• View in gallery

    Location of the collection sites with blood samples and head lice studied between 2010 and 2011 in Sine-Saloum, Senegal. (A) Aerial view of the village of Dielmo, Sine-Saloum, Senegal. (B) Aerial view of the village of Ndiop, Sine-Saloum, Senegal.

  • View in gallery

    Difference in color between head and body lice collected from Senegal. (A) Black head louse collected from a young girl in Senegal. (B) Grey transparent body louse collected from a young boy talibé in Senegal.

  • 1.

    Brouqui P, Lascola B, Roux V, Raoult D, 1999. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med 340: 184189.

  • 2.

    Brouqui P, 2011. Arthropod-borne diseases associated with political and social disorder. Annu Rev Entomol 56: 357374.

  • 3.

    Raoult D, Roux V, 1999. The body louse as a vector of reemerging human diseases. Clin Infect Dis 29: 888911.

  • 4.

    Reed DL, Smith VS, Hammond SL, Rogers AR, Clayton DH, 2004. Genetic analysis of lice supports direct contact between modern and archaic humans. PLoS Biol 2: e340.

    • Search Google Scholar
    • Export Citation
  • 5.

    Boutellis A, Veracx A, Angelakis E, Diatta G, Mediannikov O, Trape JF, Raoult D, 2012. Bartonella quintana in head lice from Senegal. Vector Borne Zoonotic Dis 12: 14.

    • Search Google Scholar
    • Export Citation
  • 6.

    Angelakis E, Diatta G, Abdissa A, Trape JF, Mediannikov O, Richet H, Raoult D, 2011b. Altitude-dependent presence of Bartonella quintana in genotype C head lice from Ethiopia. Emerg Infect Dis 17: 23572359.

    • Search Google Scholar
    • Export Citation
  • 7.

    Thiam M, Fall PD, Gning SB, 2002. Endocardite à Bartonella quintana. Chez un Sénégalais immunocompétent (Bartonella quintana infective endocarditis. In an immunocompetent Senegalese man). La Revue de Médecine Interne 23: 10351037.

    • Search Google Scholar
    • Export Citation
  • 8.

    Trape JF, Rogier C, Konate L, Diagne N, Bouganali H, Canque B, Legros F, Badji A, Ndiaye G, Ndiaye P, Brahimi K, Faye O, Druilhe P, Da Sylva LP, 1994. The Dielmo project: a longitudinal study of natural malaria infection and the mechanisms of protective immunity in a community living in a holoendemic area of Senegal. Am J Trop Med Hyg 51: 123137.

    • Search Google Scholar
    • Export Citation
  • 9.

    Sokhna C, Mediannikov O, Fenollar F, Bassene H, Diatta G, Tall A, Trape JF, Drancourt M, Raoult D, 2013. Point-of-care laboratory of pathogen diagnosis in rural Senegal. PLoS Negl Trop Dis 7: e1999.

    • Search Google Scholar
    • Export Citation
  • 10.

    Angelakis E, Rolain JM, Raoult D, Brouqui P, 2011a. Bartonella quintana in head louse nits. FEMS Immunol Med Microbiol 62: 244246.

  • 11.

    Parola P, Diatta G, Socolovschi C, Mediannikov O, Tall A, Bassène H, Trape JF, Raoult D, 2011. Tick-borne relapsing fever borreliosis, rural Senegal. Emerg Infect Dis 17: 883885.

    • Search Google Scholar
    • Export Citation
  • 12.

    Kittler R, Kayser M, Stoneking M, 2003. Molecular evolution of Pediculus humanus and the origin of clothing. Curr Biol 13: 14141417.

  • 13.

    Brouqui P, Stein A, Dupont HT, Gallian P, Badiaga S, Rolain JM, Mege JL, La Scola B, Berbis P, Raoult D, 2005. Ectoparasitism and vector-borne diseases in 930 homeless people from Marseille. Medicine (Baltimore) 84: 6168.

    • Search Google Scholar
    • Export Citation

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Prevalence of Bartonella quintana in Patients with Fever and Head Lice from Rural Areas of Sine-Saloum, Senegal

View More View Less
  • Institut de Recherche pour le Développement (IRD), Unité Mixte de Recherche (UMR 198), IRD, Unité de Recherche sur les Maladies Infectieuses et Tropicales Emergentes (URMITE) de Dakar, Campus Commun IRD-Université Cheikh Anta Diop de Dakar (UCAD) of Hann, Dakar, Senegal; Aix Marseille Université, URMITE, Unité Mixte 63 (UM 63), Centre National de la Recherche Scientifique (CNRS) 7278, IRD 198, Institut National de la Santé et de la Recherche Médicale (INSERM) 1095, Marseille, France

Trench fever is poorly known by the staff of health facilities that manage febrile patients in Senegal. Bartonella quintana DNA was identified in 5 of 274 (2%) febrile patients from two rural dispensaries and 2 of 71 (3%) head lice specimens collected from the same villages.

Introduction

Bartonella quintana, a small facultative intracellular α-Proteobacterium, is the causative agent of trench fever. It was first identified as an important human pathogen during World War I, when it caused an epidemic of louse-borne trench fever among 1 million troops in Europe. Currently, this bacterium is regarded as a re-emerging pathogen in the homeless population in Europe, where it is responsible for asymptomatic chronic bacteremia, endocarditis, and bacillary angiomatosis.1 The disease is transmitted to humans through the body louse Pediculus humanus humanus, which has also been implicated as a vector for other human diseases.2 These body lice have been shown to be the vectors for the transmission of two other louse-borne diseases: epidemic typhus caused by Rickettsia prowazekii and relapsing fever caused by Borrelia recurrentis.3 Both head and body lice are specific blood-sucking ectoparasites of humans,4 and they are morphologically different from each other. Genetically, lice are classified into three clades, and body lice all over the world belong to clade A.5 Boutellis and others5 recently revealed the presence of clades A and C in the head lice from Senegal. Recent studies have shown that the head lice collected from rural populations in Ethiopia6 and females in Senegal5 were infected with B. quintana. A human case of endocarditis caused by B. quintana was reported in a patient living in Senegal7 as well as Senegalese traveling to France5 and Switzerland.5 Our study aimed to investigate the role of B. quintana as the cause in the occurrence of acute febrile illness in rural Senegal, describe its epidemiology, and show that this often forgotten disease must be taken into account in the management of febrile patients.

Materials and Methods

Dielmo (13°45′ N/16°25′ W), with 350 inhabitants, is located in the Fatick region of Sine-Saloum (280 km southeast of Dakar and approximately 15 km north of the Gambian border), and Ndiop (13°41′ N/16°23′ W; 400 inhabitants) is situated 8.5 km south of Dielmo (Figure 1). Inhabitants of these two villages participated in a long-term malaria surveillance program that has been described in detail elsewhere.8 In each village, there is a functional dispensary. One nurse, two technicians, and three fieldworkers are present every day in the village. Since 2011, a point-of-care laboratory has been functioning in Dielmo,9 where the molecular diagnostics of multiple bacterial pathogens are performed. All patients with fever (an axillary temperature > 37.5°C) from Dielmo and Ndiop treated at the dispensaries from June of 2010 until the end of 2011 were included in the study. Blood samples were taken from each individual and placed in a sample tube containing 20 μL 3.2% trisodium citrate; then, a questionnaire was completed.9 A 200-μL sample of whole blood (three or four drops) was collected from each patient by a lancet stick of a fingertip, and this sample was used for DNA extraction and subsequent molecular tests.

Figure 1.
Figure 1.

Location of the collection sites with blood samples and head lice studied between 2010 and 2011 in Sine-Saloum, Senegal. (A) Aerial view of the village of Dielmo, Sine-Saloum, Senegal. (B) Aerial view of the village of Ndiop, Sine-Saloum, Senegal.

Citation: The American Society of Tropical Medicine and Hygiene 91, 2; 10.4269/ajtmh.13-0685

In March of 2011, head lice were collected from female individuals from both villages and preserved dry in sterile conditions at room temperature. The general sanitary and hygienic conditions were poor. The samples were then sent to our Unit of Rickettsioses in Marseille, France for DNA extraction and molecular studies.

DNA was extracted from blood samples of febrile patients using the QIAGEN EZ-1 Kit (QIAGEN, Courtaboeuf, France) according to the manufacturer's protocol.9 All samples were first subjected to quantitative polymerase chain reaction (qPCR) specific for Bartonella spp. (Table 1). When the qPCR was positive for Bartonella spp., the sample was tested using a second genus-specific qPCR and a qPCR specific for B. quintana, which targeted the yopP gene.5,10 A sample was considered positive when the qPCR reaction was positive for at least one Bartonella genus-specific qPCR and the B. quintana-specific qPCR had a cycle number (Ct) lower than 40; this value was considered to be the threshold level for log-based fluorescence. DNA extraction from the blood samples collected between June and November 11, 2010 was performed in the Dielmo village dispensary using the QIAamp Kit (QIAGEN, Hilden, Germany), and the columns with the bound and dry DNA were stored at 4°C until the final elution in Marseille, France.11 In contrast, from November 12, 2010 to the end of December of 2011, DNA extracted from the blood samples was tested in the point-of-care laboratory based in Dielmo9 before being sent to our Unit of Rickettsioses in Marseille, France.

Table 1

The primers and probes used in the study

OrganismGeneType of oligonucleotidePrimers (5′–3′) and probes (TAMRA)Refs.
Screening samples
Bartonella spp.16S-23S ITS2FGGGGCCGTAGCTCAGCTG10
RTGAATATATCTTCTCTTCACAATTTC
PFAM-CGATCCCGTCCGGCTCCACCA-TAMRA
Confirmation of positive sample
Bartonella spp.16S-23S ITS3FGATGCCGGGGAAGGTTTTC10
RGCCTGGGAGGACTTGAACCT
PFAM-GCGCGCGCTTGATAAGCGTG-TAMRA
B. quintanayopPFTAAACCTCGGGGGAAGCAGA5,10
RTTTCGTCCTCAACCCCATCA
PFAM-CGTTGCCGACAAGACGTCCTTGC-TAMRA

F = forward; P = probe; R = reverse.

Each louse was rinsed two times in sterile water baths (Versylene Fresenius, Sèvres, France) for 15 minutes,5,10 and DNA was extracted using the QIAamp Kit (QIAGEN, Hilden, Germany). PCR amplification was performed using the same primers and probes (Table 1) that were used for the blood samples; however, only one Bartonella genus-specific qPCR (internal transcribed spacer 2 [ITS2]) was performed followed by the yopP-based qPCR for B. quintana detection.9 PCR results were assessed according to the appearance of a positive control and the negativity of the two negative controls.

Results

B. quintana in febrile patients.

In total, 786 blood samples were collected from patients with fever. In five cases (0.6%), we identified DNA from B. quintana in the blood samples. All 5 of 247 (2%) infected samples came from Ndiop, whereas 0 of 539 remaining negative samples were collected in Dielmo. Among the infected patients found in Ndiop, four cases were from household 10, and one case was from household 19. One 4-year-old boy was infected, and four female patients (4, 10, 43, and 65 years old) were also infected. The only male case was detected in 2010, whereas three female cases with B. quintana infection were consecutively diagnosed in 2011.

B. quintana in head lice.

Overall, 19 girls and 1 adult woman were examined in Dielmo, and 17 girls and 5 adult women were examined in Ndiop. None of the five persons that had suffered from trench fever were found to have lice at the time of collection. Body lice were not found during the examination, and the elders of both villages stated that there had been no body lice in the villages for more than 30 years. All head lice that were collected were black, whereas body lice are described as grey transparent12 (Figure 2); the collected lice belonged to the genotype A and/or C (data not shown). Of 148 head lice tested, 2 (1.3%) lice were infected with B. quintana. In Dielmo, 2 of 71 (3%) head lice were infected, whereas the remaining 0 of 77 tested in Ndiop were negative. All infected lice belonged to clade A (data not shown) as previously described.5 The head lice that were found infected in Dielmo were collected from young girls ages 8 and 11 years old. These young girls did not visit the dispensaries for febrile disease for at least 6 months before or after the collection of the infected lice.

Figure 2.
Figure 2.

Difference in color between head and body lice collected from Senegal. (A) Black head louse collected from a young girl in Senegal. (B) Grey transparent body louse collected from a young boy talibé in Senegal.

Citation: The American Society of Tropical Medicine and Hygiene 91, 2; 10.4269/ajtmh.13-0685

Discussion and Conclusion

For the first time, our investigation showed the circulation of B. quintana in febrile patients visiting a health facility in rural Senegal. Additionally, the study provides more data5 that suggests that head lice, similar to body lice, could transmit B. quintana to humans. The presence of B. quintana infections has been previously reported in homeless patients from Marseille, France in two studies,13 with a prevalence of 14% (10 of 71) and 5.3% (50 of 930),1,12 and the seroprevalence observed in homeless people in both the United States and Europe is high.1,13 For a long time, it was thought that B. quintana was only transmitted by body lice.12 The first possible involvement of head lice in the transmission of B. quintana was shown in homeless children in Nepal, where genotype C head lice are found.5 Recent studies performed on head lice specimens collected in Ethiopia and Senegal (Dakar) highlighted the role of head lice as possible vectors in the transmission of B. quintana to humans.5,6 The evidence of B. quintana DNA was also identified in the head louse nits collected from homeless individuals from Marseille, France,10 indicating the possible vertical transmission of this pathogen. Molecular analyses of the head lice confirmed the existence of head lice from clades A and C in Senegal,5 but only the head lice of clade A, the same clade that includes body lice, were found to be infected with B. quintana. Studies performed on lice collected in France, Russia, Peru, the United States, Tokyo, Rwanda, Burundi, Ethiopia, and Senegal5,6,13 have shown that poor hygiene and poverty provide the ideal conditions to maintain the transmission cycle of B. quintana in a target population.

We believe that our report of simultaneous trench fever cases, discovery of B. quintana in the clade A head lice found in the same population, and absence of body lice presents additional evidence that B. quintana may be transmitted by clade A head lice. B. quintana infections in louse-infested populations, particularly in the homeless population, of rural or suburban areas or the large modern cities of developed countries could increase in the coming years if public authorities or non-governmental organizations do not take appropriate measures to fight the scourge of poverty that has been linked to poor hygiene.

ACKNOWLEDGMENTS

We thank the populations of the Dielmo and Ndiop villages for their participation in our investigation. We also thank S. Ndiaye and M. Ndiaye for their assistance during the head lice collection as well as K. Leye and A. Diallo for their assistance with the laboratory experiments.

  • 1.

    Brouqui P, Lascola B, Roux V, Raoult D, 1999. Chronic Bartonella quintana bacteremia in homeless patients. N Engl J Med 340: 184189.

  • 2.

    Brouqui P, 2011. Arthropod-borne diseases associated with political and social disorder. Annu Rev Entomol 56: 357374.

  • 3.

    Raoult D, Roux V, 1999. The body louse as a vector of reemerging human diseases. Clin Infect Dis 29: 888911.

  • 4.

    Reed DL, Smith VS, Hammond SL, Rogers AR, Clayton DH, 2004. Genetic analysis of lice supports direct contact between modern and archaic humans. PLoS Biol 2: e340.

    • Search Google Scholar
    • Export Citation
  • 5.

    Boutellis A, Veracx A, Angelakis E, Diatta G, Mediannikov O, Trape JF, Raoult D, 2012. Bartonella quintana in head lice from Senegal. Vector Borne Zoonotic Dis 12: 14.

    • Search Google Scholar
    • Export Citation
  • 6.

    Angelakis E, Diatta G, Abdissa A, Trape JF, Mediannikov O, Richet H, Raoult D, 2011b. Altitude-dependent presence of Bartonella quintana in genotype C head lice from Ethiopia. Emerg Infect Dis 17: 23572359.

    • Search Google Scholar
    • Export Citation
  • 7.

    Thiam M, Fall PD, Gning SB, 2002. Endocardite à Bartonella quintana. Chez un Sénégalais immunocompétent (Bartonella quintana infective endocarditis. In an immunocompetent Senegalese man). La Revue de Médecine Interne 23: 10351037.

    • Search Google Scholar
    • Export Citation
  • 8.

    Trape JF, Rogier C, Konate L, Diagne N, Bouganali H, Canque B, Legros F, Badji A, Ndiaye G, Ndiaye P, Brahimi K, Faye O, Druilhe P, Da Sylva LP, 1994. The Dielmo project: a longitudinal study of natural malaria infection and the mechanisms of protective immunity in a community living in a holoendemic area of Senegal. Am J Trop Med Hyg 51: 123137.

    • Search Google Scholar
    • Export Citation
  • 9.

    Sokhna C, Mediannikov O, Fenollar F, Bassene H, Diatta G, Tall A, Trape JF, Drancourt M, Raoult D, 2013. Point-of-care laboratory of pathogen diagnosis in rural Senegal. PLoS Negl Trop Dis 7: e1999.

    • Search Google Scholar
    • Export Citation
  • 10.

    Angelakis E, Rolain JM, Raoult D, Brouqui P, 2011a. Bartonella quintana in head louse nits. FEMS Immunol Med Microbiol 62: 244246.

  • 11.

    Parola P, Diatta G, Socolovschi C, Mediannikov O, Tall A, Bassène H, Trape JF, Raoult D, 2011. Tick-borne relapsing fever borreliosis, rural Senegal. Emerg Infect Dis 17: 883885.

    • Search Google Scholar
    • Export Citation
  • 12.

    Kittler R, Kayser M, Stoneking M, 2003. Molecular evolution of Pediculus humanus and the origin of clothing. Curr Biol 13: 14141417.

  • 13.

    Brouqui P, Stein A, Dupont HT, Gallian P, Badiaga S, Rolain JM, Mege JL, La Scola B, Berbis P, Raoult D, 2005. Ectoparasitism and vector-borne diseases in 930 homeless people from Marseille. Medicine (Baltimore) 84: 6168.

    • Search Google Scholar
    • Export Citation

Author Notes

* Address correspondence to Georges Diatta, Route des Pères Maristes Hann, Dakar, CP.18524, Senegal. E-mail: georges.diatta@ird.fr

Financial support: This work was supported by grants from the Agence Nationale de la Recherche (ANR) 2010 MALEMAF (Research of emergent pathogens in Africa) and La Fondation Méditerranée Infection.

Authors' addresses: Georges Diatta, Ceikh Sokhna, and Hubert Bassene, Institut de Recherche pour le Développement (IRD), UMR 198 IRD URMITE, Campus Commun IRD-UCAD of Hann, Dakar, Senegal, E-mails: georges.diatta@ird.fr, cheikh.sokhna@ird.fr, and hubert.bassene@ird.fr. Oleg Mediannikov, Florence Fenollar, and Didier Raoult, Institut de Recherche pour le Développement (IRD), UMR 198 IRD URMITE, Campus commun IRD-UCAD of Hann, Dakar, Senegal, and Aix Marseille Université, URMITE, UM63, CNRS 7278, IRD 198, INSERM 1095, Marseille, France, E-mails: oleg.mediannikov@ird.fr, florence.fenollar@univ-amu.fr, and didier.raoult@gmail.com. Cristina Socolovschi and Pavel Ratmanov, Aix Marseille Université, URMITE, UM63, CNRS 7278, IRD 198, INSERM 1095, Marseille, France, E-mails: cristina.socolovschi@univ-amu.fr and ratmanov@gmail.com.

Save