• View in gallery

    County map of Connecticut showing the geographic location and number of Cache Valley virus isolates analyzed in this study.

  • View in gallery

    Maximum-likelihood tree of M segment sequences encoding the Gc protein. Taxon names for Connecticut strains specify the strain number, mosquito species, county where they were collected, and year of isolation. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

  • View in gallery

    Maximum-likelihood tree of medium (M) segment sequences encoding the Gn protein. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

  • View in gallery

    Maximum-likelihood tree of small (S) segment sequences. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

  • View in gallery

    Maximum-likelihood tree of large (L) segment sequences. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

  • 1.

    Calisher CH, Francy DB, Smith GC, Muth DJ, Lazuick JS, Karabatsos N, Jakob WL, McLean RG, 1986. Distribution of Bunyamwera serogroup viruses in North America, 1956–1984. Am J Trop Med Hyg 35: 429443.

    • Search Google Scholar
    • Export Citation
  • 2.

    Grimstad PR, 2001. Cache Valley virus. Service MW, ed. Encyclopedia of Arthropod-Transmitted Infections of Man and Domestic Animals. New York: CABI Publishing, 101104.

    • Search Google Scholar
    • Export Citation
  • 3.

    Blackmore CG, Grimstad PR, 1998. Cache Valley and Potosi viruses (Bunyaviridae) in white-tailed deer (Odocoileus virginianus): experimental infections and antibody prevalence in natural populations. Am J Trop Med Hyg 59: 704709.

    • Search Google Scholar
    • Export Citation
  • 4.

    Neitzel DF, Grimstad PR, 1991. Serological evidence of California group and Cache Valley virus infection in Minnesota white-tailed deer. J Wildl Dis 27: 230237.

    • Search Google Scholar
    • Export Citation
  • 5.

    Kokernot RH, Hayes J, Tempelis CH, Chan DH, Boyd KR, Anderson RJ, 1969. Arbovirus studies in the Ohio-Mississippi Basin, 1964–1967. IV. Cache Valley virus. Am J Trop Med Hyg 18: 768773.

    • Search Google Scholar
    • Export Citation
  • 6.

    Buescher EL, Byrne RJ, Clarke GC, Gould DJ, Russell PK, Scheider FG, Yuill TM, 1970. Cache Valley virus in the Del Mar Va Peninsula. I. Virologic and serologic evidence of infection. Am J Trop Med Hyg 19: 493502.

    • Search Google Scholar
    • Export Citation
  • 7.

    Blitvich BJ, Saiyasombat R, Talavera-Aguilar LG, Garcia-Rejon JE, Farfan-Ale JA, Machain-Williams C, Lorono-Pino MA, 2012. Orthobunyavirus antibodies in humans, Yucatan Peninsula, Mexico. Emerg Infect Dis 18: 16291632.

    • Search Google Scholar
    • Export Citation
  • 8.

    Sexton DJ, Rollin PE, Breitschwerdt EB, Corey GR, Myers SA, Dumais MR, Bowen MD, Goldsmith CS, Zaki SR, Nichol ST, Peters CJ, Ksiazek TG, 1997. Life-threatening Cache Valley virus infection. N Engl J Med 336: 547549.

    • Search Google Scholar
    • Export Citation
  • 9.

    Campbell GL, Mataczynski JD, Reisdorf ES, Powell JW, Martin DA, Lambert AJ, Haupt TE, Davis JP, Lanciotti RS, 2006. Second human case of Cache Valley virus disease. Emerg Infect Dis 12: 854856.

    • Search Google Scholar
    • Export Citation
  • 10.

    Nguyen NL, Zhao G, Hull R, Shelly MA, Wong SJ, Wu G, St George K, Wang D, Menegus MA, 2013. Cache valley virus in a patient diagnosed with aseptic meningitis. J Clin Microbiol 51: 19661969.

    • Search Google Scholar
    • Export Citation
  • 11.

    Edwards JF, Livingston CW, Chung SI, Collisson EC, 1989. Ovine arthrogryposis and central nervous system malformations associated with in utero Cache Valley virus infection: spontaneous disease. Vet Pathol 26: 3339.

    • Search Google Scholar
    • Export Citation
  • 12.

    Chung SI, Livingston CW Jr, Edwards JF, Crandell RW, Shope RE, Shelton MJ, Collisson EW, 1990. Evidence that Cache Valley virus induces congenital malformations in sheep. Vet Microbiol 21: 297307.

    • Search Google Scholar
    • Export Citation
  • 13.

    Chung SI, Livingston CW Jr, Edwards JF, Gauer BB, Collisson EW, 1990. Congenital malformations in sheep resulting from in utero inoculation of Cache Valley virus. Am J Vet Res 51: 16451648.

    • Search Google Scholar
    • Export Citation
  • 14.

    Hunt AR, Calisher CH, 1979. Relationships of bunyamwera group viruses by neutralization. Am J Trop Med Hyg 28: 740749.

  • 15.

    Calisher CH, Sabattini MS, Monath TP, Wolff KL, 1988. Cross-neutralization tests among Cache Valley virus isolates revealing the existence of multiple subtypes. Am J Trop Med Hyg 39: 202205.

    • Search Google Scholar
    • Export Citation
  • 16.

    Lambert AJ, Lanciotti RS, 2008. Molecular characterization of medically important viruses of the genus Orthobunyavirus. J Gen Virol 89: 25802585.

    • Search Google Scholar
    • Export Citation
  • 17.

    Blitvich BJ, Saiyasombat R, Dorman KS, Garcia-Rejon JE, Farfan-Ale JA, Lorono-Pino MA, 2012. Sequence and phylogenetic data indicate that an orthobunyavirus recently detected in the Yucatan Peninsula of Mexico is a novel reassortant of Potosi and Cache Valley viruses. Arch Virol 157: 11991204.

    • Search Google Scholar
    • Export Citation
  • 18.

    Blitvich BJ, Lorono-Pino MA, Garcia-Rejon JE, Farfan-Ale JA, Dorman KS, 2012. Nucleotide sequencing and serologic analysis of Cache Valley virus isolates from the Yucatan Peninsula of Mexico. Virus Genes 45: 176180.

    • Search Google Scholar
    • Export Citation
  • 19.

    Pabbaraju K, Ho KC, Wong S, Fox JD, Kaplen B, Tyler S, Drebot M, Tilley PA, 2009. Surveillance of mosquito-borne viruses in Alberta using reverse transcription polymerase chain reaction with generic primers. J Med Entomol 46: 640648.

    • Search Google Scholar
    • Export Citation
  • 20.

    Andreadis TG, Armstrong PM, Anderson JF, Main AJ, 2014. Spatial-temporal analysis of Cache Valley virus (Bunyaviridae: Orthobunyavirus) infection in anopheline and culicine mosquitoes (Diptera: Culicidae) in the northeastern United States, 1997–2012. Vector Borne Zoonotic Dis 14: 763773.

    • Search Google Scholar
    • Export Citation
  • 21.

    Anderson JF, Main AJ, Armstrong PM, Andreadis TG, Ferrandino FJ, 2015. Arboviruses in North Dakota, 2003–2006. Am J Trop Med Hyg 92: 377393.

  • 22.

    Main AJ, 1981. Arbovirus surveillance in Connecticut IV. Bunyamwera group. Mosq News 41: 490494.

  • 23.

    Calisher CH, Gutierrez E, Francy DB, Alava A, Muth DJ, Lazuick JS, 1983. Identification of hitherto unrecognized arboviruses from Ecuador: members of serogroups B, C, Bunyamwera, Patois, and Minatitlan. Am J Trop Med Hyg 32: 877885.

    • Search Google Scholar
    • Export Citation
  • 24.

    Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 27252729.

    • Search Google Scholar
    • Export Citation
  • 25.

    Briese T, Kapoor V, Lipkin WI, 2007. Natural M-segment reassortment in Potosi and Main Drain viruses: implications for the evolution of orthobunyaviruses. Arch Virol 152: 22372247.

    • Search Google Scholar
    • Export Citation
  • 26.

    Rico-Hesse R, Harrison LM, Salas RA, Tovar D, Nisalak A, Ramos C, Boshell J, de Mesa MT, Nogueira RM, da Rosa AT, 1997. Origins of dengue type 2 viruses associated with increased pathogenicity in the Americas. Virology 230: 244251.

    • Search Google Scholar
    • Export Citation
  • 27.

    Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM, 2003. Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 9: 800809.

    • Search Google Scholar
    • Export Citation
  • 28.

    OhAinle M, Balmaseda A, Macalalad AR, Tellez Y, Zody MC, Saborio S, Nunez A, Lennon NJ, Birren BW, Gordon A, Henn MR, Harris E, 2011. Dynamics of dengue disease severity determined by the interplay between viral genetics and serotype-specific immunity. Sci Transl Med 3: 114ra128.

    • Search Google Scholar
    • Export Citation
  • 29.

    Ebel GD, Carricaburu J, Young D, Bernard KA, Kramer LD, 2004. Genetic and phenotypic variation of West Nile virus in New York, 2000–2003. Am J Trop Med Hyg 71: 493500.

    • Search Google Scholar
    • Export Citation
  • 30.

    Davis CT, Ebel GD, Lanciotti RS, Brault AC, Guzman H, Siirin M, Lambert A, Parsons RE, Beasley DW, Novak RJ, Elizondo-Quiroga D, Green EN, Young DS, Stark LM, Drebot MA, Artsob H, Tesh RB, Kramer LD, Barrett AD, 2005. Phylogenetic analysis of North American West Nile virus isolates, 2001–2004: evidence for the emergence of a dominant genotype. Virology 342: 252265.

    • Search Google Scholar
    • Export Citation
  • 31.

    Cologna R, Armstrong PM, Rico-Hesse R, 2005. Selection for virulent dengue viruses occurs in humans and mosquitoes. J Virol 79: 853859.

  • 32.

    Lambrechts L, Fansiri T, Pongsiri A, Thaisomboonsuk B, Klungthong C, Richardson JH, Ponlawat A, Jarman RG, Scott TW, 2012. Dengue-1 virus clade replacement in Thailand associated with enhanced mosquito transmission. J Virol 86: 18531861.

    • Search Google Scholar
    • Export Citation
  • 33.

    Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG, 2002. Extinction and rapid emergence of strains of dengue 3 virus during an interepidemic period. Virology 301: 148156.

    • Search Google Scholar
    • Export Citation
  • 34.

    Armstrong PM, Rico-Hesse R, 2003. Efficiency of dengue serotype 2 virus strains to infect and disseminate in Aedes aegypti. Am J Trop Med Hyg 68: 539544.

    • Search Google Scholar
    • Export Citation
  • 35.

    Armstrong PM, Andreadis TG, 2007. Genetic relationships of Jamestown Canyon virus strains infecting mosquitoes collected in Connecticut. Am J Trop Med Hyg 77: 11571162.

    • Search Google Scholar
    • Export Citation
  • 36.

    Andreadis TG, Anderson JF, Armstrong PM, Main AJ, 2008. Isolations of Jamestown Canyon virus (Bunyaviridae: Orthobunyavirus) from field-collected mosquitoes (Diptera: Culicidae) in Connecticut, USA: a ten-year analysis, 1997–2006. Vector Borne Zoonotic Dis 8: 175188.

    • Search Google Scholar
    • Export Citation
  • 37.

    Berry RL, Lalondie-Weigert BJ, Calisher CH, Parsons MA, Bear GT, 1977. Evidence for transovarial transmission of Jamestown Canyon virus in Ohio. Mosq News 37: 494496.

    • Search Google Scholar
    • Export Citation
  • 38.

    Boromisa RD, Grimstad PR, 1986. Virus-vector-host relationships of Aedes stimulans and Jamestown Canyon virus in a northern Indiana enzootic focus. Am J Trop Med Hyg 35: 12851295.

    • Search Google Scholar
    • Export Citation
  • 39.

    Armstrong PM, Andreadis TG, 2006. A new genetic variant of La Crosse virus (Bunyaviridae) isolated from New England. Am J Trop Med Hyg 75: 491496.

    • Search Google Scholar
    • Export Citation

 

 

 

 

 

Emergence of a New Lineage of Cache Valley Virus (Bunyaviridae: Orthobunyavirus) in the Northeastern United States

View More View Less
  • Center for Vector Biology and Zoonotic Diseases, The Connecticut Agricultural Experiment Station, New Haven, Connecticut

Cache Valley virus (CVV; Family Bunyavidae, Genus Orthobunyavirus) is a mosquito-borne zoonosis that frequently infects humans and livestock in North and Central America. In the northeastern United States, CVV transmission is unpredictable from year-to-year and may derive from the periodic extinction and reintroduction of new virus strains into this region. To evaluate this possibility, we sequenced and analyzed numerous CVV isolates sampled in Connecticut during an 18-year period to determine how the virus population may change over time. Phylogenetic analyses showed the establishment of a new viral lineage during 2010 that became dominant by 2014 and appears to have originated from southern Mexico. CVV strains from Connecticut also grouped into numerous sub-clades within each lineage that included viruses from other U.S. states and Canada. We did not observe the development and stable persistence of local viral clades in Connecticut, which may reflect the episodic pattern of CVV transmission. Together, our data support the emergence of a new lineage of CVV in the northeastern United States and suggest extensive dispersal of viral strains in North America.

Introduction

Cache Valley virus (CVV; family Bunyaviridae, genus Orthobunyavirus) occurs throughout much of North and Central America where the virus circulates in an enzootic cycle involving mammal-biting mosquitoes and deer hosts.14 Humans are frequently exposed to the virus in endemic regions with antibody prevalence ranging from 3% to 19%.2,57 The development of severe disease occurs rarely in humans but is potentially life-threatening with symptoms ranging from fever to encephalitis.810 In addition, CVV is responsible for epizootics in sheep, causing fetal death and congenital defects in these animals.1113

CVV includes a number of regional subtypes and varieties based on antigenic and genetic relationships. The virus is closely related to but distinct from a number of viruses circulating in South and Central America and Mexico including Maguari virus, Xingu virus, Cholul virus, and Fort Sherman virus.1417 CVV may be further delineated into regional varieties that include Tlacotalpan virus from Veracruz, Mexico that is genetically distinct from strains circulating in the United States and Canada.18 Phylogenetic comparisons indicate that CVV strains from United States and Canada segregate into a single genetically conserved lineage that has persisted over a 60-year period.18,19 Viruses grouped into sub-clades within this lineage but without clear evidence of spatial or temporal genetic structure. Nevertheless, firm conclusions could not be drawn about the phylogeography because prior analyses were based on a limited number of viral sequences.

In Connecticut, CVV is detected in mosquitoes during most years of arbovirus surveillance but virus activity is highly variable and not directly associated with mosquito abundance.20 The reasons for these oscillations remain unclear but may derive from the periodic extinction and re-introduction of new virus strains into this region. Accordingly, we sequenced and analyzed numerous virus isolates sampled over an 18-year period in Connecticut to determine how the virus population may change over time. Specifically, portions of the small (S), medium (M), and large (L) genomic segments of CVV were sequenced and phylogenetic relationships were evaluated to differentiate strains, monitor their regional persistence, and compare with viruses from other geographic regions.

Materials and Methods

Virus strains.

The majority of CVV isolates analyzed in this study (N = 70) were obtained from mosquitoes collected during the statewide surveillance program in Connecticut. Mosquitoes were trapped at 91 locations statewide from June to October of 1997–2014 and processed for virus isolation in Vero, clone E6 cell cultures as previously described.20 CVV was isolated during 11 of the 18 years of mosquito testing and representative viruses were selected from each of these years in 50 locations throughout Connecticut (Figure 1). The number of viral isolates sequenced from each year is as follows: 1998 (N = 9), 2000 (N = 1), 2001 (N = 2), 2003 (N = 18), 2005 (N = 2), 2006 (N = 2), 2008 (N = 5), 2009 (N = 1), 2010 (N = 5), 2011 (N = 13), and 2014 (N = 12), which reflects fluctuating levels of virus activity among years.20 We also sequenced six CVV strains obtained from North Dakota during 2005,21 an earlier CVV isolate from Connecticut in 1979,22 and the prototype strain of Playas virus from Ecuador in 1975.23 Portions of the S and L segments were sequenced from viral strains from Manitoba, Canada 1981 (N = 1), New Jersey 1982 (N = 1), and Oregon 1969 (N = 1). Additional sequences were obtained from GenBank and included CVV strains from other locations in United States, Canada, Mexico, and Panama.

Figure 1.
Figure 1.

County map of Connecticut showing the geographic location and number of Cache Valley virus isolates analyzed in this study.

Citation: The American Society of Tropical Medicine and Hygiene 93, 1; 10.4269/ajtmh.15-0132

Reverse transcription-polymerase chain reaction and nucleotide sequencing.

Viral RNA was isolated from the primary virus cultures using the QIamp viral RNA Kit (Qiagen, Valencia, CA). Reverse transcription-polymerase chain reaction (RT-PCR) was performed using the Titan One-Tube RT-PCR System (Roche Diagnostics, Indianapolis, IN) and using PCR primers targeting the three genomic segments of CVV (Table 1). Primers BUNS+ new and BUNS− new were used to amplify the S segment under the following thermal cycling conditions: 1 cycle of 50°C for 30 minutes and 94°C for 2 minutes, 10 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute, followed by 25 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute + 5 seconds per cycle, and 1 cycle of 68°C for 7 minutes. The entire M segment was amplified using primers M14C and M4510R as follows: 1 cycle of 45°C for 30 minutes and 94°C for 2 minutes, 10 cycles of 94°C for 15 seconds, 48°C for 30 seconds, and 68°C for 4 minutes, followed by 25 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 4 minutes + 5 seconds per cycle, and 1 cycle of 68°C for 7 minutes. Primers targeting a portion of the M segment (M14C and CVM759r) and L segment (BUNL15C and CVLrev) were used under the same thermal cycling conditions described for the entire M segment except the 68°C extension step was set at 1 minute instead of 4 minutes. Amplification products of the appropriate size were purified using the PCR purification kit (Qiagen, Valencia, CA) and commercially sequenced (Keck Center, New Haven, CT) using primers listed in Table 1.

Table 1

Primers used for RT-PCR and sequencing reactions

SegmentPrimer nameSequence (5′–3′)*Genomic positionUsed forPCR amplicon size (nt)
SBUNS+ newTGACC AGTAGTGTACTCCAC1–15PCR960
BUNS− newCAAGC AGTAGTGTGCTCCAC935–950PCR
BUNS+AGTAGTGTACTCCAC1–15Sequencing
BUNS−AGTAGTGTGCTCCAC935–950Sequencing
BUNSPA1CTGTCCCCTACCACCCACCCA863–883Sequencing
MM14CCGGAATTC AGTAGTGTACTACC1–14PCR, sequencing767
CVM759rCGGCATGAAAATTGGCATCA740–759PCR, sequencing
M4510RATCGCGT AGTAGTGTGCTACC4450–4463PCR4478
CVMfwdCACAAAAGAATGCCATAATGC2269–2288Sequencing
CVMfwdDCTTTGGTGAGTATTGTATATCTC2679–2701Sequencing
CVMrev-1AATTCCACCTAATGCAGGGAT2980–3000Sequencing
CVMfwdECACACAACATGATGAGCACTG3129–3149Sequencing
CVMfwdFCTCAATCCTAGGCATGGG3561–3578Sequencing
CVMrevBCTGGTCCCCTGTGTTCACTTC4081–4101Sequencing
CVMrevACCCCTCATCTCTAACCCTGCA4147–4167Sequencing
LBUNL15CCGGCC AGTAGTGTACTCCTA1–15PCR, sequencing643
CVLrevTCATCCATACACCATGGTGCTGT616–638PCR, sequencing

L = large; M = medium; S = small; RT-PCR = reverse transcription-polymerase chain reaction.

Nonviral sequences are indicated in italics.

Genetic analyses.

Overlapping sequence chromatograms were edited using ChromasPro (Technelysium Ltd, Tewantin, Australia) and edited nucleotide sequences were deposited in GenBank (accession numbers KP835801–KP835938). Multiple sequence alignments were generated by the ClustalW algorithm. Nucleotide alignments were then manually inspected and coding sequences were translated into protein to check the position of the open reading frame in the alignment. Four data sets were generated for phylogenetic analysis: 1) M segment—1,803 nucleotide sites encoding the Gc protein, 2) M segment—525 nucleotides of the Gn protein gene, 3) S segment—757 nucleotides of the nucleocapsid gene and 3′ untranslated region, and 4) L segment—528 nucleotides of the 5′ untranslated region and RNA polymerase gene. Phylogenetic relationships were evaluated by maximum-likelihood analysis in Mega 6.0.24 The optimal nucleotide substitution model for each data set was selected by performing ML fits of 24 different models in Mega. Support for individual nodes was evaluated by performing 1,000 bootstrap replicates.

Results

To evaluate phylogenetic relationships of CVV strains, we analyzed a 1,803 nucleotide region of M segment encoding the Gc protein. The final alignment included 71 viral sequences from Connecticut, 20 from other U.S. states and Canada, 1 from Mexico, and 3 from Central and South America. CVV sequences segregated into two distinct and well-supported groups, each with 100% bootstrap support, by maximum-likelihood analysis (Figure 2). Lineage 1 comprised CVV sampled from United States and Canada during 1952–2011, a human isolate from Panama, and Playas virus from Equator. More recent CVV strains from Connecticut, New Jersey, and New York 2010–2014 clustered together and grouped with Tlacotalpan virus from Mexico to form lineage 2. Connecticut viruses also grouped into numerous sub-clades within each lineage. These clades were not defined by in-state location, year of isolation, or mosquito species and sometimes included viruses from other U.S. states and Canada. Our data support the emergence of a new genotype of CVV in the northeastern United States and suggest extensive dispersal of viral strains in North America.

Figure 2.
Figure 2.

Maximum-likelihood tree of M segment sequences encoding the Gc protein. Taxon names for Connecticut strains specify the strain number, mosquito species, county where they were collected, and year of isolation. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

Citation: The American Society of Tropical Medicine and Hygiene 93, 1; 10.4269/ajtmh.15-0132

We then analyzed another region of the M segment encoding the Gn protein to facilitate the inclusion of more CVV sequences from Mexico. Figure 3 shows the phylogenetic relationships of 40 viral sequences analyzed by maximum-likelihood analysis. We included more distant outgroup taxa in this analysis, which obscured fine resolution of CVV relationships; nevertheless, lineages 1 and 2 could be distinguished in the analysis with 87% and 98% booststrap support, respectively. Lineage 2 comprised the same strains from Connecticut, New Jersey, and New York in the earlier analysis and these strains were most similar to viruses isolated in Yucatan, Mexico during 2008.

Figure 3.
Figure 3.

Maximum-likelihood tree of medium (M) segment sequences encoding the Gn protein. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

Citation: The American Society of Tropical Medicine and Hygiene 93, 1; 10.4269/ajtmh.15-0132

CVV has the capacity to undergo reassortment by exchanging whole genomic segments with heterologous viruses during mixed infections. To determine whether lineage 2 viruses emerged due to genetic reassortment with another virus, we sequenced and analyzed portions of the S and L segments by maximum-likelihood methods. The topologies of S- and L-segment trees (Figures 4 and 5) differed somewhat from each other and the M segment tree (Figure 3). The position of Cholul virus, Ft. Sherman virus, and Potosi were inconsistent among trees, which had been previously reported as evidence for RNA segment reassortment.17,25 Phylogenetic relationships among CVV strains, however, were consistent in all three trees generated from the S, M, and L segments. The S segment tree shows two distinct groups of CVV that correspond to lineage 1 with 96% bootstrap support and lineage 2 from previous analyses (Figure 4). Phylogenetic reconstruction of the L segment revealed strong bootstrap support (100%) for lineage 2 but not lineage 1 (Figure 5). We conclude that lineage 2 viruses form a monophyletic group and are not reassortant viruses.

Figure 4.
Figure 4.

Maximum-likelihood tree of small (S) segment sequences. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

Citation: The American Society of Tropical Medicine and Hygiene 93, 1; 10.4269/ajtmh.15-0132

Figure 5.
Figure 5.

Maximum-likelihood tree of large (L) segment sequences. Number at nodes indicate bootstrap support for values > 50%. Branch lengths are proportional to the number of nucleotide substitutions.

Citation: The American Society of Tropical Medicine and Hygiene 93, 1; 10.4269/ajtmh.15-0132

Our analyses indicated that all of the viral sequences from Connecticut 2014 belonged exclusively to lineage 2 as shown in Figure 2. To determine whether lineage 2 may have supplanted lineage 1, we genotyped the remaining strains (N = 13) that were collected during statewide surveillance during 2014 by sequencing the Gn gene. These viruses were identical or most similar to lineage 2 viruses from northeastern United States and Yucatan, Mexico (99.4–100% sequence identity).

Discussion

Our study documents the emergence of a new lineage of CVV in the northeastern United States that shares recent common ancestry with viral strains from southern Mexico. Lineage 2 viruses first appeared in Connecticut and New Jersey in 2010 and were most similar to viruses isolated 2 years earlier in Yucatan, Mexico. This suggests long-distance dispersal of viral strains from Mexico into northeastern United States; however, the pathway for migration is unclear based on our current sample of viruses. It is also possible that lineage 2 viruses originated from another region not represented in this analysis. CVV is known to occur in southern Canada, Mexico, Panama, and throughout the continental United States except in southeastern states where related Tensaw virus is prevalent.1 Our sample includes CVV strains from across much of its geographic range, extending from Oregon to Connecticut and from Canada to Panama, but sampling is very limited in most geographic regions. Rather, this study focuses primarily on viral population change at the statewide level over many consecutive years and clearly shows the recent introduction and establishment of a new lineage in the northeastern United States.

The phenomenon of lineage replacement has been well documented for a number of different arboviruses including dengue virus and West Nile virus.2630 This occurs when a new viral lineage or genotype is introduced into a region and rapidly displaces its native counterpart. The mechanistic basis of lineage replacement is not always clear but could stem from differences in viral fitness or may reflect stochastic processes such as random genetic drift.29,3134 In this study, we found that all of the CVV isolates collected during 2014 belonged exclusively to lineage 2 indicating a possible lineage replacement event; however, future monitoring is required to determine whether lineage 2 becomes permanently fixed. Moreover, the impact of lineage replacement is not clear as viruses from both lineages have the capacity to cause human disease and infect a wide diversity of mosquito species.

Our sequence analysis included 70 CVV strains collected during 18 years of continuous statewide arbovirus surveillance in Connecticut. These viruses grouped into a number of well-supported sub-clades within each major lineage but there was no clear segregation of viruses by geographic location, year of isolation, or mosquito species. Many of these sub-clades contained viruses from other U.S. states and Canada indicating widespread dispersal of viral strains in North America. These findings differ from that of another Bunyavirus—Jamestown Canyon virus that also perpetuates in a deer-mosquito cycle in this region. Our prior analyses found that Jamestown Canyon virus could be distinguished into two major lineages that persisted in different regions in Connecticut, suggesting geographic isolation of this virus.35 Unlike CVV, Jamestown Canyon virus is consistently detected every year during statewide surveillance and the virus may overwinter locally in mosquito eggs infected by vertical transmission.3638 These factors might contribute to the stability of Jamestown Canyon virus populations in different regions of the state as compared with CVV that occurs more sporadically.

CVV proved to be genetically conserved throughout its geographic range over a 60-year sampling period. Mean nucleotide distances between lineages 1 and 2 ranged from 3.1% for the S segment sequences to 7.0% for M segment sequences encoding the Gc protein. For comparison, nucleotide distances were from 5.7% to 12.4% between Jamestown Canyon virus lineages and were up to 14.6% for La Crosse virus lineages circulating in the United States.35,39 This suggest that CVV lineages diverged relatively recently from a common ancestor; however, it is also possible that nucleotide substitution rates were lower for CVV than for Jamestown Canyon virus and La Crosse virus. We cannot differentiate between these possibilities based on this analysis.

Our sequence data suggest that CVV and Playas virus are not distinct viruses as previously proposed.23 Playas virus from Ecuador was indistinguishable from CVV and grouped within other North American strains to form lineage 1 based on phylogenetic analysis of S, M, and L sequences. These results conflict with serological classification by neutralization tests that targets glycoproteins encoded on the M segment.23 We analyzed portions of the Gc (Figure 2) and Gn proteins (Figure 3) but there were no obvious differences in encoded proteins to explain antigenic differences among viruses. Full genome sequencing might help resolve this discrepancy; nevertheless, our initial analyses of S, M, and L sequences clearly show that CVV and Playas virus are closely related to each other.

In conclusion, we tracked the geographic distribution and persistence of CVV variants in Connecticut over an 18-year sampling period. We show the emergence of a new viral lineage that included strains isolated from southern Mexico. Phylogenetic patterns show wide circulation of CVV strains across a broad geographic region. We did not observe the stable persistence of local variants of CVV in Connecticut, which may reflect the episodic patterns of CVV transmission. Multiple clades often appeared in a specific year indicating that a number of virus variants may emerge and circulate simultaneously when conditions support CVV amplification.

ACKNOWLEDGMENTS

We thank Angela Bransfield, Shannon Finan, and Michael Misencik for their technical assistance in the isolation and sequencing of viruses from field-collected mosquitoes. We also thank Terrill Goodman, Michael Misencik, John Shepard, Michael Thomas, and Michael Vasil for the collection and identification of mosquitoes for virus testing.

  • 1.

    Calisher CH, Francy DB, Smith GC, Muth DJ, Lazuick JS, Karabatsos N, Jakob WL, McLean RG, 1986. Distribution of Bunyamwera serogroup viruses in North America, 1956–1984. Am J Trop Med Hyg 35: 429443.

    • Search Google Scholar
    • Export Citation
  • 2.

    Grimstad PR, 2001. Cache Valley virus. Service MW, ed. Encyclopedia of Arthropod-Transmitted Infections of Man and Domestic Animals. New York: CABI Publishing, 101104.

    • Search Google Scholar
    • Export Citation
  • 3.

    Blackmore CG, Grimstad PR, 1998. Cache Valley and Potosi viruses (Bunyaviridae) in white-tailed deer (Odocoileus virginianus): experimental infections and antibody prevalence in natural populations. Am J Trop Med Hyg 59: 704709.

    • Search Google Scholar
    • Export Citation
  • 4.

    Neitzel DF, Grimstad PR, 1991. Serological evidence of California group and Cache Valley virus infection in Minnesota white-tailed deer. J Wildl Dis 27: 230237.

    • Search Google Scholar
    • Export Citation
  • 5.

    Kokernot RH, Hayes J, Tempelis CH, Chan DH, Boyd KR, Anderson RJ, 1969. Arbovirus studies in the Ohio-Mississippi Basin, 1964–1967. IV. Cache Valley virus. Am J Trop Med Hyg 18: 768773.

    • Search Google Scholar
    • Export Citation
  • 6.

    Buescher EL, Byrne RJ, Clarke GC, Gould DJ, Russell PK, Scheider FG, Yuill TM, 1970. Cache Valley virus in the Del Mar Va Peninsula. I. Virologic and serologic evidence of infection. Am J Trop Med Hyg 19: 493502.

    • Search Google Scholar
    • Export Citation
  • 7.

    Blitvich BJ, Saiyasombat R, Talavera-Aguilar LG, Garcia-Rejon JE, Farfan-Ale JA, Machain-Williams C, Lorono-Pino MA, 2012. Orthobunyavirus antibodies in humans, Yucatan Peninsula, Mexico. Emerg Infect Dis 18: 16291632.

    • Search Google Scholar
    • Export Citation
  • 8.

    Sexton DJ, Rollin PE, Breitschwerdt EB, Corey GR, Myers SA, Dumais MR, Bowen MD, Goldsmith CS, Zaki SR, Nichol ST, Peters CJ, Ksiazek TG, 1997. Life-threatening Cache Valley virus infection. N Engl J Med 336: 547549.

    • Search Google Scholar
    • Export Citation
  • 9.

    Campbell GL, Mataczynski JD, Reisdorf ES, Powell JW, Martin DA, Lambert AJ, Haupt TE, Davis JP, Lanciotti RS, 2006. Second human case of Cache Valley virus disease. Emerg Infect Dis 12: 854856.

    • Search Google Scholar
    • Export Citation
  • 10.

    Nguyen NL, Zhao G, Hull R, Shelly MA, Wong SJ, Wu G, St George K, Wang D, Menegus MA, 2013. Cache valley virus in a patient diagnosed with aseptic meningitis. J Clin Microbiol 51: 19661969.

    • Search Google Scholar
    • Export Citation
  • 11.

    Edwards JF, Livingston CW, Chung SI, Collisson EC, 1989. Ovine arthrogryposis and central nervous system malformations associated with in utero Cache Valley virus infection: spontaneous disease. Vet Pathol 26: 3339.

    • Search Google Scholar
    • Export Citation
  • 12.

    Chung SI, Livingston CW Jr, Edwards JF, Crandell RW, Shope RE, Shelton MJ, Collisson EW, 1990. Evidence that Cache Valley virus induces congenital malformations in sheep. Vet Microbiol 21: 297307.

    • Search Google Scholar
    • Export Citation
  • 13.

    Chung SI, Livingston CW Jr, Edwards JF, Gauer BB, Collisson EW, 1990. Congenital malformations in sheep resulting from in utero inoculation of Cache Valley virus. Am J Vet Res 51: 16451648.

    • Search Google Scholar
    • Export Citation
  • 14.

    Hunt AR, Calisher CH, 1979. Relationships of bunyamwera group viruses by neutralization. Am J Trop Med Hyg 28: 740749.

  • 15.

    Calisher CH, Sabattini MS, Monath TP, Wolff KL, 1988. Cross-neutralization tests among Cache Valley virus isolates revealing the existence of multiple subtypes. Am J Trop Med Hyg 39: 202205.

    • Search Google Scholar
    • Export Citation
  • 16.

    Lambert AJ, Lanciotti RS, 2008. Molecular characterization of medically important viruses of the genus Orthobunyavirus. J Gen Virol 89: 25802585.

    • Search Google Scholar
    • Export Citation
  • 17.

    Blitvich BJ, Saiyasombat R, Dorman KS, Garcia-Rejon JE, Farfan-Ale JA, Lorono-Pino MA, 2012. Sequence and phylogenetic data indicate that an orthobunyavirus recently detected in the Yucatan Peninsula of Mexico is a novel reassortant of Potosi and Cache Valley viruses. Arch Virol 157: 11991204.

    • Search Google Scholar
    • Export Citation
  • 18.

    Blitvich BJ, Lorono-Pino MA, Garcia-Rejon JE, Farfan-Ale JA, Dorman KS, 2012. Nucleotide sequencing and serologic analysis of Cache Valley virus isolates from the Yucatan Peninsula of Mexico. Virus Genes 45: 176180.

    • Search Google Scholar
    • Export Citation
  • 19.

    Pabbaraju K, Ho KC, Wong S, Fox JD, Kaplen B, Tyler S, Drebot M, Tilley PA, 2009. Surveillance of mosquito-borne viruses in Alberta using reverse transcription polymerase chain reaction with generic primers. J Med Entomol 46: 640648.

    • Search Google Scholar
    • Export Citation
  • 20.

    Andreadis TG, Armstrong PM, Anderson JF, Main AJ, 2014. Spatial-temporal analysis of Cache Valley virus (Bunyaviridae: Orthobunyavirus) infection in anopheline and culicine mosquitoes (Diptera: Culicidae) in the northeastern United States, 1997–2012. Vector Borne Zoonotic Dis 14: 763773.

    • Search Google Scholar
    • Export Citation
  • 21.

    Anderson JF, Main AJ, Armstrong PM, Andreadis TG, Ferrandino FJ, 2015. Arboviruses in North Dakota, 2003–2006. Am J Trop Med Hyg 92: 377393.

  • 22.

    Main AJ, 1981. Arbovirus surveillance in Connecticut IV. Bunyamwera group. Mosq News 41: 490494.

  • 23.

    Calisher CH, Gutierrez E, Francy DB, Alava A, Muth DJ, Lazuick JS, 1983. Identification of hitherto unrecognized arboviruses from Ecuador: members of serogroups B, C, Bunyamwera, Patois, and Minatitlan. Am J Trop Med Hyg 32: 877885.

    • Search Google Scholar
    • Export Citation
  • 24.

    Tamura K, Stecher G, Peterson D, Filipski A, Kumar S, 2013. MEGA6: Molecular Evolutionary Genetics Analysis version 6.0. Mol Biol Evol 30: 27252729.

    • Search Google Scholar
    • Export Citation
  • 25.

    Briese T, Kapoor V, Lipkin WI, 2007. Natural M-segment reassortment in Potosi and Main Drain viruses: implications for the evolution of orthobunyaviruses. Arch Virol 152: 22372247.

    • Search Google Scholar
    • Export Citation
  • 26.

    Rico-Hesse R, Harrison LM, Salas RA, Tovar D, Nisalak A, Ramos C, Boshell J, de Mesa MT, Nogueira RM, da Rosa AT, 1997. Origins of dengue type 2 viruses associated with increased pathogenicity in the Americas. Virology 230: 244251.

    • Search Google Scholar
    • Export Citation
  • 27.

    Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM, 2003. Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 9: 800809.

    • Search Google Scholar
    • Export Citation
  • 28.

    OhAinle M, Balmaseda A, Macalalad AR, Tellez Y, Zody MC, Saborio S, Nunez A, Lennon NJ, Birren BW, Gordon A, Henn MR, Harris E, 2011. Dynamics of dengue disease severity determined by the interplay between viral genetics and serotype-specific immunity. Sci Transl Med 3: 114ra128.

    • Search Google Scholar
    • Export Citation
  • 29.

    Ebel GD, Carricaburu J, Young D, Bernard KA, Kramer LD, 2004. Genetic and phenotypic variation of West Nile virus in New York, 2000–2003. Am J Trop Med Hyg 71: 493500.

    • Search Google Scholar
    • Export Citation
  • 30.

    Davis CT, Ebel GD, Lanciotti RS, Brault AC, Guzman H, Siirin M, Lambert A, Parsons RE, Beasley DW, Novak RJ, Elizondo-Quiroga D, Green EN, Young DS, Stark LM, Drebot MA, Artsob H, Tesh RB, Kramer LD, Barrett AD, 2005. Phylogenetic analysis of North American West Nile virus isolates, 2001–2004: evidence for the emergence of a dominant genotype. Virology 342: 252265.

    • Search Google Scholar
    • Export Citation
  • 31.

    Cologna R, Armstrong PM, Rico-Hesse R, 2005. Selection for virulent dengue viruses occurs in humans and mosquitoes. J Virol 79: 853859.

  • 32.

    Lambrechts L, Fansiri T, Pongsiri A, Thaisomboonsuk B, Klungthong C, Richardson JH, Ponlawat A, Jarman RG, Scott TW, 2012. Dengue-1 virus clade replacement in Thailand associated with enhanced mosquito transmission. J Virol 86: 18531861.

    • Search Google Scholar
    • Export Citation
  • 33.

    Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG, 2002. Extinction and rapid emergence of strains of dengue 3 virus during an interepidemic period. Virology 301: 148156.

    • Search Google Scholar
    • Export Citation
  • 34.

    Armstrong PM, Rico-Hesse R, 2003. Efficiency of dengue serotype 2 virus strains to infect and disseminate in Aedes aegypti. Am J Trop Med Hyg 68: 539544.

    • Search Google Scholar
    • Export Citation
  • 35.

    Armstrong PM, Andreadis TG, 2007. Genetic relationships of Jamestown Canyon virus strains infecting mosquitoes collected in Connecticut. Am J Trop Med Hyg 77: 11571162.

    • Search Google Scholar
    • Export Citation
  • 36.

    Andreadis TG, Anderson JF, Armstrong PM, Main AJ, 2008. Isolations of Jamestown Canyon virus (Bunyaviridae: Orthobunyavirus) from field-collected mosquitoes (Diptera: Culicidae) in Connecticut, USA: a ten-year analysis, 1997–2006. Vector Borne Zoonotic Dis 8: 175188.

    • Search Google Scholar
    • Export Citation
  • 37.

    Berry RL, Lalondie-Weigert BJ, Calisher CH, Parsons MA, Bear GT, 1977. Evidence for transovarial transmission of Jamestown Canyon virus in Ohio. Mosq News 37: 494496.

    • Search Google Scholar
    • Export Citation
  • 38.

    Boromisa RD, Grimstad PR, 1986. Virus-vector-host relationships of Aedes stimulans and Jamestown Canyon virus in a northern Indiana enzootic focus. Am J Trop Med Hyg 35: 12851295.

    • Search Google Scholar
    • Export Citation
  • 39.

    Armstrong PM, Andreadis TG, 2006. A new genetic variant of La Crosse virus (Bunyaviridae) isolated from New England. Am J Trop Med Hyg 75: 491496.

    • Search Google Scholar
    • Export Citation

Author Notes

* Address correspondence to Philip M. Armstrong, The Connecticut Agricultural Experiment Station, 123 Huntington St., P.O. Box 1106, New Haven, CT 06504. E-mail: philip.armstrong@ct.gov

Financial support: This work was supported in part by grants from the Centers for Disease Control and Prevention (U50/CCU116806-01-1), the U.S. Department of Agriculture (58-6615-1-218, CONH00768 and CONH00773).

Authors' addresses: Philip M. Armstrong, Theodore G. Andreadis, and John F. Anderson, The Connecticut Agricultural Experiment Station, Center for Vector Biology and Zoonotic Diseases, New Haven, CT, E-mails: philip.armstrong@ct.gov, theodore.andreadis@ct.gov, and john.f.anderson@po.state.ct.us.

Save