Introduction
Ticks are important vectors for human and animal pathogens of viral, bacterial, and protozoan nature worldwide. Lyme disease is a tick-borne disease that is common in all temperate regions of the Northern Hemisphere and it is the most common tick-borne disease in the United States. Most infections occur during the months of May through August, when both the nymph ticks' activity and human outdoor activity are at their peak. The causative agent for Lyme disease, Borrelia burgdorferi s.l., was first identified from the hard tick Ixodes scapularis (formerly called I. dammini) in the autumn of 1981.1,2 To date, at least 19 species of Borellia burgdorferi s.l. have been described: B. burgdorferi sensu stricto, B. garinii, B. afzelii, B. japonica, B. valaisiana, B. lusitaniae, B. andersonii, B. tanukii, B. turdi, B. bissettii, B. sinica, B. spielmanii, B. californiensis, B. carolinensis sp. nov., B. americana, B. bavariensis, B. finlandensis, B. kurtenbachii, and B. yangzte.3–13
In China, the first case of Lyme disease was reported in Hailin county Heilongjiang province in 1987.14 Thereafter, Lyme disease has been documented in more than 20 provinces and autonomous regions throughout China and several B. burgdorferi s.l. genotyping studies have been conducted.8,15–18 Some previous reports have shown the presence of antibody immunoglobulin G (IgG) against B. burgdorferi s.l. in serum of humans from different areas in Zhejiang Province.19–21 Monitoring tick distribution and the prevalence of Borrelia are essential to describe and understand the risk of acquiring Borrelia infections. To explore the tick distribution and prevalence of Borrelia, we performed a survey in nine locations in Zhejiang Province in Eastern China.
Materials and Methods
Tick sampling.
The investigated sites included Daishan, Xinchang, Jindong, Tiantai, Xianju Yongjia, Wencheng, Taishun, and Anji and were randomly chosen based on their geographical and administrative locations (Figure 1). Some ticks were collected from domestic animals such as sheep, cattle, and dog using tweezers with the help of the owners of these domestic animals. Some ticks were collected from Sus scrofa trapped by local hunters or sold at markets. The other ticks were collected from wild mammals including Erinaceus amurensis, Apodemus agrarius, Rattus niviventer, and Suncus murinus, which were trapped with mousetraps. Collections of tick samples were conducted during January 2010 to December 2011. Only adult ticks were collected and no questing ticks were collected. All ticks were identified to the species level by standard guides and were stored at −20°C before DNA extraction.
Geographical distribution of investigated sites in Zhejiang Province.
Citation: The American Society of Tropical Medicine and Hygiene 92, 2; 10.4269/ajtmh.14-0587
DNA extraction.
Each adult tick was subjected individually to DNA extraction. Ticks were washed using 70% ethanol once; they were then washed three times with sterile deionized water to decontaminate the surface. Individual ticks were placed into different sterilized mortars and crushed with corresponding sterile pestles with liquid nitrogen. The DNA was prepared from the crushed ticks using the QIAamp Tissue Kit (Qiagen, Hilden, Germany) according to the manufacturer's instructions.
Polymerase chain reaction (PCR) amplification.
All tick samples were screened for Borrelia infection through testing them individually by nested PCR amplification, which was performed using a MyCyclerThermal Cycler (BIO-RAD, Hercules, CA) with the primers (Table 1) designed to amplify a fragment of 5S-23S rRNA as described previously.6
Polymerase chain reaction primers
Primer name | Target gene | Primer sequence (5′-3′) | Anneal temperature | Product size (bp) |
---|---|---|---|---|
B1 | 5S-23S rRNA | CGACCTTCTTCGCCTTAAAGC | 55°C | |
B2 | TAAGCTGACTAATACTAATTACCC | |||
B3 | TCCTAGGCATTCACCATA | 59°C | 245 | |
B4 | CTGCGAGTTCGCGGGAGA |
The reaction mixtures contained 10 mM Tris-HCl, 1.5 mM MgCl2, 50 mM KCl (pH 8.3), 200 mM each dNTP, 1.25 U Taq polymerase, and 0.5 mM each respective primer. Nested PCR was performed using 1 uL of the primary PCR product as the template. The PCR products were run in a 1.5% agarose gel, stained with gold view, and visualized using UV light. To avoid cross-contamination, all steps were performed in separate rooms; mastermix was prepared under a laminar air flow bench. In each PCR, at least two negative controls contained mastermix and sterile water instead of DNA template.
Cloning and sequencing of PCR products.
After electrophoresis, all positive DNA amplicons were purified using the Promega Wizard PCR Preps Kit (Promega, Madison, WI) and then cloned into the PGEM-T Easy vector system (Promega) following the manufacturer's protocol. The white recombinant clones were selected for sequencing. Bidirectional sequencing of positive PCR products were commercially conducted by Shanghai Sangon Biotechnology Co. (Shanghai, China).
Database DNA comparisons.
Our sequences were compared with published sequences using the Basic Local Alignment Tool (BLAST) program from the National Center for Biotechnology Information Website (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Data analysis.
Logistic regression analysis, χ2 test, or Fisher's exact test was used to compare Borrelia prevalence among different tick species, different sampling sites, and different host species. The dependent variable in the logistic regression was assigned as the prevalence status and the independent variables were tick species, sampling site, host species, tick species × sampling site, tick species × host species, sampling site × host species. The method of logistic regression used was forward-conditional. The stepwise probability was set to 0.05 for entry and 0.10 for removal. The classification cut-off was 0.5 and the maximum number of iterations was 20. Omnibus tests of model coefficients were also conducted. The difference was considered statistically significant when P < 0.05. Statistical analysis was performed with the use of Statistical Product and Service Solutions (SPSS 11.0; Chicago, IL).
Results
Tick samples.
A total of 447 adult ticks of 11 species were captured (Table 2). The dominant tick species were Haemaphysalis longicornis (47.43%) and Ixodes sinensis (21.03%) in Zhejiang Province. However, the abundance of tick species varied significantly (X2 = 1071.681, P = 0.000 < 0.05) in different areas. Haemaphysalis longicornis was dominant in Daishan (91.38%), Xinchang (80.00%), Taishun (76.67%), and Yongjia (94.29%); H. longicornis (21.43%), Rhiphicephalus haemaphysaloides (21.43%), and I. sinensis (22.86%) in Jindong; I. sinensis (100%) in Tiantai; H. longicornis (58.14%) and Rhipicephalus microplus (41.86%) in Xianju; Amblyomma testudinarium (23.96%) and I. sinensis (65.63%) in Anji; Ixodes granulatus (100%) in Wencheng (Table 2). Haemaphysalis longicornis ticks were collected from sheep (38.58%), cattle (54.72%), and Sus scrofa (6.60%). Ixodes sinensis ticks were from sheep (63.83%) and cattle (36.17%). Ixodes granulatus ticks were from Apodemus agrarius (41.67%), Rattus niviventer (27.78%), and Suncus murinus (30.55%). Additionally, R. haemaphysaloides and A. testudinarium were all from domestic dogs, all B. microplus were from cattle, H. yeni, H. hystricis, and H. asiaticum from S. scrofa, D. taiwanensis and I. ovatus were from Eragrotis amurensis.
Prevalence of Borrelia infection among different species ticks from different areas
Dai shan | Xin chang | Jin dong | Tian tai | Xian ju | An ji | Wen cheng | Tai shun | Yong jia | Total (n) | No. PCR positive (n) | Prevalence (%) | |
---|---|---|---|---|---|---|---|---|---|---|---|---|
Haemaphysalis longicornis− | 53 | 8 | 15 | 0 | 25 | 9 | 0 | 69 | 33 | 212 | 11 | 5.19 |
Rhipicephalus haemaphysaloides?− | 3 | 2 | 15 | 0 | 0 | 0 | 0 | 0 | 0 | 20 | 0 | 0 |
Amblyomma testudinarium?+ | 0 | 0 | 5 | 0 | 0 | 23 | 0 | 1 | 0 | 29 | 1 | 3.45 |
Ixodes sinensis+ | 0 | 0 | 16 | 15 | 0 | 63 | 0 | 0 | 0 | 94 | 1 | 1.06 |
Boophilus microplus?+ | 1 | 0 | 0 | 0 | 18 | 0 | 0 | 0 | 1 | 20 | 1 | 5.00 |
Haemaphysalis yeni− | 0 | 0 | 5 | 0 | 0 | 0 | 0 | 14 | 0 | 19 | 0 | 0 |
Dermacentor taiwanensis?− | 0 | 0 | 9 | 0 | 0 | 0 | 0 | 0 | 0 | 9 | 0 | 0 |
Haemaphysalis hystricis?− | 0 | 0 | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 5 | 0 | 0 |
Hyalomma asiaticum?− | 0 | 0 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
Ixodes granulates+ | 1 | 0 | 0 | 0 | 0 | 0 | 30 | 4 | 1 | 36 | 7 | 19.44 |
Ixodes ovatus?+ | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 2 | 0 | 2 | 0 | 0 |
Total (n) | 58 | 10 | 70 | 15 | 43 | 96 | 30 | 90 | 35 | 447 | 21 | 4.70 |
Positive (n) | 0 | 0 | 2 | 1 | 10 | 1 | 7 | 0 | 0 | |||
Prevalence (%) | 0 | 0 | 2.86 | 6.67 | 23.26 | 1.04 | 23.33 | 0 | 0 |
Experimentally confirmed vector (+), experimentally confirmed as being incapable of serving as a vector (−), unknown vector status but likely to be a vector (?+), unknown vector status but not likely to be a vector (?−).
Prevalence of Borrelia infection.
Overall, 4.70% (21 of 447) of the ticks were PCR positive. The average PCR-positive rates were 5.19% (11 of 212) for H. longicornis, 3.45% (1 of 29) for A. testudinarium, 1.06% (1 of 94) for I. sinensis, 5.00% (1 of 20) for R. microplus, and 19.44% (7 of 36) for I. granulatus, respectively (Table 2). No Borrelia DNA was detected in R. haemaphysaloides, H. yeni, D. taiwanensis, H. hystricis, H. asiaticum, and I. ovatus. The prevalence of Borrelia varied significantly among species (χ2 = 24.106, P = 0.012 < 0.05) and the prevalence in I. granulatus was significantly higher than that in other species of ticks (P = 0.001, Table 2).
The prevalences in Daishan, Xinchang, Jindong, Tiantai, Xianju, Anji, Wencheng, Taishun, and Yongjia were 0, 0, 2.86%, 6.67%, 23.26%, 1.04%, 23.33%, 0, and 0, respectively (Table 2). The prevalences of Xianju and Wencheng were significantly higher than that of other areas (χ2 = 69.385, P = 0.000 < 0.05).
Comparison to the sequences in the GenBank.
As shown in Table 3, 12 sequences were 99–100% identical to three B. garinii (GenBank accession nos.: L30119, AB178361, AB091797, AF497990), which were all B. garinii 5S-23S rRNA partial sequences detected from I. ricinus in Russia, Turkey, and Czech Republic, respectively. The sequences of samples 145, 168, 344, and 345 were identical to B. valaisiana 5S-23S rRNA partial sequence (GenBank accession no. HM100120), which was detected in I. granulatus ticks from Taiwan. Moreover, the sequences of samples 349, 350 were identical to another B. valaisiana 5S-23S rRNA partial sequence (GenBank accession no. HM100125), which was detected in I. granulatus ticks from Taiwan and the sequence of 354 had the highest sequence similarity (99%) to this sequence. The sequence of sample 348 was most similar (96%) to B. valaisiana 5S-23S rRNA partial sequence (GenBank accession no. JX888445), which was detected from human blood in Heilongjiang Province, China. The sequence of sample 360 was identical to B. yantze strain QSYSP3 5S-23S ribosomal RNA partial sequence detected in H. longicornis from southwestern China.
Sequence names, GenBank accession number, similar species, and source
Sequence names and accession nos. | Similar species | Source | Location |
---|---|---|---|
78 (KJ398171), 80 (KJ398172) | B. garinii (strain 20047) | H. longicornis | Jindong |
182 (KJ398175), 186 (KJ398176), 187 (KJ398177), 188 (KJ398178), 189 (KJ398179), 190 (KJ398180), 191 (KJ398181), 194 (KJ398182), 195 (KJ398183) | B. garinii (strain 20047) | H. longicornis | Xianju |
199 (KJ398184) | B. garinii (strain 20047) | A. testudinarium | Anji |
145 (KJ398173) | B. valaisiana (strain KM36) | I. sinensis | Tiantai |
168 (KJ398174) | B. valaisiana (strain KM36) | B. microplus | Xianju |
344 (KJ398185), 345 (KJ398186), 348 (KJ398187), 349 (KJ398188), 350 (KJ398189), 354 (KJ398190), 360 (KJ398191) | B. valaisiana (strain KM36, strain HL8), B. yantze (strain QSYSP3) | I. granulatus | Yongjia |
All sequences that were most similar to B. garinii were detected in H. longicornis except for one sequence that was detected in A. testudinarium (KJ398184). The majority of sequences that were most similar to B. valaisiana were detected in I. granulatus except for two sequences, one sequence was from I. sinensis and the other was from B. microplus (Table 3). The sequences that were most similar to B. garinii came from three areas (Jindong, Xianju, Anji) and the sequences that were most similar to B. valaisiana came from three additional areas (Tiantai, Xianju, Yongjia). Moreover, H. longicornis and A. testudinarium ticks, Borreia sequences detected in them were most similar to B. garinii, were collected from cattle and dogs, respectively. Ixodes granulatus, I. sinensis, and B. microplus, Borrelia sequences detected in them were most similar to B. valaisiana, were collected from S. scrofa, cattle, A. agrarius, and R. niviventer.
Discussion
Previous studies in China reported the prevalence and genetic characteristics of B. burgdorferi s.l. in ticks collected from different sites in Eastern China. A total of 11 species of ticks were found in nine areas of Eastern China. The distribution of tick species varied considerably in the different areas. This variability may have been caused by different hosts from which ticks were collected and different habitats in sampling sites. The dominant tick species of Zhejiang Province are H. longicornis and I. sinensis.
In our study, the overall infection rate with B. burgdorferi s.l. was found to be 4.70% among ticks as detected using nested PCR. Previous studies reported that Borrelia spp. were detected in 22 of 55 (40.00%) ticks,17 41 of 182 (22.53%) ticks,22 94 of 667 (14.09%) ticks,23 25.6% of I. persulcatus ticks,24 123 of 181 (67.96%) I. granulatus ticks,25 27 of 147 (18.37%) ticks,26 and 23 of 113 (20.35%) ticks.27 The lower infection rate in our study is most probably a result of different sampling regions, different tick species, different methods of tick collection or the differences in sensitivity for the different methods used for Borrelia detection.
Our data showed that the prevalences in I. granulatus and H. longicornis were higher than that in other species of ticks. The findings indicate that I. granulatus and H. longicornis may play roles as vector or carrier of Borrelia in Eastern China. However, we cannot exclude that other ticks might act as carriers for B. burgdorferi s.l. because of small sample sizes. Additionally, former studies have shown that I. granulatus ticks are vector of Borrelia, but H. longicornis only carry Borrelia and cannot transmit it.28,29 Therefore, H. longicornis ticks are not the main vector of Borrelia, although they were dominant in Zhejiang Province. Similarly, I. sinensis ticks were experimentally confirmed vector and H. yeni ticks were confirmed as being incapable of serving as a vector for B. burgdorferi s.l. Other tick species collected in our study have unknown vector status (Table 2). Of B. burgdorferi s.l. complex spirochetes, B. afzelii, B. bavariensis, B. garinii, B. spielmanii and B. burgdorferi sensu stricto are known to be pathogenic for humans, and B. valaisiana, and B. lusitaniae are considered potentially pathogenic.30 The finding of B. garinii and B. valaisiana or B. yangtze sp. nov. in ticks that were LD vectors indicate that transmission of LD via tick bite in Zhejiang Province is possible.
A report on distribution of B. burgdorferi s.l. in China shows that B. garinii was the main genotype in China and distributed mainly in northern China, B. afzelii was the second most frequently found species and distributed in both northern and southern China, and all B. valaisiana strains were isolated from southern China.31 Our study confirmed that two species of B. burgdorferi s.l. might exist in Zhejiang Province of which 12 sequences were most similar to the sequence of B. garinii and the other sequences were most similar to the sequence of B. valaisiana or B. yangtze sp. nov. The reason might be that Zhejiang Province is located in east-central China. The sequences, which were found in our study, are similar to sequences that have been designated B. yangtze sp. nov. or B. valaisiana in different studies. To determine the proper species designation further studies are required using multilocus sequence typing.
The majority of sequences that were most similar to B. garinii were detected in H. longicornis and the majority of sequences that were most similar to B. valaisiana or B. yangtze sp. nov. were detected in I. granulatus suggesting a relation between tick species and Borrelia species. Furthermore, B. garinii and B. valaisiana were detected from ticks collected from different host species indicating a relation between host species and Borrelia species. Cattle and dogs might be reservoirs for B. garinii and S.scrofa, cattle, A. agrarius, and R. niviventer might be reservoirs for B. valaisiana. The difference in Borrelia species distribution may be also relative to different tick species. Borrelia garinii is considered to be transmitted by birds, but hosts from which ticks were collected did not include birds in our study. As all ticks were adult, it is likely that Borrelia infections of these ticks were acquired during a previous blood meal.
There were several limitations to our study. First, the low numbers of ticks of each species in each region collected in different times and from different animals reduced the probabilities of getting useful information from this study. Second, the examined ticks were collected from animals rather than as questing specimens, which brings into question whether B. burgdorferi s.l. spirochetes would survive the molt, especially for non-Ixodes ticks. Finally, tick species from different sites varied significantly, which might influence infection rates of different sites.
In conclusion, the dominant tick species were H. longicornis and I. sinensis in Zhejiang Province. We detected B. burgdorferi s.l. in diverse species of ticks from different areas. Borrelia burgdorferi s.l. detected were similar to B. garinii, B. valaisiana, or B. yangtze sp. nov., which can cause human infections, indicating that B. burgdorferi s.l. infections might be largely unrecognized and these infections may be frequent in Zhejiang Province.
ACKNOWLEDGMENTS
We thank the physicians and staff at Pujiang, Lishui, Xiangshan, Yiwu, Anji, Haining, and Xianju Centers for Disease Control and Prevention for their support and assistance with this investigation.
- 1.↑
Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grundwaldt E, Davis JP, 1982. Lyme disease: a tick-borne spirochetosis? Science 216: 1317–1319.
- 2.↑
Oliver JH Jr, Owsley MR, Hutcheson HJ, James AM, Chen C, Irby WS, Dotson EM, McLain DK, 1993. Conspecificity of the ticks Ixodes scapularis and I. dammini (Acari: Ixodidae). J Med Entomol 30: 54–63.
- 3.↑
Fukunaga M, Okada K, Nakao M, Konishi T, Sato Y, 1996. Phylogenetic analysis of Borrelia species based on flagellin gene sequences and its application for molecular typing of Lyme disease borreliae. Int J Syst Bacteriol 46: 898–905.
- 4.
Wang G, van Dam AP, Schwartz I, Dankert J, 1999. Molecular typing of Borrelia burgdorferi sensu lato: taxonomic, epidemiological, and clinical implications. Clin Microbiol Rev 12: 633–653.
- 5.
Masuzawa T, Takada N, Kudeken M, Fukui T, Yano Y, Ishiguro F, Kawamura Y, Imai Y, Ezaki T, 2001. Borrelia sinica sp. nov., a Lyme disease-related Borrelia species isolated in China. Int J Syst Evol Microbiol 51: 1817–1824.
- 6.↑
Richter D, Postic D, Sertour N, Livey I, Matuschka FR, Baranton G, 2006. Delineation of Borrelia burgdorferi sensu lato species by multilocus sequence analysis and confirmation of the delineation of Borrelia spielmanii sp. nov. Int J Syst Evol Microbiol 56: 873–881.
- 7.
Postic D, Garnier M, Baranton G, 2007. Multilocus sequence analysis of atypical Borrelia burgdorferi sensu lato isolates-description of Borrelia californiensis sp. nov., and genomospecies 1 and 2. Int J Med Microbiol 297: 263–271.
- 8.↑
Chu CY, Liu W, Jiang BG, Wang DM, Weijia J, Jiang WJ, Zhao QM, Zhang PH, Wang ZX, Tang GP, Yang H, Cao WC, 2008. Novel genospecies of Borrelia burgdorferi sensu lato from rodents and ticks in southwestern China. J Clin Microbiol 46: 3130–3133.
- 9.
Margos G, Vollmer SA, Cornet M, Garnier M, Fingerle V, Wilske B, Bormane A, Vitorino L, Collares-Pereira M, Drancourt M, Kurtenbach K, 2009. A new Borrelia species defined by multilocus sequence analysis of housekeeping genes. Appl Environ Microbiol 75: 5410–5416.
- 10.
Rudenko N, Golovchenko M, Grubhoffer L, Oliver JH Jr, 2009. Borrelia carolinensis sp. nov., a new (14th) member of the Borrelia burgdorferi sensu lato complex from the southeastern region of the United States. J Clin Microbiol 47: 134–141.
- 11.
Margos G, Hojgaard A, Lane RS, Cornet M, Fingerle V, Rudenko N, Ogden N, Aanensen DM, Fish D, Piesman J, 2010. Multilocus sequence analysis of Borrelia bissettii strains from North America reveals a new Borrelia species, Borrelia kurtenbachii. Ticks Tick Borne Dis 1: 151–158.
- 12.
Casjens SR, Fraser-Liggett CM, Mongodin EF, Qiu WG, Dunn JJ, Luft BJ, Schutzer SE, 2011. Whole genome sequence of an unusual Borrelia burgdorferi sensu lato isolate. J Bacteriol 193: 1489–1490.
- 13.↑
Kawabata H, Takano A, Kadosaka T, Fujita H, Nitta Y, Gokuden M, Honda T, Tomida J, Kawamura Y, Masuzawa T, Ishiguro F, Takada N, Yano Y, Andoh M, Ando S, Sato K, Takahashi H, Ohnishi M, 2013. Multilocus sequence typing and DNA similarity analysis implicates that a Borrelia valaisiana-related sp. isolated in Japan is distinguishable from European B. valaisiana. J Vet Med Sci 75: 1201–1207.
- 14.↑
Ai CX, Wen YX, Zhang YG, Wang SS, Qiu GC, Shi ZX, Cheng ZQ, Li DY, Liu XD, 1987. Epidemiological study on Lyme disease in Hailin of Heilongjiang. China Pub Health 6: 82–85.
- 15.↑
Wan KL, Zhang ZF, Dou G, 1998. Investigation on primary vectors of Borrelia burgdorferi in China. Chin J Epidemiol 19: 263–266.
- 16.
Zhang ZF, Wan KL, Zhang JS, 1997. Studies on epidemiology and etiology of Lyme disease in China. Chin J Epidemiol 18: 8–11.
- 17.↑
Takada N, Masuzawa T, Ishiguro F, Fujita H, Kudeken M, Mitani H, Fukunaga M, Tsuchiya K, Yano Y, Ma XH, 2001. Lyme disease Borrelia spp. in ticks and rodents from northwestern China. Appl Environ Microbiol 67: 5161–5165.
- 18.↑
Wang DM, Hao Q, Cai XH, Wan KL, Wang ZX, Chen J, 2003. Study on ribotyping of Lyme borreliosis spirochete in Guizhou province. Chin J Epidemiol 24: 1129–1131.
- 19.↑
Zhang ZD, Chen YJ, Mei JH, Wang DB, Lin RW, Wu WY, Lv LZ, Wang C, Shi GP, 2001. Serological epidemiology investigation of Lyme disease in southern Zhejiang Province. Chin J Publ Health 17: 1036–1037.
- 20.
Gong ZY, Jiang LP, Wang Z, Ge JH, Pang WL, Chen YJ, Gao Y, Fang CF, Wang KL, Chen EF, Wang W, Cui QR, Xie SY, Chen K, 2005. Serological epidemiology investigation of Lyme disease in Zhejiang Province. Dis Surveill 20: 510–512.
- 21.↑
Cui WW, Deng J, Shi SF, Huang RJ, Xu K, Huang CX, Gan WQ, Xu XP, Xu XJ, Sun Z, Wang GX, Wan KL, 2007. Investigation on the seroepidemiology of Lyme in Hangzhou. Chin J Prev Med 8: 382–386.
- 22.↑
Chu CY, Jiang BG, Liu W, Zhao QM, Wu XM, Zhang PH, Zhan L, Yang H, Cao WC, 2008. Presence of pathogenic Borrelia burgdorferi sensu lato in ticks and rodents in Zhejiang, south-east China. J Med Microbiol 57: 980–985.
- 23.↑
Niu QL, Guan GQ, Yang JF, Fu YG, Xu ZK, Li YQ, Ma ML, Liu ZJ, Liu JL, Liu AH, Ren QY, Jorgensen W, Luo JX, Yin H, 2011. Detection and differentiation of Borrelia burgdorferi sensu lato in ticks collected from sheep and cattle in China. BMC Vet Res 7: 17.
- 24.↑
Liu S, Yuan C, Cui YF, Li BX, Wu LJ, Liu Y, 2012. Investigation of Borrelia spp. in ticks (Acari: Ixodidae) at the border crossings between China and Russia in Heilongjiang Province, China. Asia Pac J Trop Med 5: 459–464.
- 25.↑
Chao LL, Liu LL, Shih CM, 2012. Prevalence and molecular identification of Borrelia spirochetes in Ixodes granulatus ticks collected from Rattus losea on Kinmen Island of Taiwan. Parasite Vector 5: 167.
- 26.↑
Chao LL, Wu WJ, Shih CM, 2010. Molecular detection of Borrelia valaisiana-related spirochetes from Ixodes granulatus ticks in Taiwan. Exp Appl Acarol 52: 393–407.
- 27.↑
Huang CM, Wang HC, Lin YC, Chiu SH, Kao YS, Lee PL, Wang HI, Hung RC, Chan HI, Wu HS, Chiang CS, Mu JJ, 2010. The presence of Borrelia valaisiana-related genospecies in ticks and a rodent in Taiwan. J Microbiol 48: 877–880.
- 28.↑
Telford SR, Spielman A, 1989. Competence of a rabbit-feeding Ixodes (Acri: Ixodidae) as a vector of the Lyme disease spirochete. J Med Entomol 26: 118–121.
- 29.↑
Sun Y, Xu RM, Guo TY, Zhang PH, Cao WC, 2003. Incapability of Haemaphysalis longicornis and Dermacentor nuttalli to acquire and trans-stadial transmit the Lyme spirochetes Borrelia garinii. Acta Parasitol Med Entomol Sin 10: 174–180.
- 30.↑
Rudenko N, Golovchenko M, Grubhoffer L, Oliver JH Jr, 2011. Updates on Borrelia burgdorferi sensu lato complex with respect to public health. Ticks Tick Borne Dis 2: 123–128.
- 31.↑
Hao Q, Hou XX, Geng Z, Wang KL, 2011. Distribution of Borrelia burgdorferi sensu lato in China. J Clin Microbiol 49: 647–650.