Introduction
Although tuberculosis (TB) diagnosis may be assumed from clinical history and radiological findings, confirmation requires laboratory-based testing. Globally, TB laboratory diagnosis relies principally on smear microscopy that has low and variable sensitivity (50–80%) and suboptimal specificity.1,2 Culture followed by phenotypic identification and drug resistance testing is a “gold standard,”3,4 but has the disadvantage of usually requiring several weeks and species.5 In addition, final species identification requires additional phenotypic or genotypic testing, the latter not always being conclusive.
An alternative method for detection and/or species identification comprises the amplification of specific loci by polymerase chain reaction (PCR), which is theoretically capable of detecting a single copy of DNA from one cell. The PCR is used in the diagnosis of several infectious diseases and can give results in a few hours. For TB diagnosis, multiple commercial and in-house nucleic acid amplification techniques have been developed6,7 and recently, a commercial real-time PCR assay has been endorsed by the World Health Organization (WHO) (Xpert RIF/TB, GeneXpert, Cepheid, Canada) for the first time.8 However, in-house PCR assays that use equipment and reagents that are available from diverse suppliers in competitive markets may be more affordable, feasible, and sustainable than using “sole-source” tests. We therefore aimed to develop and evaluate an in-house diagnostic real-time PCR using equipment and reagents that are widely available and a non-commercial sputum processing method. We included an internal control to try to increase reliability. The performance was evaluated in patients with suspected pulmonary TB by comparing results to direct smear microscopy and culture.
Material and Methods
Primer design.
The primers and probe design was based on the sequence homology of the insertion sequence 6110 (IS6110) for all species of the Mycobacterium tuberculosis complex (MTBc). A 123 base pair (bp) region, which represents one of the highly conserved regions, was chosen as the target region for primer amplification. The fluorogenic BHQ-1 probe, labeled at 5′ with FAM and at 3′ with a dark quencher dye, was designed to anneal to an internal sequence of the amplified region. The sense and antisense primers and BHQ-1 probe were designated IS6110-TF, IS6110-TR, and IS6110-TP, respectively.
As an internal control to check for inhibition, a 105 bp region from ERV3 sequence was chosen as the target for primer amplification.9 The fluorogenic BHQ-1 probe, labeled at 5′ with HEX and at 3′ with a dark quencher dye, was designed to anneal to an internal sequence of the amplified region. The sense and antisense primers and BHQ-1 probe were designated ERV3-TF, ERV3-TR, and ERV3-TP, respectively (Table 1). All primers and probes were designed using the AlleleID v. 7.0 software (PREMIER Biosoft, Palo Alto, CA).
Primers and BHQ-probes designed and used in this study
| Name | Sequence 5′ → 3′ | Final conc. (nM) | Location (nucleotide) | Sense |
|---|---|---|---|---|
| IS6110-probe | TCTCAGTACACATCGATCCGGT | 100 | 1014 | + |
| IS6110-forward | AGACGTTATCCACCATAC | 400 | 986 | + |
| IS6110-reverse | AGTGCATTGTCATAGGAG | 400 | 1108 | − |
| ERV3-probe | CGAACCTGCACCATCAAGTCA | 100 | 972 | + |
| ERV3-forward | CCCAAGATAATTTCACACTAA | 400 | 938 | + |
| ERV3-reverse | GAGCAATACAGAATTTTCCA | 400 | 1042 | − |
DNA extraction.
Samples for real-time PCR (qPCR) analysis (a 10 μL loop of mycobacterial isolate or 50 μL of decontaminated sputum) were heat inactivated at 95°C for 20 min and precipitated with 300 μL cold isopropanol, incubated overnight at −20°C, centrifuged (13,000 rpm for 10 min), washed once with ice cold absolute ethanol, and the pellet was resuspended in 100 μL TE 1X (Tris 10 mM, EDTA 1 mM, pH 8.0) buffer. One microliter (1 μL) of DNA solution was used in the qPCR.
qPCR assay.
The PCR was performed using a LightCycler 480 Real-Time PCR System (Roche Applied Science, Penzberg, Germany). Each multiplex PCR assay was performed in a 10 μL final reaction volume containing 2× SensiMix II Probe master (Bioline Reagents Ltd, London, UK). The following thermal profile was used: polymerase activation at 95°C for 10 min followed by 45 amplification cycles of 10 sec at 95°C and 1 min at 60°C each (annealing-extension step). A qPCR result for clinical specimens was considered negative if only a signal for ERV3 was observed, positive in case of a positive IS6110 reaction irrespective of the presence of an ERV3 peak, and invalid if both the ERV3 and IS6110 reaction were negative. For qPCR the cycler threshold “CT” is the number of PCR cycles in which the PCR product starts to be detected and represents a relative measure of the concentration of target DNA in the PCR reaction. Data were collected at the annealing step of each cycle and the CT for each sample was calculated by determining the point at which the fluorescence exceeded the threshold limit. The IS6110 PCR was considered positive if the CT was ≤ 37 and the ERV3 PCR was considered positive if the CT was ≤ 40.
Analytical sensitivity.
A pure culture of Mycobacterium tuberculosis reference strain Mt1432310 was used to determine the detection limit (analytical sensitivity). Ten-fold serial dilutions from 107 to 1 fg (equivalent to 106–10° genome copies) were prepared in triplicate from the genomic DNA,11 and each of them was mixed with 5.4 ng of human DNA derived from 1.5 × 103 peripheral blood mononuclear cells from a volunteer. The standard curve was calculated automatically by plotting the CT values against each standard of known concentration and by extrapolating the linear regression line of this curve.
Quality control.
Duplicate positive controls were included in all three of the PCR runs. We also analyzed 10 samples from the Quality Control Molecular Diagnostics 2012 M. tuberculosis external quality assessment panel (QCMD, Glasgow, UK) comprising eight positive controls containing M. tuberculosis in the concentration range 4–400 bacilli/10 μL in protein-rich buffer (0.1% Tween 20, 0.5% bovine serum albumin in phosphate buffered saline).
To assess the specificity of the qPCR all three runs included duplicate negative samples (no template control) to discriminate possible background. The external quality assessment panel also contained two negative control pooled specimens negative for MTBc. To assess the species specificity of the qPCR, we randomly selected 84 non-tuberculosis mycobacteria reference strains belonging to 35 species from the public collection of mycobacterial cultures (BCCM/ITM) (Table 2).
Eighty-four samples of 35 non-tuberculosis mycobacteria strains were randomly selected to test the specificity of the assay*
| Species | Biological origin | n |
|---|---|---|
| Mycobacterium abscessus | human | 4 |
| Mycobacterium alveum | human | 1 |
| Mycobacterium angelicum | human | 1 |
| Mycobacterium aurum | 1 | |
| Mycobacterium avium | animal/human | 10 |
| Mycobacterium chelonae | 1 | |
| Mycobacterium chitae | 2 | |
| Mycobacterium diernhoferi | 1 | |
| Mycobacterium duvalii | 1 | |
| Mycobacterium engbaecki | 1 | |
| Mycobacterium fallax | environment/human | 2 |
| Mycobacterium fortuitum | animal/human | 8 |
| Mycobacterium frederiksbergense | human | 1 |
| Mycobacterium genavense | animal | 2 |
| Mycobacterium gilvum | animal/human | 2 |
| Mycobacterium intracellulare | animal | 6 |
| Mycobacterium kansasii | 1 | |
| Mycobacterium komossense | environment | 2 |
| Mycobacterium lentiflavum | human | 1 |
| Mycobacterium malmoense | 1 | |
| Mycobacterium nonchromogenicum | environment | 4 |
| Mycobacterium obuense | 1 | |
| Mycobacterium parafortuitum | environment | 3 |
| Mycobacterium peregrinum | animal/human | 6 |
| Mycobacterium rhodesiense | 2 | |
| Mycobacterium scrofulaceum | environment | 1 |
| Mycobacterium septicum | human | 1 |
| Mycobacterium simiae | animal | 2 |
| Mycobacterium smegmatis | 2 | |
| Mycobacterium sphagnum | 2 | |
| Mycobacterium terrae | 3 | |
| Mycobacterium thermoresistibile | environment | 1 |
| Mycobacterium ulcerans | human | 5 |
| Mycobacterium vaccae | 1 | |
| Mycobacterium xenopi | 1 |
Because DNA was isolated from cultures, polymerase chain reaction (PCR) remained negative for IS6110 and ERV3 for all the samples except for the positive control that was run in duplicate.
Clinical specimens.
Single sputum samples were collected in Lima, Peru from patients (N = 112) with suspected TB who had been coughing for ≥ 15 days. Subjects were untreated TB patients with positive sputum smear microscopy (N = 64), patients with microscopy smear-negative sputum that was subsequently confirmed to be TB culture-positive (N = 20), and patients diagnosed as not having TB who subsequently had confirmatory negative TB smear microscopy and culture (N = 28).
Microbiology.
An aliquot (1 mL) from each sample was decontaminated by the N-Acetyl-L-Cysteine-Sodium Hydroxide (NALC/NaOH) method,12 and examined by Ziehl-Neelsen staining.13,14 A second aliquot (1 mL) of the same sample was decontaminated by the NaOH/NaCl (1:1 v/v) method,15 the pellet resuspended in 200 μL of sterile TE 1× buffer (Tris 10 mM, EDTA 1 mM, pH 8.0), and 75 μL were inoculated onto each of two Löwenstein-Jensen tubes.
Analysis.
All laboratory procedures were performed by personnel who were blinded to sample details including the results of all other tests. The clinical sensitivity and specificity of the qPCR were calculated using 2 × 2 tables by comparing results to culture on Löwenstein-Jensen medium that was considered to be the gold standard test. The 95% confidence intervals (95%CI) of proportions were calculated using the Stata program (version 12, StataCorp., College Station, TX).
Ethics.
All human subjects gave informed written consent and the clinical protocols that involved sample preparation for diagnostics research were approved by the institutional ethics committee at the Universidad Peruana Cayetano Heredia and by the Regional Health Direction from the Ministry of Health. This laboratory research project used only anonymous unlinked specimens and therefore was exempted from human subjects research approval. None of the investigators have any conflict of interest in relation to this work.
Results
Analytical sensitivity.
Results of 10-fold serial dilutions are reported as CT numbers versus logs of starting quantities of DNA. The PCR efficiency was 1.9 with and without the presence of human DNA (Figure 1A and B). The detection limit of this PCR assay was 10 fg of DNA/reaction which is equivalent to 1 bacillus (Figure 2).
Multiplex real-time polymerase chain reaction (qPCR) assay using eight samples of which human DNA was mixed with10-fold dilutions of DNA from Mycobacterium tuberculosis reference strain Mt14323. Fluorescence (y axis) from the qPCR products is plotted against the number of cycles (x axis). Each experiment was run in triplicate and the results from each identical triplicate assay are shown in red, green, and blue. The flat basal purple line indicates the negative control samples. (A) Detection of M. tuberculosis IS6110 gene with a FAM-labeled probe (465–560 nm) showing the increasing number of cycles required to detect decreasing amounts of Mycobacterium tuberculosis complex (MTB) DNA. The most dilute sample tested contained 10° fg, which is equivalent to the amount of DNA in a single M. tuberculosis bacillus and that was detected with 37 cycles. (B) Concurrent detection of human DNA (ERV3) with a VIC-labeled probe (533–580nm) in the same assays as shown in (A) showing that all assays were positive, indicating that these assays were valid and not prevented by the presence of PCR inhibitors. High cycle numbers were required because ERV3 was present as a unique copy compared to IS6110.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Multiplex real-time polymerase chain reaction (qPCR) assay using eight samples of which human DNA was mixed with10-fold dilutions of DNA from Mycobacterium tuberculosis reference strain Mt14323. Fluorescence (y axis) from the qPCR products is plotted against the number of cycles (x axis). Each experiment was run in triplicate and the results from each identical triplicate assay are shown in red, green, and blue. The flat basal purple line indicates the negative control samples. (A) Detection of M. tuberculosis IS6110 gene with a FAM-labeled probe (465–560 nm) showing the increasing number of cycles required to detect decreasing amounts of Mycobacterium tuberculosis complex (MTB) DNA. The most dilute sample tested contained 10° fg, which is equivalent to the amount of DNA in a single M. tuberculosis bacillus and that was detected with 37 cycles. (B) Concurrent detection of human DNA (ERV3) with a VIC-labeled probe (533–580nm) in the same assays as shown in (A) showing that all assays were positive, indicating that these assays were valid and not prevented by the presence of PCR inhibitors. High cycle numbers were required because ERV3 was present as a unique copy compared to IS6110.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Multiplex real-time polymerase chain reaction (qPCR) assay using eight samples of which human DNA was mixed with10-fold dilutions of DNA from Mycobacterium tuberculosis reference strain Mt14323. Fluorescence (y axis) from the qPCR products is plotted against the number of cycles (x axis). Each experiment was run in triplicate and the results from each identical triplicate assay are shown in red, green, and blue. The flat basal purple line indicates the negative control samples. (A) Detection of M. tuberculosis IS6110 gene with a FAM-labeled probe (465–560 nm) showing the increasing number of cycles required to detect decreasing amounts of Mycobacterium tuberculosis complex (MTB) DNA. The most dilute sample tested contained 10° fg, which is equivalent to the amount of DNA in a single M. tuberculosis bacillus and that was detected with 37 cycles. (B) Concurrent detection of human DNA (ERV3) with a VIC-labeled probe (533–580nm) in the same assays as shown in (A) showing that all assays were positive, indicating that these assays were valid and not prevented by the presence of PCR inhibitors. High cycle numbers were required because ERV3 was present as a unique copy compared to IS6110.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Standard curve for the real-time polymerase chain reaction qPCR analysis was done from the same stock of DNA of Mycobacterium tuberculosis reference strain Mt14323. Threshold cycle (y axis) of the reaction is plotted against the Log of M. tuberculosis genomic DNA (x axis). Threshold cycle indicates the number of cycles in which the PCR product was enough to be detected. Ten-fold serial dilutions were done from 107 to 10° fg (equivalent to 106–10° genome copies) and were tested with (red) and without (blue) human DNA. The reaction efficiency was 99.9% for both curves.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Standard curve for the real-time polymerase chain reaction qPCR analysis was done from the same stock of DNA of Mycobacterium tuberculosis reference strain Mt14323. Threshold cycle (y axis) of the reaction is plotted against the Log of M. tuberculosis genomic DNA (x axis). Threshold cycle indicates the number of cycles in which the PCR product was enough to be detected. Ten-fold serial dilutions were done from 107 to 10° fg (equivalent to 106–10° genome copies) and were tested with (red) and without (blue) human DNA. The reaction efficiency was 99.9% for both curves.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Standard curve for the real-time polymerase chain reaction qPCR analysis was done from the same stock of DNA of Mycobacterium tuberculosis reference strain Mt14323. Threshold cycle (y axis) of the reaction is plotted against the Log of M. tuberculosis genomic DNA (x axis). Threshold cycle indicates the number of cycles in which the PCR product was enough to be detected. Ten-fold serial dilutions were done from 107 to 10° fg (equivalent to 106–10° genome copies) and were tested with (red) and without (blue) human DNA. The reaction efficiency was 99.9% for both curves.
Citation: The American Society of Tropical Medicine and Hygiene 91, 4; 10.4269/ajtmh.13-0603
Quality control.
The results for the quality control samples are shown in Table 3. All positive control samples yielded positive qPCR results and all no template controls were negative in all qPCR runs. Among the external quality assessment panel, the qPCR results were appropriate for all 8 of 8 positive samples and 2 of 2 negative samples included as controls. All 84 non-tuberculosis mycobacteria reference strains were qPCR negative for IS6110. They were all negative for ERV3 internal control, which was expected because they were isolated from cultures that did not contain human DNA. Thus, for the 106 quality control samples the sensitivity was 100% (95% CI 78–100%) and specificity was 100% (95% CI 96–100%).
Comparison of real-time PCR results with microscopy and Löwenstein-Jensen culture for detecting Mycobacterium tuberculosis complex
| Controls/samples | M. tuberculosis | qPCR positive | qPCR negative | qPCR total* | Sensitivity (95% CI) | Specificity (95% CI) |
|---|---|---|---|---|---|---|
| Positive quality controls | Positive | 14 | 0 | 14 | 100% (78–100%) | NA |
| Negative quality controls | Negative | 0 | 8 | 8 | NA | 100% (63–100%) |
| Quality control non-tuberculosis mycobacteria | Negative | 0 | 84 | 84 | NA | 100% (95–100%) |
| All quality control samples | Positive | 14 | 0 | 102 | 100% (78–100%) | 100% (96–100%) |
| Negative | 0 | 92 | ||||
| Smear-positive patient sputum | Positive | 60 | 4 | 64 | 94% (90–98%) | NA |
| Smear-negative patient sputum | Positive | 19 | 1 | 20 | 95% (91–99%) | NA |
| Control patient sputum | Negative | 1 | 24 | 25 | NA | 96% (92–100%) |
| All patient sputum | Positive | 79 | 5 | 109 | 94% (90–98%) | 96% (92–100%) |
| Negative | 1 | 24 | ||||
| All quality control and patient sputum samples | Positive | 93 | 5 | 215 | 95% (89–98%) | 99% (95–100%) |
| Negative | 1 | 116 | ||||
Three samples were excluded because the IS6110 and internal control qPCR were both negative (see results).
CI = confidence intervals.
Clinical specimens.
All Löwenstein-Jensen cultures gave interpretable results and 100% (84 of 84) of TB cases were confirmed to be culture positive, whereas all samples from non-TB patients were culture negative. We obtained valid qPCR results in 109 of 112 samples; 3 of 112 (2.7%) others failed because they showed neither the product corresponding to the IS6110 sequence nor the product for the ERV3 internal control. For the valid results, qPCR analysis confirmed 94% (79 of 84) of the culture-positive samples, and predicted absence of TB DNA in 96% (24 of 25) of the negative samples. Hence, the qPCR had 94% (95% CI 90–98%) sensitivity and 96% (95% CI 92–100%) specificity compared with Löwenstein-Jensen culture.
All quality control and clinical specimens.
Considering together the 215 quality control and clinical specimens the qPCR accuracy is shown in Table 3: sensitivity 95% (95% CI 89–98% and specificity 99% (95–100%).
Speed and cost.
The use of real-time PCR provided diagnostic information within 24 hours from receipt of the clinical specimen. Excluding the expense of the qPCR thermocycler device self, the running costs (reagents and materials) of this MTBc assay were ∼US$5.00 for purchases in Peru.
Discussion
Acid-fast bacilli (AFB) smear microscopy plays an important role in the early diagnosis of mycobacterial infections because it can be performed rapidly, within a few hours of sample collection, and requires only basic skills and equipment so it is often the only locally available diagnostic method in low-income countries. However, microscopy is prone to false negative results because it can only detect mycobacterial concentrations above ∼10,000 AFB/mL of specimen. Culture is more sensitive but may be hazardous to staff and results become available only after weeks of incubation.
The development of DNA probes for rapid detection of mycobacteria has been reported, and although they may be of use in identifying cultures of M. tuberculosis, they lack the sensitivity required for direct detection of the organism in specimen.16–24 Currently, several assays are commercially available for the detection of the M. tuberculosis complex, including the Cobas Amplicor MTB PCR test (Roche Diagnostics, Basel, Switzerland), the RealArt Mycobact Diff Kit (Qiagen, Hamburg, Germany),25 AMTD (Gen-Probe, Inc. San Diego, CA),26 the Inno-LiPA line probe assay (Innogenetics, Ghent, Belgium),27 the GenoType MTDRplus assay (Hain Lifescience, Nehren, Germany),28 and the Xpert RIF/TB, GeneXpert, Cepheid, Canada).8 These commercial assays are divided into two methods: conventional PCR followed by probe hybridization and real-time PCR. They require purified DNA by enzymatic lysis and phenol-chloroform extraction, ultrasound-based platforms or commercial kits. In this study, we used heating as the only agent to break down the bacteria and to release DNA followed by ethanol precipitation, which simplified the overall procedure, making the method potentially useful for routine clinical practice.
The IS6110 is an insertion element found exclusively within the members of the MTBc and, because of this exclusivity, it has become an important diagnostic tool in the identification of MTBc species.29–31 McHugh and others32 found that some non-tuberculosis mycobacteria (NTM) contain IS6110 homologs, which potentially could affect specificity; however, in our study none of the NTM amplified. Another benefit is that this sequence has been reported to be present in multiple copies1–25 in the genome.33,34 Because IS6110 can be found as several copies, our qPCR could detect as little as 0.01 pg of DNA/mL, which is equivalent to 1 bacillus. This compares to Löwenstein-Jensen culture, which detects 10–100 viable mycobacteria/mL of sample and the Gene Xpert System's MTB/RIF assay, which detects 131 colony-forming units (CFU)/mL.35 The most sensitive limit of detection (LOD) theoretically possible is three copies per PCR, assuming a Poisson distribution.36 The analytical sensitivity is defined as the concentration that can be detected with reasonable certainty (95% probability is commonly used) with a given analytical procedure.
Five culture-positive samples had false-negative PCR results and three samples from control subjects failed because they did not show amplification for the internal control. One of the latter samples was diluted 1/10 to decrease the possible presence of inhibitors, but the result remained negative. In addition to human error, poor amplification, or the lack of enough copies of IS6110 (< 3 copies), this could be explained by the presence of inhibitors of the amplifying system sample that may be observed in 2.9–20% of cases.37
This assay provides added value over previously published in-house tests by inclusion of the ERV3 gene, an evolutionarily conserved single-copy human endogenous retrovirus with a coding envelope gene potentially involved in important placental functions.38 The use of ERV3 as an internal control39 will identify the presence of false negative PCR results caused by contamination and/or inhibition.
We simplified DNA extraction to use only heat and ethanol precipitation, potentially facilitating implementation in resource-poor settings and avoiding the high cost of commercial kits for DNA isolation.6,40 To avoid sole-source reagents and equipment that can be difficult to import, afford, and sustain in some settings, we used a TaqMan real-time PCR assay and obtained sensitivity similar to the much slower Löwenstein-Jensen culture.
Excluding the expense of the qPCR thermocycler device self, the running costs (reagents and small materials) of this MTBc assay are ∼US$5.00, lower than the Xpert RIF/TB (US$10.00–$100 in different American countries) and the Hain Assay (US$10.00 in Peru).
Thus, the real-time PCR proposed in this study, showed a high level of specificity and sensitivity, short turn-around time, and relatively low cost. These results justify further evaluation of this relatively simple, low-cost test to determine diagnostic reliability in operational settings.
ACKNOWLEDGMENTS
We thank our field workers for data and sample collection and the staff of the health care facilities for their continuous support in the conduction of the study.
- 1.↑
Master RN, section editor, 1992. Microbiology. Clinical Microbiology Procedures Handbook. Volume I. Washington, DC: ASM.
- 2.↑
Steingart KR, Ng V, Henry M, Hopewell PC, Ramsay A, Cunningham J, Urbanczik R, Perkins MD, Aziz MA, Pai M, 2006. Sputum processing methods to improve the sensitivity of smear microscopy for tuberculosis: a systematic review. Lancet Infect Dis 6: 664–674, Review.
- 3.↑
Katila ML, Katila P, Erkinjuntti-Pekkanen R, 2000. Accelerated detection and identification of Mycobacteria with MGIT 960 and COBAS AMPLICOR Systems. J Clin Microbiol 38: 960–964.
- 4.↑
Morán Mogue MC, Hernández DA, Pena Montes de Oca PM, Gallegos Arreola MP, Flores Martínez SE, Montoya Fuentes H, Figuera LE, Villa Manzanares L, Sánchez Corona J, 2000. Detección de Mycobacterium tuberculosis mediante la reacción en cadena de la polimerasa en una población seleccionada del noroccidente de México. Rev Panam Salud Publica 7: 389–394.
- 5.↑
Parimango D, Chávez M, Luján M, Otiniano M, Robles H, Muñoz E, 2007. Comparación de los medios Ogawa y Löwenstein-Jensen en el aislamiento de Mycobacterium tuberculosis de pacientes con tuberculosis pulmonar. Hospital Regional Docente de Trujillo, Perú. Rev. Med. Vallejiana 4: 24–31.
- 6.↑
Ling DI, Flores LL, Riley LW, Pai M, 2008. Commercial nucleic-acid amplification tests for diagnosis of pulmonary tuberculosis in respiratory specimens: meta-analysis and meta-regression. PLoS One 3: e1536.
- 7.↑
Flores LL, Pai M, Colford JM Jr, Riley LW, 2005. In-house nucleic acid amplification tests for the detection of Mycobacterium tuberculosis in sputum specimens: meta-analysis and meta-regression. BMC Microbiol 5: 55–63.
- 8.↑
Moure R, Muñoz L, Torres M, Santin M, Martín R, Alcaide F, 2011. Rapid detection of Mycobacterium tuberculosis complex and rifampin resistance in smear-negative clinical samples by use of an integrated real-time PCR method. J Clin Microbiol 49: 1137–1139.
- 9.↑
Yuan CC, Miley W, Waters D, 2001. A quantification of human cells using an ERV-3 real time PCR assay. J Virol Methods 91: 109–117.
- 10.↑
Van Embden JDA, Cave MD, Crawford JT, Dale JW, Eisenach KD, Gicquel B, Hermans P, Martin C, McAdam R, Shinnick TM, Small PM, 1993. Strain identification of Mycobacterium tuberculosis by DNA fingerprinting: recommendations for a standardized methodology. J Clin Microbiol 31: 406–409.
- 11.↑
Käser M, Ruf MT, Huaser J, Marsollier L, Pluschke G, 2009. Optimized method for preparation of DNA from pathogenic and environmental Mycobacteria. Appl Environ Microbiol 75: 414–418.
- 12.↑
Palomino JC, 2006. Newer diagnostics for tuberculosis and multidrug resistant tuberculosis. Curr Opin Pulm Med 12: 172–178.
- 13.↑
Somoskovi A, Hotaling JE, Fitzgerald M, O'Donnell D, Parsons LM, Salfinger M, 2001. Lessons from a proficiency testing event for acid-fast microscopy. Chest 120: 250–257.
- 14.↑
Van Deun A, Hamid Salim A, Aung KJ, Hossain MA, Chambugonj N, Hye MA, Kawria A, Declercq E, 2005. Performance of variations of caebolfuchsin staining of sputum for AFB under field conditions. Int J Tuberc Lung Dis 9: 1127–1133.
- 15.↑
Ricaldi JN, Guerra H, 2008. A simple and improved method for diagnosis of tuberculosis using hypertonic saline and sodium hydroxide (HS–SH) to concentrate and decontaminate sputum. Trop Doct 38: 97–99.
- 16.↑
Altamirano M, Kelly MT, Wong A, Bessuille ET, Black WA, Smith JA, 1992. Characterization of a DNA probe for detection of Mycobacterium tuberculosis complex in clinical samples by polymerase chain reaction. J Clin Microbiol 30: 2173–2176.
- 17.
Beige J, Lokies J, Schaberg T, Finckh U, Fischer M, Mauch H, Lode H, Köhler B, Rolfs A, 1995. Clinical evaluation of a Mycobacterium tuberculosis PCR assay. J Clin Microbiol 33: 90–95.
- 18.
Clarridge JE 3rd, Shawar RM, Shinnick TM, Plikaytis BB, 1993. Large-scale use of polymerase chain reaction for detection of Mycobacterium tuberculosis in a routine mycobacteriology laboratory. J Clin Microbiol 31: 2049–2056.
- 19.
Cousins DV, Wilton SD, Francis BR, Gow BL, 1992. Use of polymerase chain reaction for rapid diagnosis of tuberculosis. J Clin Microbiol 30: 255–258.
- 20.
Eisenach KD, Cave MD, Bates JH, Crawford JT, 1990. Polymerase chain reaction amplification of a repetitive DNA sequence specific for Mycobacterium tuberculosis. J Infect Dis 161: 977–981.
- 21.
Folgueira L, Delgado R, Palenque E, Noriega AR, 1993. Detection of Mycobacterium tuberculosis DNA in clinical samples by using a simple lysis method and polymerase chain reaction. J Clin Microbiol 31: 1019–1021.
- 22.
Kocagöz T, Yilmaz E, Ozkara S, Kocagöz S, Hayran M, Sachedeva M, Chambers HF, 1993. Detection of Mycobacterium tuberculosis in sputum samples by polymerase chain reaction using a simplified procedure. J Clin Microbiol 31: 1435–1438.
- 23.
Kox LF, Rhienthong D, Miranda AM, Udomsantisuk N, Ellis K, van Leeuwen J, van Heusden S, Kuijper S, Kolk AH, 1994. A more reliable PCR for detection of Mycobacterium tuberculosis in clinical samples. J Clin Microbiol 32: 672–678.
- 24.↑
Moore DF, Curry JL, 1995. Detection and identification of Mycobacterium tuberculosis directly from sputum sediments by Amplicor PC. J Clin Microbiol 33: 2686–2691.
- 25.↑
Beqaj SH, Flesher R, Walker GR, Smith SA, 2007. Use of the real-time PCR assay in conjunction with MagNA Pure for the detection of mycobacterial DNA from fixed specimens. Diagn Mol Pathol 16: 169–173.
- 26.↑
Piersimoni C, Scarparo C, 2003. Relevance of commercial amplification methods for direct detection of Mycobacterium tuberculosis complex in clinical samples. J Clin Microbiol 41: 5355–5365.
- 27.↑
Lebrun L, Weill FX, Lafendi L, Houriez F, Casanova F, Gutierrez MC, Ingrand D, Lagrange P, Vincent V, Herrmann JL, 2005. Use of the INNO-LiPA-MYCOBACTERIA assay (version 2) for identification of Mycobacterium avium-Mycobacterium intracellulare-Mycobacterium scrofulaceum complex isolates. J Clin Microbiol 43: 2567–2574.
- 28.↑
Richter E, Weizenegger M, Fahr AM, Rüsch-Gerdes S, 2004. Usefulness of the GenoType MTBC assay for differentiating species of the Mycobacterium tuberculosis complex in cultures obtained from clinical specimens. J Clin Microbiol 42: 4303–4306.
- 29.↑
Mazzarelli G, Rindi L, Piccoli P, Scarparo C, Garzelli C, Tortoli E, 2003. Evaluation of the BDProbeTec ET system for direct detection of Mycobacterium tuberculosis in pulmonary and extrapulmonary samples: a multicenter study. J Clin Microbiol 41: 1779–1782.
- 30.
Chen X, Yang Q, Kong H, Chen Y, 2012. Real-time PCR and amplified MTD for rapid detection of Mycobacterium tuberculosis in pulmonary specimens. Int J Tuberc Lung Dis 16: 235–239.
- 31.↑
Eigner U, Veldenzer A, Holfelder M, 2013. Evaluation of the FluoroType MTB assay for the rapid and reliable detection of Mycobacterium tuberculosis in respiratory tract specimens. Clin Lab 59: 1179–1181.
- 32.↑
McHugh TD, Newport LE, Gillespie SH, 1997. IS6110 homologs are present in multiple copies in mycobacteria other than tuberculosis-causing mycobacteria. J Clin Microbiol 35: 1769–1771.
- 33.↑
Thierry D, Cave MD, Eisenach KD, Crawford JT, Bates JH, Gicquel B, Guesdon JL, 1990. IS6110, an IS-like element of Mycobacterium tuberculosis complex. Nucleic Acids Res 18: 188.
- 34.↑
Kurepina NE, Sreevatsan S, Plikaytis BB, Bifani PJ, Connell ND, Donnelly RJ, van Sooligen D, Musser JM, Kreiswirth BN, 1998. Characterization of the phylogenetic distribution and chromosomal insertion sites of five IS6110 elements in Mycobacterium tuberculosis: non-random integration in the dnaA-dnaN region. Tuber Lung Dis 79: 31–42.
- 35.↑
Helb D, Jones M, Story E, Boehme C, Wallace E, Ho K, Kop J, Owens MR, Rodgers R, Banada P, Safi H, Blakemore R, Lan NT, Jones-López EC, Levi M, Burday M, Ayakaka I, Mugerwa RD, McMillan B, Winn-Deen E, Christel L, Dailey P, Perkins MD, Persing DH, Alland D, 2010. Rapid detection of Mycobacterium tuberculosis and rifampin resistance by use of on-demand, near-patient technology. J Clin Microbiol 48: 229–237.
- 36.↑
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M, Mueller R, Nolan T, Pfaffl MW, Shipley GL, Vandesompele J, Wittwer CT, 2009. The MIQE guidelines: minimum information for publication of quantitative real-time PCR experiments. Clin Chem 55: 611–622.
- 37.↑
Burkardt HJ, 2000. Standardization and quality control of PCR analyses. Clin Chem Lab Med 38: 87–91.
- 38.↑
De Parseval N, Hiedmann T, 1998. Physiological knockout of the envelope gene of the single-copy ERV-3 human endogenous retrovirus in a fraction of the caucasian population. J Virol 72: 3442–3445.
- 39.↑
Cohen M, Powers M, O'Connell C, Kato N, 1985. The nucleotide sequence of the env gene from the human provirus ERV3 and isolation and characterization of an ERV3-specific cDNA. Virology 147: 449–458.
- 40.↑
Yang YC, Lu PL, Huang SC, Jenh YS, Jou R, Chang TC, 2011. Evaluation of the Cobas TaqMan MTB test for direct detection of Mycobacterium tuberculosis complex in respiratory specimens. J Clin Microbiol 49: 797–801.