Introduction
Rodents are hosts to a wide range of zoonotic pathogens. Rodent-borne agents can be transmitted to humans directly through contact with rodents and their excretions or through rodent bites and indirectly by arthropod vectors including ticks, fleas, and mites. Croatia is a natural focus for many rodent-borne zoonoses because of its diverse forest ecology and wide range of rodent species. Different rodent species in Croatia have been implicated as reservoirs to several clinically important bacteria, protozoa, and viruses. The main rodent-associated bacteria include species of Anaplasma, Borrelia, Bartonella, Coxiella, Ehrlichia, Francisella, Leptospira, and Rickettsia. Infections with Leptospira and Borrelia are the most frequently reported from among this group. With a mean yearly infection incidence of 1.7 per 100,000 inhabitants, Croatia has one of the highest recorded incidences of human leptospirosis in the world.1 Borrelia infections result in two distinct tick-transmitted diseases, Lyme borreliosis and relapsing fever (RF). Both are endemic in Croatia with majority of cases of borreliosis reported in the northwest of the country.2 Q fever, caused by Coxiella burnetii is endemic in parts of southern Croatia.3,4 Limited data exist on tick-transmitted Rickettsia, Anaplasma, and Ehrlichia.5 Human cases of anaplasmosis and rickettsiosis have been reported in Croatia, but little data are available on ehrlichiosis.6,7 Infections with Francisella tularensis, the agent of tularemia, are occasionally reported in Croatia, particularly in Sava Valley in the central part of the country.8 Bartonella spp. are hemotropic bacteria detected in many mammals, predominantly rodents.9 Many species and subspecies of Bartonella circulate in European rodents, although the pathogenicity of many of these species is as yet undetermined. In addition, the diversity of Bartonella spp. present in rodents in Croatia has not been examined.
Hantaviruses are the viruses most frequently associated with rodents in Croatia. These include Dobrava (DOBV) and Puumala (PUUV) viruses, implicated in hemorrhagic fever with renal syndrome, and the nonpathogenic Tula (TULV) and Saaremaa viruses.10–14 Rodents can also be infected with flaviviruses, orthopoxviruses, and lymphocytic choriomeningitis virus (LCMV); however, to our knowledge, there are no published reports of investigation for the presence of these viruses in Croatia.15–17 Rodents in Croatia are also reservoirs of protozoan Apicomplexa parasites, including Toxoplasma and Babesia that cause toxoplasmosis and babesiosis, respectively, mainly in immunocompromised individuals.
Here, we report results of analysis of rodents and small mammals trapped in eight localities in Croatia for the presence of a wide range of known zoonotic human pathogens.
Materials and Methods
Sample collection.
This survey was an extension of a project designed to assess the distribution of small rodents in diverse forest ecosystems in Croatia. Between 2003 and 2011, rodents were trapped in eight different localities in Croatia: Ivanić-Grad, Mikanovci, Ilok, Cerna, Papuk, Žutica, Draganić, and Sušica (Figure 1). In each of three selected geographic transects at each location, 100 traps were placed. The distance between the traps was approximately 7 m and the distance between the transects was approximately 150 m. Each transect was at least 50 m away from the edge of the forest stands. Each of these localities includes forest ecosystems without proximity to urban areas. All rodents were trapped using Sherman-type live traps and were morphologically characterized to species.18 Species identification of Apodemus flavicollis and Apodemus sylvaticus was confirmed by PCR (polymerase chain reaction) targeting the mitochondrial cytochrome b gene and sequencing of PCR products.19,20 A total of 242 animals were collected, including 131 yellow-necked mouse (A. flavicollis), 53 striped field mouse (Apodemus agrarius), three wood mouse (A. sylvaticus), 43 bank voles (Myodes glareolus), six common shrews (Sorex araneus), four common voles (Microtus arvalis), one field vole (Microtus agrestis), and one common dormouse (Muscardinus avellanarius). Animal experimentation guidelines of the American Society of Mammologists was followed during all animal work.21 After euthanasia, kidney and lung samples were collected from individual specimens and stored at −80°C.
Map in Croatia indicating the regions where the rodents were trapped.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Map in Croatia indicating the regions where the rodents were trapped.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Map in Croatia indicating the regions where the rodents were trapped.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Nucleic acid extraction and complementary DNA synthesis.
A total of 323 organ specimens were available for PCR analysis. These consisted of lung samples acquired from 237 animals and kidney samples from 86 animals. At least one organ (lung or kidney) was available for PCR analysis from all 242 animals. In cases where both lung and kidney samples were available from an individual animal, both were tested by PCR. Tissues were homogenized using TissueLyser and 5-mm beads for homogenization (Qiagen, Hilden, Germany). DNA and RNA were extracted from each sample using the AllPrep DNA/RNA Mini Kit (Qiagen). DNA from each sample was eluted in 100 μL EB Buffer and RNA from each sample was eluted in 40 μL RNase-free water. Nucleic acid concentration was assessed with the NanoDrop Spectrophotometer (Thermo Scientific, Waltham, MA). Complementary DNA (cDNA) was prepared in a 20 μL reaction using 5 μL extracted RNA and SuperScript II Reverse Transcriptase (Invitrogen, Carlsbad, CA).
Polymerase chain reaction.
MassTag PCR was performed using primers for detection of Lyme borreliosis–associated Borrelia spp., Bartonella spp., Ehrlichia spp., Anaplasma spp., F. tularensis, C. burnetii, Rickettsia spp., RF Borrelia spp., and Babesia spp. (Table 1).22,23,29 Of template DNA, 2 μL was used in all reactions. Reaction conditions were 94°C for 15 minutes; one cycle at 94°C for 30 seconds, 65°C for 30 seconds, and 72°C for 30 seconds, followed by 11 cycles with annealing temperature decreased by 1°C in each cycle. The final PCR was run for 38 cycles at 94°C for 30 seconds, 54°C for 30 seconds, and 72°C for 30 seconds.
Primer sequences used for pathogen detection
| Pathogen | Gene target | Primer sequence | Reference |
|---|---|---|---|
| Lyme borreliosis–associated Borrelia spp. | flaB | Fwd: GCAATGACAAAACATATTGRGGAASTTGA | 22 |
| Rev: YACAATGACMGATGAGGTTGTRGC | |||
| Relapsing fever Borrelia spp. | flaB | Fwd: GCTGAAGAGCTTGGAATGCAAC | 23 |
| Rev: GCAATTGCYTCATCCTGATTTG | |||
| Bartonella spp. | hbpA | Fwd: CTTCTGCRGCACAAGCTGCTGAT | 22 |
| Rev: CCACCAATATARAAACCTGTCCAAGA | |||
| Ehrlichia spp. | 16SrRNA | Fwd: CGTAAAGGGCACGTAGGTGGACTA | 22 |
| Rev: CACCTCAGTGTCAGTATCGARCCA | |||
| Anaplasma spp. | 16SrRNA | Fwd: GGGCATGTAGGCGGTTCGGT | 22 |
| Rev: TCAGCGTCAGTACCGGACCA | |||
| Francisella tularensis | fopA | Fwd: ATGTTTCGGCATGTGAATAGTTAA | 22 |
| Rev: ACCACTGCTTTGTGTAGTAGCTGAA | |||
| Coxiella burnetii | IS1111 | Fwd: GCTCCTCCACACGCTTCCAT | 22 |
| Rev: GGTTCAACTGTGTGGAATTGATGAGT | |||
| Rickettsia spp. | ompB | Fwd: YAAAAGTCAGCGTTACTTCTTYGA | 22 |
| Rev: YGCTTRTTTGCAACTGTTGTACC | |||
| Babesia spp. | 18SrRNA | Fwd: CGACTAGDGATTGGDGGTCGTC | This study |
| Rev: CTHTGTCTGGACCTGGTGAGKTT | |||
| Lymphocytic choriomeningitis virus | RdRp | Fwd: CCACTYTTGTCTGCACTGTCTAT | This study |
| Rev: CTTTTTGATGCGCAATGGAT | |||
| Orthopoxvirus | VETFS | Fwd: ACCAACTATATTACCTCATCAGTTA | This study |
| Rev: TTAAACAAGTTCATAGCTACACCCA | |||
| Flavivirus | NS5 | Fwd: ATGGCHATGACNGACACNAC | This study |
| Rev: TTCTTYTCTCTYTTNCCCATCAT | |||
| Toxoplasma gondii | B1 | Fwd: GAAGAGATCCAGCAGATCTCGT | This study |
| Rev: TGAGAGGAGGCAGCACAAG | |||
| Puumala/Tula hantavirus | N | Fwd1: TATGGIAATGTCCTTGATGT | 24 |
| Rev1: GCACAIGCAAAIACCCA | |||
| Fwd2: CCIAGTGGICAIACAGC | 24 | ||
| Rev2: AAICCIATIACICCCAT | |||
| Dobrava hantavirus | G | Fwd1: GGACCAGGTGCAGCTTGTGAAGC | 25 |
| Rev1: ACCTCACAAACCATTGAACC | |||
| Fwd2: ATGCCAGCGAGTCGACCAA | 26 | ||
| Rev2: GAGCTATTATGTAAGATTGC | |||
| Leptospira spp. | LA0322 | FwdA: CATTCATGTTTCGAATCATTTCAAA | 27 |
| RevA: GCCCAAGTTCCTTCTAAAAG | |||
| secY | FwdB: GAATTTCTCTTTTGATCTTCG | 28 | |
| RevB: GAGTTAGAGCTCAAATCTAAG | |||
| Bartonella spp.* | gltA | Fwd: GGTCTATCAYGACTCKATTGATATTA | This study |
| Rev: GCACGTGGRTCATAATTTTTATARAC | |||
| 16SrRNA | Fwd: ATAGCAAGTCGAGCGCRCT | This study | |
| Rev: GCCCGACGGCTAACATTC | |||
| Borrelia spp.* | flaB | Fwd: GGGGATGATYATMAATCATAATAC | This study |
| Rev: TGCAATCATWGCCATTGC | |||
| Babesia spp.* | 18SrRNA | Fwd: TTCGACGGTAKGGTATTGGC | This study |
| Rev: GGGAATTTCACCTCTGACAGTYAA |
Consensus genus primers used for species discrimination.
All samples that were positive on the MassTag PCR assay were retested in individual PCR assays for the microbe(s) of interest using the same primer pairs. The presence of relevant sequence in the resulting PCR product was required as confirmation before a sample was declared agent positive. In cases where species differentiation was required, we designed primers within a discriminatory region of the genome to amplify partial sequences that were then compared with existing genomic data from GenBank. To discriminate among Bartonella spp., we designed primer pairs that amplified 513 nucleotides (nts) of the gltA gene and 800 nts of the 16SrRNA gene. For Babesia spp., we used a primer pair that amplified 607 nts of the 18SrRNA gene, and for Borrelia spp., an assay targeting the flaB gene amplified a sequence of 966 nts (Table 1). Sequences for Baronella spp. and Borrelia miyamotoi were deposited in GenBank under accession nos. KT452901–KT452935. All alignments were generated in Geneious v 6.1.5 (Biomatters Ltd., Auckland, New Zealand). Maximum-likelihood phylogenetic tree for Bartonella was constructed using the Jukes–Cantor model with 1,000 bootstrap replicates in Mega 6.0.30
All samples were additionally tested for LCMV, orthopoxvirus, flaviviruses, hantaviruses, and Toxoplasma gondii in single-agent PCR assays. For detection of RNA viruses, 2 μL cDNA were used as template. For the detection of orthopoxviruses and T. gondii, 2 μL DNA was used. Nested PCR assays were used to detect the presence of hantaviruses (PUUV, DOBV, and TULV).24–26 All primer sequences are listed in Table 1. PCR products were size-fractionated in 1% agarose gels and visualized using ethidium bromide before purification for dideoxy sequencing.
Detection of Leptospira by renal tissue culture and PCR.
Kidney tissue from each animal (N = 242) was available for Leptospira detection. Tissue was inoculated into Korthof's medium for isolation and stabilization of Leptospira isolates. Isolates were grown to a density of 2–4 × 108/mL and harvested by centrifugation at 14,000 rpm. Genomic DNA was extracted from each kidney tissue using the QIAamp DNA Mini Kit (Qiagen). Two PCR assays were used for species identification. In the first assay, real-time PCR was used as described by Merien and others27 with a primer set that amplified 331 nts of the locus LA0322 obtained from the complete genome sequence of Leptospira interrogans serovar Lai. All specimens were tested 10 times and mean melting temperatures were calculated to distinguish Leptospira genomic species. In a second assay, PCR was done with primers that amplified a 658-nt segment of secY that includes a 245-nt fragment suitable for rapid phylogenetic determination.28 Amplified products were visualized in a 1.5% agarose gel, and their sizes were estimated by comparison with a 100-bp ladder (Amersham Biosciences, Little Chalfont, Buckinghamshire, United Kingdom). PCR products were purified by QIAquick PCR Purification Kit (Qiagen) and sequenced. DNA sequence clustal alignments were done using the LaserGene software package (DNASTAR, LaserGene, Madison, WI). In addition, a primer set that amplified a 563-nt DNA fragment of Leptospira kirschneri was used to confirm the speciation of L. kirschneri isolates.31
Results
In our survey, 114 of 242 rodents (47%) were positive for at least one agent. Polymicrobial infections were detected in 32 rodents (13%). Dual infections were detected in 26 rodents (11%), triple infections in four rodents (3%), and quadruple infections in two rodents (0.8%) (Table 2).
Summary of all agents and coinfections detected in different rodent species
| N | Apodemus flavicollis | Apodemus agrarius | Apodemus sylvaticus | Myodes glareolus | Sorex araneus | Microtus arvalis | Microtus agrestis | Muscardinus avellanarius | |
|---|---|---|---|---|---|---|---|---|---|
| Total | 242 | 131 | 53 | 3 | 43 | 6 | 4 | 1 | 1 |
| Borrelia afzelii | 5 | 2 | 1 | – | 3 | – | – | – | – |
| Bartonella spp. | 29 | 16 | 7 | – | 5 | 1 | – | – | – |
| Babesia microti | 8 | 4 | 3 | – | – | – | – | 1 | – |
| Ehrlichia spp. | 2 | 1 | 1 | – | – | – | – | – | – |
| Borrelia miyamotoi | 9 | 1 | 7 | – | – | 1 | – | – | – |
| Anaplasma spp. | 4 | 3 | – | – | 1 | – | – | – | – |
| Francisella tularensis | 2 | – | 2 | – | – | – | – | – | – |
| Leptospira spp. | 52 | 37 | 12 | – | 1 | – | 1 | – | 1 |
| Hantavirus | 43 | 36 | 2 | – | 4 | – | 1 | – | – |
| DOBV | 38 | 36 | 2 | – | – | – | – | – | – |
| PUUV | 4 | – | – | – | 4 | – | – | – | – |
| TULV | 1 | – | – | – | – | – | 1 | – | – |
| Orthopoxvirus | 1 | – | – | – | 1 | – | – | – | – |
| Infections with two agents | |||||||||
| Leptospira, B. afzelii | 1 | 1 | – | – | – | – | – | – | – |
| Leptospira, Ehrlichia | 1 | – | 1 | – | – | – | – | – | – |
| Leptospira, B. microti | 1 | 1 | – | – | – | – | – | – | – |
| Leptospira, Bartonella | 3 | 3 | – | – | – | – | – | – | – |
| Leptospira, Anaplasma | 1 | 1 | – | – | – | – | – | – | – |
| Leptospira, B. miyamotoi | 3 | 1 | 2 | – | – | – | – | – | – |
| Leptospira, TULV | 1 | – | – | – | – | – | 1 | – | – |
| Leptospira, DOBV | 10 | 10 | – | – | – | – | – | – | |
| Bartonella, DOBV | 3 | 3 | – | – | – | – | – | – | – |
| B. microti, B. miyamotoi | 1 | – | 1 | – | – | – | – | – | – |
| Anaplasma, DOBV | 1 | 1 | – | – | – | – | – | – | – |
| Infections with three agents | |||||||||
| Leptospira, B. afzelii, B. microti | 1 | 1 | – | – | – | – | – | – | |
| Bartonella, Anaplasma, DOBV | 1 | 1 | – | – | – | – | – | – | – |
| B. microti, Leptospira, DOBV | 2 | 2 | – | – | – | – | – | – | – |
| Infections with four agents | |||||||||
| Bartonella, B. afzelii, Leptospira, DOBV | 1 | 1 | – | – | – | – | – | – | – |
| Bartonella, F. tularensis, Leptospira, DOBV | 1 | – | 1 | – | – | – | – | – | – |
DOBV = Dobrava virus; PUUV = Puumala virus; TULV = Tula virus.
Leptospira.
Leptospira species were the most frequently detected agents with 52 Leptospira-positive rodents (21%). Apodemus spp. have previously been implicated as reservoirs of Leptospira in Croatia.32,33 Consistent with this earlier work, we found that 49 of 52 Leptospira-positive rodents represented Apodemus spp. Bacterial isolation from kidney tissue was successful in 40 PCR-positive rodents, and speciation assays indicated that 22 were L. interrogans, 16 L. kirschneri, and two Leptospira borgpetersenii.
Borrelia.
Five rodents were positive for Lyme borreliosis–associated Borrelia spp. All were identified as Borrelia afzelii (> 99% identity with B. afzelii PKo strain, accession no. CP002933). The presence of this species in Croatian rodents has been reported previously.34 Although Borrelia garinii is known to circulate in Croatia, we did not detect any rodents infected with this species. RF Borrelia was detected in nine rodents (4%) from four different localities. All RF Borrelia were identified as B. miyamotoi (> 99% identity with LB-2001 strain, accession no. CP006647) with the majority (7/9) detected in A. agrarius. Two B. miyamotoi-positive rodents originated from Ivanić-Grad in the central part of Croatia, and the remaining seven were trapped in the eastern end of the country.
Bartonella.
Bartonella spp. were detected in 29 animals (12%) in six different localities with the highest prevalence in Ilok and Draganić (26.7% and 25.0%, respectively). Although A. flavicollis was the most frequent reservoir of Bartonella in this study (9 of 29 Bartonella-positive rodents) and in earlier studies,35 A. agrarius as well as M. glareolus and S. araneus were also positive for Bartonella. To determine the phylogeny of Bartonella in these rodents, we obtained partial sequences of 16SrRNA and gltA genes by PCR. Previous reports have indicated that sequence analysis of 16SrRNA gene alone is inadequate for species/genotype demarcation in Bartonella, and an additional loci need to be analyzed, with gltA the preferred gene used to establish Bartonella phylogeny.36 Our analysis based on a 388-nt gltA sequence indicated that representatives of six putative Bartonella species were present in the these rodents (Figure 2). Five rodents were infected with strains representative of Bartonella grahamii and nine rodents were infected with strains of Bartonella taylorii. Both species are distributed throughout Eurasia and are frequently detected in Apodemus and Myodes rodents.37,38 A single A. flavicollis was infected with a strain that clustered with Bartonella elizabethae species group. Seven A. flavicollis were infected with a genotype similar to strain N40 isolated from A. sylvaticus from the United Kingdom.39 On the basis of high sequence divergence relative to other strains and a distinct gltA phylogenic clade formed by this group, we speculate that this genotype constitutes a new Bartonella species. Sequences obtained from six A. agrarius formed a monophyletic clade and likely constitute another potential novel Bartonella species. We also detected a single Bartonella strain (ARH567) in A. agrarius that clustered with AR15-3 strain from the United States (FN645480) and strains from Sweden (AY454539), Siberia (EF682090). Analysis of the 16SrRNA sequence indicated that ARH567 was > 99% identical to B. rochalimae (strain BAA-1498, accession no. FN645459) and thus may constitute a B. rochalimae subspecies.
Maximum likelihood phylogenetic tree based on a 388-nucleotide fragment of Bartonella gltA gene. All sequences obtained in this study are indicated by * and the six species they cluster into are shown in gray. Only select relevant sequences from GenBank are shown in the tree.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Maximum likelihood phylogenetic tree based on a 388-nucleotide fragment of Bartonella gltA gene. All sequences obtained in this study are indicated by * and the six species they cluster into are shown in gray. Only select relevant sequences from GenBank are shown in the tree.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Maximum likelihood phylogenetic tree based on a 388-nucleotide fragment of Bartonella gltA gene. All sequences obtained in this study are indicated by * and the six species they cluster into are shown in gray. Only select relevant sequences from GenBank are shown in the tree.
Citation: The American Society of Tropical Medicine and Hygiene 94, 2; 10.4269/ajtmh.15-0517
Babesia.
Eight rodents from five localities were infected with Babesia, all identified as Babesia microti (100% identity to strain Jena, accession no. EF413181). Previous work has implicated A. flavicollis and M. glareolus as the primary reservoirs for B. microti in Europe.40 Of the eight positive rodents in our study, three were A. agrarius and one M. agrestis, implicating these species as additional reservoirs of Babesia spp.
Hantaviruses.
Hantaviruses were the second most frequently detected pathogens. Of 43 hantavirus-positive rodents, 38 were infected with DOBV, four with PUUV, and a single rodent was infected with TULV. Hantavirus-positive rodents originated from seven different locations with the highest prevalence in Žutica (34.5%) and Ilok (20%) (Table 3). Among Apodemus species, 28% of A. flavicollis and 2% of A. agrarius were DOBV positive. The highest prevalence of DOBV-positive rodents (30%) was in Žutica (Table 3). PUUV was detected in M. glareolus and TULV was detected in M. arvalis, similar to previous reports.12
Number of agent-positive rodents at each trapping site
| Ivanić-Grad | Mikanovci | Ilok | Cerna | Papuk | Žutica | Draganić | Sušica | Total | |
|---|---|---|---|---|---|---|---|---|---|
| N = 39 | N = 28 | N = 30 | N = 9 | N = 18 | N = 87 | N = 16 | N = 15 | 242 | |
| Borrelia afzelii | – | 1 | – | – | – | 3 | 0 | 1 | 5 |
| Bartonella | 4 | 1 | 8 | – | 2 | 10 | 4 | – | 29 |
| Babesia microti | 1 | 2 | – | 1 | – | 3 | 1 | – | 8 |
| Ehrlichia | 1 | 1 | – | – | – | – | – | – | 2 |
| Borrelia miyamotoi | 2 | 4 | 1 | 2 | – | – | – | – | 9 |
| Anaplasma | – | – | – | – | 3 | 1 | – | – | 4 |
| Francisella tularensis | – | – | – | – | 0 | 0 | 2 | – | 2 |
| Leptospira | 4 | 11 | 9 | 1 | 1 | 24 | – | 1 | 52 |
| Hantaviruses | 1 | 1 | 6 | – | 3 | 30 | 1 | 1 | 43 |
| DOBV | 1 | – | 6 | – | 3 | 26 | 1 | 1 | 38 |
| PUUV | – | – | – | – | – | 4 | – | – | 4 |
| TULV | – | 1 | – | – | – | – | – | – | 1 |
| Orthopoxvirus | – | – | – | – | – | 1 | – | – | 1 |
DOBV = Dobrava virus; PUUV = Puumala virus; TULV = Tula virus.
Other agents.
Francisella tularensis was detected in two A. agrarius from the Draganić site. One rodent was positive for orthopoxvirus. This is the first report of F. tularensis and orthopoxvirus infection in rodents in Croatia. Four rodents were positive for Anaplasma and two for Ehrlichia. Rickettsia, C. burnetii, LCMV, flaviviruses, and T. gondii were not detected. Among the agents detected, RF Borrelia, Bartonella, Babesia, Ehrlichia, and hantaviruses were detected in nucleic acids isolated from both lung and kidney tissues; Anaplasma, Francisella, and B. afzelii were detected in nucleic acids isolated only from lung tissue.
Discussion
In this study, we demonstrate the presence of multiple zoonotic pathogens in rodent species present in Croatia. Although this study was not designed to demonstrate a linkage between the presence of these agents and human disease, the data presented here may provide insight into assessing the risk of rodent-borne zoonoses in Croatia.
Leptospira spp. and hantaviruses were the human pathogens most frequently detected in our study. The high prevalence of Leptospira-positive rodents parallels recent surveys in Croatia that revealed Leptospira infection in > 20% of rodents. The majority of Leptospira-positive rodents reported here were Apodemus species. In our previous work, Leptospira spp. were isolated from 13 of 28 A. flavicollis captured in Žutica forest.41 Leptospira interrogans, L. kirschneri, and L. borgpetersenii were identified as the Leptospira species in our study, similar to previous reports from Croatian rodents.32,33 Hantavirus and Leptospira also represented the most frequent coinfections. We previously showed coinfections with both agents in humans10 and rodents41,42 highlighting the potential risk for simultaneous transmission of these pathogens. The clinical underestimation of hantavirus and Leptospira coinfections was recently emphasized.43
The genus Bartonella contains over 30 named species. Approximately 20 are adapted to wild rodents and six of these have caused documented human infections.37 We detected the presence of six putative species present in Croatian rodents. Our data provide insight into the diversity of Bartonella in Croatia and the high overall genetic diversity of this genus worldwide. The extent of human infections associated with rodent-borne Bartonella is unknown as data regarding the incidence of zoonotic human Bartonella infections in Europe are not available. However, despite a relatively high prevalence of infected rodents, based on existing reports of infections due to rodent-borne Bartonella, we anticipate that the risk of human infection is low.
In this study, we report the first evidence of Borrelia miyamotoi in Croatia and have implicated Apodemus mice as reservoirs, similar to recent report from Switzerland.44 Borrelia miyamotoi is an emerging tick-borne pathogen phylogenetically classified within the RF Borrelia group. Originally detected in Asia, it was subsequently detected in North America and Europe.23,45,46 Recent work has also implicated it as a potential cause of meningoencephalitis.47,48
The prevalence of Anaplasma spp. infection in our study was 1.7%. Anaplasma spp. were detected in only two locations in central Croatia (Papuk and Žutica) among A. flavicollis and M. glareolus. Anaplasma spp. were previously reported in small rodents elsewhere in Europe,49 but not in Croatia. Ehrlichia spp. were detected in only two rodents (0.8%) of genus Apodemus in two locations (Ivanić-Grad and Mikanovci).
A limitation of this study was the unavailability of organs other than lungs and kidneys for analysis. This is because we used samples banked during the course of a hantavirus and Leptospira surveillance project wherein only lungs and kidneys were collected. Thus, we may have missed some bacteria and viruses that concentrate in other organs. Furthermore, we did not screen for all rodent-associated agents, nor did we pursue unbiased sequencing. Nonetheless, our data indicate that small rodents in Croatia are reservoirs for a wide range of viral, bacterial, and protozoan pathogens. We also demonstrated a high rate of coinfections that may have important implications for simultaneous transmission to humans.
- 1.↑
Topic MB, Habus J, Milas Z, Tosev EC, Stritof Z, Turk N, 2010. Human leptospirosis in Croatia: current status of epidemiology and clinical characteristics. Trans R Soc Trop Med Hyg 104: 202–206.
- 2.↑
Mulic R, Antonijevic S, Klismanic Z, Ropac D, Lucev O, 2006. Epidemiological characteristics and clinical manifestations of Lyme borreliosis in Croatia. Mil Med 171: 1105–1109.
- 3.↑
Milotic I, Miletic B, Morovic M, 2001. Clinical, epidemiological and epizootic features of Q fever in the northern coastal part of Croatia from 1989 to 1998. Acta Med Croatica 55: 53–57.
- 4.↑
Arricau-Bouvery N, Rodolakis A, 2005. Is Q fever an emerging or re-emerging zoonosis? Vet Res 36: 327–349.
- 5.↑
Schex S, Dobler G, Riehm J, Muller J, Essbauer S, 2011. Rickettsia spp. in wild small mammals in Lower Bavaria, south-eastern Germany. Vector Borne Zoonotic Dis 11: 493–502.
- 6.↑
Punda-Polic V, Luksic B, Capkun V, 2008. Epidemiological features of Mediterranean spotted fever, murine typhus, and Q fever in Split-Dalmatia County (Croatia), 1982–2002. Epidemiol Infect 136: 972–979.
- 7.↑
Misic-Majerus L, Bujic N, Madaric V, Avsic-Zupanc T, Milinkovic S, 2006. Human anaplasmosis (ehrlichiosis) [in Croatian]. Acta Med Croatica 60: 411–419.
- 8.↑
Borcic B, Hrabar A, Dulic B, Tvrtkovic N, Bilic V, Mikacic D, 1976. Ecological features of the tularemia natural focus in central Posavina (Croatia). Folia Parasitol (Praha) 23: 257–265.
- 9.↑
Kosoy M, Hayman DT, Chan KS, 2012. Bartonella bacteria in nature: where does population variability end and a species start? Infect Genet Evol 12: 894–904.
- 10.↑
Markotic A, Kuzman I, Babic K, Gagro A, Nichol S, Ksiazek TG, Rabatic S, Dekaris D, 2002. Double trouble: hemorrhagic fever with renal syndrome and leptospirosis. Scand J Infect Dis 34: 221–224.
- 11.
Markotic A, Nichol ST, Kuzman I, Sanchez AJ, Ksiazek TG, Gagro A, Rabatic S, Zgorelec R, Avsic-Zupanc T, Beus I, Dekaris D, 2002. Characteristics of Puumala and Dobrava infections in Croatia. J Med Virol 66: 542–551.
- 12.↑
Scharninghausen JJ, Pfeffer M, Meyer H, Davis DS, Honeycutt RL, Faulde M, 2002. Genetic evidence for Tula virus in Microtus arvalis and Microtus agrestis populations in Croatia. Vector Borne Zoonotic Dis 2: 19–27.
- 13.
Cvetko L, Markotic A, Plyusnina A, Margaletic J, Miletic-Medved M, Turk N, Milas Z, Avsic-Zupanc T, Plyusnin A, 2005. Puumala virus in Croatia in the 2002 HFRS outbreak. J Med Virol 77: 290–294.
- 14.↑
Plyusnina A, Krajinovic LC, Margaletic J, Niemimaa J, Nemirov K, Lundkvist A, Markotic A, Miletic-Medved M, Avsic-Zupanc T, Henttonen H, Plyusnin A, 2011. Genetic evidence for the presence of two distinct hantaviruses associated with Apodemus mice in Croatia and analysis of local strains. J Med Virol 83: 108–114.
- 16.
Tagliapietra V, Rosa R, Hauffe HC, Laakkonen J, Voutilainen L, Vapalahti O, Vaheri A, Henttonen H, Rizzoli A, 2009. Spatial and temporal dynamics of lymphocytic choriomeningitis virus in wild rodents, northern Italy. Emerg Infect Dis 15: 1019–1025.
- 17.↑
Knap N, Korva M, Dolinsek V, Sekirnik M, Trilar T, Avsic-Zupanc T, 2012. Patterns of tick-borne encephalitis virus infection in rodents in Slovenia. Vector Borne Zoonotic Dis 12: 236–242.
- 18.↑
Niethamer J, Krapp F, 1982. Handbuch der Saugetiere Europas: Nagetiere 2/1. Akad Verlag Wiesbaden 2: 51–491.
- 19.↑
Dekonenko A, Yakimenko V, Ivanov A, Morozov V, Nikitin P, Khasanova S, Dzagurova T, Tkachenko E, Schmaljohn C, 2003. Genetic similarity of Puumala viruses found in Finland and western Siberia and of the mitochondrial DNA of their rodent hosts suggests a common evolutionary origin. Infect Genet Evol 3: 245–257.
- 20.↑
Essbauer S, Schmidt J, Conraths FJ, Friedrich R, Koch J, Hautmann W, Pfeffer M, Wolfel R, Finke J, Dobler G, Ulrich R, 2006. A new Puumala hantavirus subtype in rodents associated with an outbreak of Nephropathia epidemica in south-east Germany in 2004. Epidemiol Infect 134: 1333–1344.
- 21.↑
Sikes RS, Gannon WL, 2011. Guidelines of the American Society of Mammalogists for the use of wild mammals in research. J Mammal 92: 235–253.
- 22.↑
Tokarz R, Kapoor V, Samuel JE, Bouyer DH, Briese T, Lipkin WI, 2009. Detection of tick-borne pathogens by MassTag polymerase chain reaction. Vector Borne Zoonotic Dis 9: 147–152.
- 23.↑
Tokarz R, Jain K, Bennett A, Briese T, Lipkin WI, 2010. Assessment of polymicrobial infections in ticks in New York State. Vector Borne Zoonotic Dis 10: 217–221.
- 24.↑
Bowen MD, Gelbmann W, Ksiazek TG, Nichol ST, Nowotny N, 1997. Puumala virus and two genetic variants of Tula virus are present in Austrian rodents. J Med Virol 53: 174–181.
- 25.↑
Chu YK, Jennings GB, Schmaljohn CS, 1995. A vaccinia virus-vectored Hantaan virus vaccine protects hamsters from challenge with Hantaan and Seoul viruses but not Puumala virus. J Virol 69: 6417–6423.
- 26.↑
Avsic-Zupanc T, Nemirov K, Petrovec M, Trilar T, Poljak M, Vaheri A, Plyusnin A, 2000. Genetic analysis of wild-type Dobrava hantavirus in Slovenia: co-existence of two distinct genetic lineages within the same natural focus. J Gen Virol 81: 1747–1755.
- 27.↑
Merien F, Portnoi D, Bourhy P, Charavay F, Berlioz-Arthaud A, Baranton G, 2005. A rapid and quantitative method for the detection of Leptospira species in human leptospirosis. FEMS Microbiol Lett 249: 139–147.
- 28.↑
Victoria B, Ahmed A, Zuerner RL, Ahmed N, Bulach DM, Quinteiro J, Hartskeerl RA, 2008. Conservation of the S10-spc-alpha locus within otherwise highly plastic genomes provides phylogenetic insight into the genus Leptospira. PLoS One 3: e2752.
- 29.↑
Briese T, Palacios G, Kokoris M, Jabado O, Liu Z, Renwick N, Kapoor V, Casas I, Pozo F, Limberger R, Perez-Brena P, Ju J, Lipkin WI, 2005. Diagnostic system for rapid and sensitive differential detection of pathogens. Emerg Infect Dis 11: 310–313.
- 30.↑
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 2725–2729.
- 31.↑
Gravekamp C, Van de Kemp H, Franzen M, Carrington D, Schoone GJ, Van Eys GJ, Everard CO, Hartskeerl RA, Terpstra WJ, 1993. Detection of seven species of pathogenic leptospires by PCR using two sets of primers. J Gen Microbiol 139: 1691–1700.
- 32.↑
Stritof Majetic Z, Galloway R, Ruzic Sabljic E, Milas Z, Mojcec Perko V, Habus J, Margaletic J, Pernar R, Turk N, 2014. Epizootiological survey of small mammals as Leptospira spp. reservoirs in eastern Croatia. Acta Trop 131: 111–116.
- 33.↑
Turk N, Milas Z, Margaletic J, Staresina V, Slavica A, Riquelme-Sertour N, Bellenger E, Baranton G, Postic D, 2003. Molecular characterization of Leptospira spp. strains isolated from small rodents in Croatia. Epidemiol Infect 130: 159–166.
- 34.↑
Turk N, Milas Z, Margaletic J, Turk R, Barbic L, Konjevic D, Peric S, Stritof Z, Staresina V, 2008. The role of fat dromouse (Glis glis L.) as reservoir host for spirochete Borrelia burgdorferi sensu lato in the region of Gorski Kotar, Croatia. Eur J Wildl Res 54: 117–121.
- 35.↑
Tea A, Alexiou-Daniel S, Papoutsi A, Papa A, Antoniadis A, 2004. Bartonella species isolated from rodents, Greece. Emerg Infect Dis 10: 963–964.
- 36.↑
La Scola B, Zeaiter Z, Khamis A, Raoult D, 2003. Gene-sequence-based criteria for species definition in bacteriology: the Bartonella paradigm. Trends Microbiol 11: 318–321.
- 37.↑
Buffet JP, Kosoy M, Vayssier-Taussat M, 2013. Natural history of Bartonella-infecting rodents in light of new knowledge on genomics, diversity and evolution. Future Microbiol 8: 1117–1128.
- 38.↑
Welc-Faleciak R, Paziewska A, Bajer A, Behnke JM, Sinski E, 2008. Bartonella spp. infection in rodents from different habitats in the Mazury Lake District, northeast Poland. Vector Borne Zoonotic Dis 8: 467–474.
- 39.↑
Birtles RJ, Raoult D, 1996. Comparison of partial citrate synthase gene (gltA) sequences for phylogenetic analysis of Bartonella species. Int J Syst Bacteriol 46: 891–897.
- 40.↑
Beck R, Vojta L, Curkovic S, Mrljak V, Margaletic J, Habrun B, 2011. Molecular survey of Babesia microti in wild rodents in central Croatia. Vector Borne Zoonotic Dis 11: 81–83.
- 41.↑
Tadin A, Turk N, Korva M, Margaletic J, Beck R, Vucelja M, Habus J, Svoboda P, Zupanc TA, Henttonen H, Markotic A, 2012. Multiple co-infections of rodents with hantaviruses, Leptospira, and Babesia in Croatia. Vector Borne Zoonotic Dis 12: 388–392.
- 42.↑
Cvetko L, Turk N, Markotic A, Milas Z, Margaletic J, Miletic-Medved M, Plyusnin A, Baranton G, Postic D, Avsic-Zupanc T, 2006. Short report: dual infections with Puumala virus and Leptospira interrogans serovar Lora in a bank vole (Clethrionomys glareolus). Am J Trop Med Hyg 74: 612–614.
- 43.↑
Sunil-Chandra NP, Clement J, Maes PDE, Silva H, Van Esbroeck M, Van Ranst M, 2015. Concomitant leptospirosis-hantavirus co-infection in acute patients hospitalized in Sri Lanka: implications for a potentially worldwide underestimated problem. Epidemiol Infect 143: 2081–2093.
- 44.↑
Burri C, Schumann O, Schumann C, Gern L, 2014. Are Apodemus spp. mice and Myodes glareolus reservoirs for Borrelia miyamotoi, Candidatus Neoehrlichia mikurensis, Rickettsia helvetica, R. monacensis and Anaplasma phagocytophilum? Ticks Tick Borne Dis 5: 245–251.
- 45.↑
Fukunaga M, Takahashi Y, Tsuruta Y, Matsushita O, Ralph D, McClelland M, Nakao M, 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Bacteriol 45: 804–810.
- 46.↑
Platonov AE, Karan LS, Kolyasnikova NM, Makhneva NA, Toporkova MG, Maleev VV, Fish D, Krause PJ, 2011. Humans infected with relapsing fever spirochete Borrelia miyamotoi, Russia. Emerg Infect Dis 17: 1816–1823.
- 47.↑
Hovius JW, de Wever B, Sohne M, Brouwer MC, Coumou J, Wagemakers A, Oei A, Knol H, Narasimhan S, Hodiamont CJ, Jahfari S, Pals ST, Horlings HM, Fikrig E, Sprong H, van Oers MH, 2013. A case of meningoencephalitis by the relapsing fever spirochaete Borrelia miyamotoi in Europe. Lancet 382: 658.
- 48.↑
Gugliotta JL, Goethert HK, Berardi VP, Telford SR 3rd, 2013. Meningoencephalitis from Borrelia miyamotoi in an immunocompromised patient. N Engl J Med 368: 240–245.
- 49.↑
Bown KJ, Begon M, Bennett M, Woldehiwet Z, Ogden NH, 2003. Seasonal dynamics of Anaplasma phagocytophila in a rodent-tick (Ixodes trianguliceps) system, United Kingdom. Emerg Infect Dis 9: 63–70.