. J Pak Med Assoc 39: 225–228.
- 51.
Rahim F, Rehman F, Ahmad S, Zada B, 1998. Visceral leishmaniasis in District Dir, NWFP. J Pak Med Assoc 48: 161–162.
- 52.↑
Rab MA, Evans DA, 1995. Leishmania infantum in the Himalayas. Trans R Soc Trop Med Hyg 89: 27–32.
- 53.↑
Momeni AZ, Aminjavaheri M, 1994. Clinical picture of cutaneous leishmaniasis in Isfahan, Iran. Int J Dermatol 33: 260–265.
- 54.↑
Bari AU, Hasshim R, Mahmood K, Muhammad I, Shahbaz N, Tariq KM, 2011. Clinico-epidemiological pattern of cutaneous leishmaniasis in armed forces personnel fighting war against terrorism in Khyber Pakhtunkhwa Province and Fata regions. J Pak Assoc Dermatol 21: 10–15.
- 55.↑
Reithinger R, Mohsen M, Wahid M, Bismullah M, Quinnell RJ, Davies CR, Kolaczinski J, David JR, 2005. Efficacy of thermotherapy to treat cutaneous leishmaniasis caused by Leishmania tropica in Kabul, Afghanistan: a randomized, controlled trial. Clin Infect Dis 40: 1148–1155.
- 56.↑
Klaus SN, Frankenburg S, Dhar AD, 2003. Leishmaniasis and other protozoan infections. Freedberg IM, Eisen AZ, Wolff K, Austen KF, Goldsmith LA, Si K, eds. Fitzpatrick's Dermatology in General Medicine, 6th edition. New York, NY: McGraw-Hill, 2215–2221.
- 57.↑
Pearson RD, Sousa ADQ, Jeronimo SMB, 2000. Leishmania species: visceral (Kala-Azar), cutaneous, and mucosal leishmaniasis. Mandell GL, Bennett JE, Dolin R, eds. Mandell, Douglas and Bennett's Principles and Practice of Infectious Disease, 5th edition, Vol. 2. Philadelphia, PA: Churchill Livingstone, 2831–2846.
- 58.↑
Mujtaba G, Khalid M, 1998. Cutaneous leishmaniasis in Multan, Pakistan. Int J Dermatol 37: 843–845.
- 59.↑
Bari AU, Ejaz A, 2009. Fissure leishmaniasis: a new variant of cutaneous leishmaniasis. Dermatol Online J 15: 13.