Plasmodium-Specific Molecular Assays Produce Uninterpretable Results and Non-Plasmodium spp. Sequences in Field-Collected Anopheles Vectors

Genelle F. Harrison Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Genelle F. Harrison in
Current site
Google Scholar
PubMed
Close
,
Desmond H. Foley Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Desmond H. Foley in
Current site
Google Scholar
PubMed
Close
,
Leopoldo M. Rueda Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Leopoldo M. Rueda in
Current site
Google Scholar
PubMed
Close
,
Vanessa R. Melanson Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Vanessa R. Melanson in
Current site
Google Scholar
PubMed
Close
,
Richard C. Wilkerson Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Richard C. Wilkerson in
Current site
Google Scholar
PubMed
Close
,
Lewis S. Long Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Lewis S. Long in
Current site
Google Scholar
PubMed
Close
,
Jason H. Richardson Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Jason H. Richardson in
Current site
Google Scholar
PubMed
Close
,
Terry A. Klein Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Terry A. Klein in
Current site
Google Scholar
PubMed
Close
,
Heung-Chul Kim Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Heung-Chul Kim in
Current site
Google Scholar
PubMed
Close
, and
Won-Ja Lee Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, Maryland; Public Health Command Region-Pacific, Camp Zama, Japan; Fifth Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea; Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun, South Korea

Search for other papers by Won-Ja Lee in
Current site
Google Scholar
PubMed
Close

The Malaria Research and Reference Reagent Resource–recommended PLF/UNR/VIR polymerase chain reaction (PCR) was used to detect Plasmodium vivax in Anopheles spp. mosquitoes collected in South Korea. Samples that were amplified were sequenced and compared with known Plasmodium spp. by using the PlasmoDB.org Basic Local Alignment Search Tool/n and the National Center for Biotechnology Information Basic Local Alignment Search Tool/n tools. Results show that the primers PLF/UNR/VIR used in this PCR can produce uninterpretable results and non-specific sequences in field-collected mosquitoes. Three additional PCRs (PLU/VIV, specific for 18S small subunit ribosomal DNA; Pvr47, specific for a nuclear repeat; and GDCW/PLAS, specific for the mitochondrial marker, cytB) were then used to find a more accurate and interpretable assay. Samples that were amplified were again sequenced. The PLU/VIV and Pvr47 assays showed cross-reactivity with non-Plasmodium spp. and an arthropod fungus (Zoophthora lanceolata). The GDCW/PLAS assay amplified only Plasmodium spp. but also amplified the non-human specific parasite P. berghei from an Anopheles belenrae mosquito. Detection of P. berghei in South Korea is a new finding.

The Malaria Research and Reference Reagent Resource1 recommends a nested polymerase chain reaction (PCR) specific for the 18S small subunit ribosomal DNA (ssrDNA) gene fragment for the detection of human Plasmodium species in Anopheles spp. mosquito vectors.2 This assay was first designed to screen human blood for Plasmodium spp.,3,4 and was later modified to screen mosquito vectors for Plasmodium spp. DNA.2 The modifications were based on the results of a comparison of extraction techniques designed to mitigate the issue of inhibitors to PCR2,5 in the DNA extraction method.1 The same primers (PLF/UNR/VIR) were used in both studies.2,3

The PLF/UNR/VIR assay was used to test for P. vivax in mosquito vectors (Table 1). Anopheles mosquitoes were collected bi-weekly (3–4-day intervals) by using Mosquito Magnet® traps (Pro-Model; American Biophysics Corp., Greenwich, RI) during August–September 2010 in South Korea. Mosquito collections were conducted in the Demilitarized Zone adjacent to the Military Demarcation Line separating North Korea from South Korea and at Warrior Base and Tongilchon located approximately 3 km from the Demilitarized Zone where malaria transmission was suspected.6 Anopheles spp. females were placed individually in 2-mL cryovials, dried, and shipped to the Walter Reed Biosystematics Unit (Suitland, MD).

Table 1

Primers, targets, and fragment sizes used for detecting Plasmodium species

Primer Locus Sequence 5′ → 3′ Specificity Size of product, basepairs
GDCW 2 cytB CGGTCGCGTCCGGTAGCGTCTAATGCCTAGACGTATTCCTGATTATCCAG Plasmodium sp.
GDCW4 cytB CGCATCACCTCTGGGCCGCGTGTTTGCTTGGGAGCTGTAATCATAATGTG Plasmodium sp.
PLAS1 cytB GAGAATTATGGAGTGGATGGTG Plasmodium sp. 815
PLAS2 cytB TGGTAATTGACATCCAATCC Plasmodium sp. 815
PLF 18S AGTGTGTATCAATCGAGTTTC Plasmodium sp. 821 for P. vivax; 787 for P. falciparum
UNR 18S GACGGTATCTGATCGTCTTC Plasmodium sp.
VIR 18S AGGACTTCCAAGCCGAAGC P. vivax 499
PLU5 18S CTTGTTGTTGCCTTAAACTTC Plasmodium sp. 1,200
PLU6 18S TTAAAATTGTTGCAGTTAAAACG Plasmodium sp.
VIV1 18S CGCTTCTAGCTTAATCCACATAACTGATAC P. vivax 120
VIV2 18S ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA P. vivax
Pvr47-F Pvr47 CTGATTTTCCGCGTAACAATG P. vivax 333
Pvr47-R Pvr47 CAAATGTAGCATAAAAATCYAAG P. vivax

The head and thorax were separated from the abdomen from individual mosquitoes to isolate only sporozoite-infected (salivary glands) mosquitoes. Total genomic DNA was extracted by using phenol-chloroform extraction using the Autogen automated DNA extraction robot (AutoGen Inc., Holliston, MA) and eluted in 50 μL of buffer in a 96-well plate format. Mosquitoes were identified to species by sequencing the internal transcribed spacer region 2 and a sequence comparison to voucher specimens available in the National Center for Biotechnology Information (NCBI) (Bethesda, MD) database. Of the mosquitoes tested, 56% were An. kleini, 27% were An. belenrae, 15% were An. sinensis, and 2% were An. pullus. For P. vivax detection, the PCR master mixture contained 1× buffer, 0.4 μM of each primer, 0.1 mM of each dNTP, 1.5 mM MgCl2, 5% dimethyl sulfoxide, 1 unit of Biolase Taq, and 1 μL of DNA template. The total reaction volume was 20 μL. The same master mixture was used in both rounds of amplification (nested PCR), and 1 μL of PCR template was used in the second reaction. For each PCR, a new master mixture was created to mitigate issues with a single batch and to minimize contamination of the master mixture. The cycling parameters were 94°C for 2 minutes; followed by 35 cycles of 94°C for 30 seconds, 62°C for 30 seconds, and 72°C for 1 minute; and a final extension at 72°C for 7 minutes. The same cycling parameters were used in the second PCR with an increase to 40 cycles.

The PCR amplicon was subjected to electrophoresis on a 1.5% agarose gel stained with ethidium bromide in the same 96-well format as the plate layout of the DNA extraction for quick interpretation. Gels were photographed to record the results. Of the 94 individual mosquitoes tested for P. vivax, 20 produced amplicons after PCR, although results were ambiguous (Figure 1). Only six of the amplified samples produced bands that were approximately 499 basepairs, the expected size for this assay. All amplified samples were cleaned by using ExoSapIT (Affymertix Inc., Santa Clara, CA) and sequenced in both directions. Sequences were trimmed, cleaned, and aligned using Sequencher software (Sequencher V5.1; Gene Codes Co., Ann Arbor, MI). Sequences in which 90% of the base calls were quality calls were run through the Plasmodium full genome database PlasmoDB (http//:PlasmoDB.org). The quality of a base call is defined by peak height and peak separation.7 Samples that did not significantly match any Plasmodium species in the database were then run through a standard Basic Local Alignment Search Tool (BLAST)/n search at the NCBI website.

Figure 1.
Figure 1.

Agarose gel electrophoresis showing polymerase chain reaction amplification by A, semi-nested primers PLF/UNR/VIR; B, nested primers PLU5/PLU6/VIV1/VIV2; C, single-round Pvr47 F/R primers; and D, cytB nested primers GDCW2/GDCW4/PLAS1/PLAS2, for field collected Anopheles spp. mosquitoes. Pos. = positive; Neg. = negative.

Citation: The American Society of Tropical Medicine and Hygiene 89, 6; 10.4269/ajtmh.12-0581

Only 9 of the 20 samples produced a quality sequence. Of these samples, none of the sequences were of the expected size of 499 basepairs once they were trimmed (Table 2). When sequences were run against the known Plasmodium spp. in the PlasmoDBs BLAST database, none of the nine sequences matched any species of Plasmodium with a percent match > 70%. When the same samples were run through the NCBI BLAST/n tool, no significant matches were identified. However, a positive control of P. vivax extracted from An. dirus8 significantly match P. vivax in the PlasmoDBs BLAST/n tool (100% match), as well as in the NCBI BLAST/n tool (100% match), showing a successful amplification and sequencing reaction. The negative control of water produced no amplicon, suggesting that amplification products were not caused by laboratory contaminants.

Table 2

Sequencing results of amplified bands in field-collected Anopheles spp. mosquitoes*

Primer Sample Length, nucleotides QC, % Result PlasmoDB % Match P Result NCBI % Coverage, %
PLAS 1/2 + Control 629 99 Plasmodium vivax 100 2.30 × 10−9 P. vivax 100 100
PLAS 1/2 10G 663 100 P. berghei 98 9.20 × 10−5 P. berghei    
VIV1/2 + Control 210 98 P. vivax 99 9.50 × 10−34 P. vivax 99 100
VIV1/2 1E 170 92 P. vivax 64 0.057 Zoophthora lanceolata 99 100
VIV1/2 2C 241 93 P. vivax 86 0.042 Z. lanceolata 97 100
VIV1/2 2D 238 90 P. vivax 72 0.015 Z. lanceolata 98 100
PLF/VIR + Control 593 99 P. vivax 100 5.90 × 10−9 P. vivax 100 100
PLF/VIR 3E 522 97 P. vivax 67   None    
PLF/VIR 6C 119 95 None     None    
PLF/VIR 10B 283 98 None     None    
PLF/VIR 16 352 100 P. vivax 67 0.00024 None    
PLF/VIR 1B 371 100 None     None    
PLF/VIR 1E 240 95 P. chabaudi 63 0.76 None    
PLF/VIR 2B 318 98 None     None    
PLF/VIR 2C 271 99 None     None    
PLF/VIR 2D 246 98 P. knowlesi 67 0.9999 None    
Pvr47 F/R + Control 116 86 P. vivax 99 1.50 × 10−13 NA    
Pvr47 F/R 1C 498 95 None     NA    
Pvr47 F/R 1H 299 98 None     NA    
Pvr47 F/R 2H 543 97 P. falciparum 54 0.2 NA    
Pvr47 F/R 5E 474 96 None     NA    
Pvr47 F/R 8H 360 96 P. berghei 62 0.0067 NA    
Pvr47 F/R 9G 146 91 P. yoelii 69 0.95 NA    

QC = query coverage; NCBI = National Center for Biotechnology Information; NA = not available. Values in bold are statistically significant.

When the primers were run through the NCBI database, the PLF primer had a 100% query coverage (QC) and 100% match identity (MI) to a Hepatocyst sp. (HQ605039.1). The UNR primer aligned with species in multiple phyla including Lophotrochozoa (AB679345), Rhodophyta (JX828192), Alveolata (JQ178269), Cnidaria (AB693054), and uncultured fungus (KC218924) with 100% QC and 100% MI. The VIR primer was also significantly similar to species in many phyla, which included Chordata (XM002609218) and Viridiplanta, with 100% MI with 89% QC; several types of fungus, including Myceliophthora thermophila (XM003662658) and Metarhizium anisopliae (AJ251965) with 100% MI and 89% QC; Ecdysozoa (XM002633807) with 84% QC and 100% MI; and several bacterium, including Cryptococcus neoformans (XM771947) and several uncultured bacterium (JQ818134, JQ818132, and JQ818120) with a 100% MI and 78% QC.

Three additional PCRs were then tested for detection of P. vivax in field-collected female mosquitoes. We tested a second 18S ssrDNA assay (PLU/VIV) that was originally designed to screen human blood for parasites,9 a nested PCR specific for mitochondrial cytB (GDCW/PLAS),10 and a single-step PCR specific for the 1441 copy nuclear tandem repeat region Pvr47 (Pvr47F/R)11 (Table 1).

The PCR master mixtures and cycling parameters for the PLU/VIV and Pvr47 assays were the same as the protocol used for the PLF/UNR/VIR assay above. The PCR mixtures were made and run independently in each assay. The Pvr47 assay was a single round of amplification. The nested GDCW/PLAS assay consisted of a 10-μL reaction with a master mixture comprised of 0.3 μM of each primer, 2 mM MgCl2, 0.125 mM dNTP, 1× buffer, 5% dimethyl sulfoxide, 1 unit of Biolase Taq, and 1 μL of DNA. The cycling parameters consisted of an initial temperature of 94°C; followed by 35 cycles at 94°C for 30 seconds, 60°C for 30 seconds, and 72°C for 1 minute and 30 seconds; and a final extension at 72°C for 10 minutes. The nested PCR used the same cycling parameters for the second round, but the number of cycles was increased to 40.

DNA from the same 94 samples, which were previously tested by using the PLF/UNR/VIR primers, was tested again with the three assays listed above (Figure 1). A positive control of P. vivax extracted from An. dirus was included, as well as a negative control of nuclease-free water. The resulting amplicons were again sequenced in both directions, and the sequences were run through PlasmoDB BLAST and NCBI BLAST/n tools, with the exception of the Pvr47 amplicons. Pvr47 is a novel locus, whose sequences are not available in the NCBI database; therefore, sequences were only run through PlasmoDB BLAST/n.

Pvr47 produced amplicons in 60 of the 94 samples, but only 10 of these were of the approximate expected size of 333 basepairs. Most amplicons was either of the wrong size, smears, or produced multiple-banding patterns. Of the 60 amplified samples, only six produced clean sequences that were obtained from the Pvr47 assay. None of the sequences matched any of the Plasmodium spp. found in the PlasmoDB.org database > 70%. For the PLU/VIV assay, 3 of the 94 samples amplified, but all were approximately 1,000 basepairs instead of the expected 120 basepairs. All samples had a quality score > 90%. However, none of these samples matched any species of the Plasmodium spp. found in the PlasmoDB.org database > 85%. When run through the NCBI database, all three matched Zoophthora lanceolata strain ARSEF (Accession nos. EF392550.1, EF392550.1, and EF392550.1) > 97%. Zoophthora is an arthropod fungus that is sometimes used as an insecticide.12,13 The PLU5/6 primers were aligned with the 18S sequence of Z. lanceolata. The PLU5 primer matched the sequence with only a 1-basepair difference; the PLU6 primer matched the sequence with a 7-basepair difference. This finding might suggest that running a nested PCR with a total of 75 cycles could increase the probability of non-specific binding and explain the amplification of this fungus although the primers are not an exact match.

The GDCW/PLAS was the most successful of the assays because it did not result in smearing or non-specific binding. Amplification was observed in one An. belenrae, which was the approximate correct size of 815 basepairs. This sample was a 100% match to the rodent malaria parasite P. berghei in the PlasmoDB database, as well as in NCBI database (100% MI and 100% QC; accession no. DQ414645). The GDCW/PLAS assay is used to amplify human and primate malaria pathogens, but exclude Apicomplexa and human blood. To verify that this assay amplifies P. berghei, seven An. stephensi with known P. berghei infections were tested by using this PCR. All seven samples produced amplicons. However, before the testing of An. stephensi, no P. berghei had been used in this laboratory, which excluded on-site contamination. The discovery of P. berghei in South Korea and in An. belerae is novel. Also, the head and thorax was separated from the abdomen, suggesting that the sporozoites were in the salivary glands, and that the infection had not merely been ingested but had also propagated. Because P. berghei can infect multiple rodent vectors, and is a temperate species, it may have a wider range than previously expected.

Over the course of this research genomic DNA was extracted from several thousand mosquitoes for vector identification, and many of these mosquitoes were also screened for P. vivax. The Pvr47, PLF/UNR/VIR, and PLU/VIV assays continually produced uninterpretable results and multiple banding patterns, leading to this sequencing work. Samples that produced amplicons were subjected to electrophoresis on agarose gels for one hour to illustrate these results (Figure 2). The GDCW/PLAS assay did not produce any amplicons, illustrating that these primers are more specific than those used in the other three assays.

Figure 2.
Figure 2.

Agarose gel electrophoresis showing multiple banding patterns produced by polymerase chain reactions PLU/VIV (A), PLF/UNR/VIR (B), and Pvr47 (C) used to detect Plasmodium spp. in Anopheles spp. mosquitoes.

Citation: The American Society of Tropical Medicine and Hygiene 89, 6; 10.4269/ajtmh.12-0581

Our results showed that the PLF/UNR/VIR, PLU/VIV, and Pvr47 assays produce non-specific sequences and uninterpretable results and have primers that could potentially bind to species in multiple phyla. Also, the PLU/VIV assay detects Z. lanceolata, an arthropod fungus. The GDCW/PLAS assay is more specific, but detects P. berghei, which is a rodent pathogen. Therefore, amplicons must be verified by sequencing. Although there is always potential for DNA degradation during shipping that could also result in smearing and irregular banding patterns, the clean sequences for the mosquito and Plasmodium amplicon is evidence that not only is the DNA viable, it is intact enough to provide quality sequences (Table 2). Our positive controls were infected mosquitoes, showing that our DNA extraction and detection methods are optimized for in vivo detection despite using an extraction protocol different from those used in the original publications. Also, if inhibitors were an issue, amplification of the mosquitoes or positive control would not have occurred. The strongest evidence that there may be issues with this detection method is their BLAST results for primers, which were independent of any laboratory work.

The conclusions of this study cast doubt on previously reported infection rates from South Korea and elsewhere where these assays were used.6 Many samples produced clear amplicons, sequences multiple pea for a single base pair, we suspected was caused by co-amplification of multiple organisms. Although one could argue that a band of the incorrect size is not a positive result per se, an assay by definition should produce a binary band or no band result. With the exception of the GDCW/PLAS primers, these assays do not produce such a result. Although these assays may work well with human blood, confounding factors from field-collected mosquitoes, such as sample degradation, exposure to environmental contaminants, and low levels of mosquito infections, may reduce the utility of these assays, and therefore render them unsuitable for use for the detection of specific Plasmodium spp. The cytB GDCW/PLAS assay is the most promising technique for future studies, despite the fact that it is not limited to human-specific Plasmodium spp. detection. Because the interpretation of results when PCR is used can be ambiguous and somewhat subjective, the use of real-time assays in which a present diagnostic negative/positive result is pre-programmed (based on cycle threshold) would produce more robust results in future studies. However, the primers used in a real-time assay must be thoroughly tested with field-collected mosquitoes to ensure they do not amplify non-Plasmodium species because many also target the 18S ssrDNA region.14

ACKNOWLEDGMENTS

We thank the staff of the Laboratory of Analytical Biology, Smithsonian Institution (Washington, DC) for help in conducting PCR/sequencing of some mosquito samples, and Dr. Yvonne Linton for sequencing assistance.

  • 1.

    MR4.org V5.2, 2008. Molecular Identification of Plasmodium spp. in Anophelines. Available at: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf. Accessed September 2010.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 2.

    Lardeux F, Tejerina R, Aliaga C, Ursic-Bedoya R, Lowenberger C, Chavez T, 2008. Optimization of a semi-nested multiplex PCR to identify Plasmodium parasites in wild-caught Anopheles in Bolivia, and its application to field epidemiological studies. Trans R Soc Trop Med Hyg 102: 485492.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 3.

    Rubio JM, Benito A, Roche J, Berzosa PJ, Garcia ML, Mico M, Edu M, Alvar J, 1999. Semi-nested, multiplex polymerase chain reaction for detection of human malaria parasites and evidence of Plasmodium vivax infection in Equatorial Guinea. Am J Trop Med Hyg 60: 183187.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 4.

    Rubio JM, Post RJ, Docters van Leeuwen WM, Henry MC, Lindergard G, Hommel M, 2002. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM–PCR). Trans R Soc Trop Med Hyg Suppl S1: 199204.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 5.

    Schriefer ME, Sacci JB, Wirtz RA, Azad AF, 1991. Detection of polymerase chain reaction-amplified malarial DNA in infected blood and individual mosquitoes. Exp Parasitol 73: 311316.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 6.

    Foley DH, Klein TA, Kim HC, Kim MS, Wilkerson RC, Harrison G, Rueda LM, Lee WJ, 2012. Synchronous peaks in trap catches of malaria infected mosquito species at a border village between North and South Korea. J Vector Ecol 37: 2936.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 7.

    Sequencher, 2011. Tutorial for Windows and Macintosh, Quality Scores. Ann Arbor, MI: Gene Codes Corporation, 16.

  • 8.

    Peyton EL, Harrison BA, 2010. Anopheles (Cellia) takasagoensis Morishita 1946, an additional species in the Balabacensis Complex of Southeast Asia (Diptera: Culicidae). Mosquito Systematics 1: 335347.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 9.

    Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, Rosario VE, Thaithong S, Brown KN, 1993. High sensitivity detection of human malaria parasites by use of nested polymerase chain reaction. Mol Biochem Parasitol 61: 315320.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 10.

    Steenkeste N, Incardona S, Chy S, Duval L, Ekala MT, Lim P, Hewitt S, Sochantha T, Socheat D, Rogier C, Mercereau-Puijalon O, Fandeur T, Ariey F, 2009. Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers. Malar J 8: 8698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 11.

    Demas A, Oberstaller J, DeBarry J, Lucchi NW, Srinivasamoorthy G, Sumari D, Kabanywanyi AM, Villegas L, Escalante AA, Kachur SP, Barnwell JW, Peterson DS, Udhayakumar V, Kissinger JC, 2011. Applied fenomics: sata mining reveals species-specific malaria diagnostic targets more sensitive than 18S rRNA. J Clin Microbiol 49: 24112418.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 12.

    Mascarin GM, Duarte V da S, Brandão MM, Delalibera I Jr, 2012. Natural occurrence of Zoophthera radicans (Entomopthorales: Entomophthoraceae) on Thaumastocoris peregrinus (Heteroptera: Thaumastocoridae), an invasive pest recently found in Brazil. J Invertebr Pathol 110: 401404.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 13.

    Koch KA, Ragsdale DW, 2011. Impacts of thiamethoxam seed treatment and host plant resistance on the soybean aphid fungal pathogen, Pandora neoaphidis. J Econ Entomol 104: 18241832.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 14.

    Genc A, Eroglu F, Koltas SI, 2010. Detection of Plasmodium vivax by nested PCR and real-time PCR. Korean J Parasitol 48: 99103.

Author Notes

* Address correspondence to Genelle F. Harrison, Entomology Branch, Walter Reed Army Institute of Research, 503 Robert Grant Avenue, Silver Spring, MD 20910. E-mail: gh0106a@american.edu

Financial support: Thus study was supported by Armed Forces Health Surveillance Center, Global Emerging Infections Surveillance and Response Systems, Silver Spring, MD.

Disclosure: This research was performed under a Memorandum of Understanding between the Walter Reed Army Institute of Research and the Smithsonian Institution, with institutional support provided by both organizations.

Authors' addresses: Genelle F. Harrison, Desmond H. Foley, Leopoldo M. Rueda, Vanessa R. Melanson, Richard C. Wilkerson, Lewis S. Long, and Jason H. Richardson, Entomology Branch, Walter Reed Army Institute of Research, Silver Spring, MD, E-mails: Genelle.harrison@mail.mcgill.ca; Desfoley@si.edu; RuedaPol@si.edu; Vanessa.melanson@us.army.mil; WilkersonR@si.edu; Lewis.S.Long@us.army.mil; and Jason.H.Richarcdson@us.army.mil. Terry A. Kline, Public Health Command Region-Pacific, Camp Zama, Japan, E-mail: Terry.A.Klein2.Civ@Mail.mil. Heung-Chul Kim, 5th Medical Detachment, 168th Multifunctional Medical Support Battalion, 65th Medical Brigade, Seoul, South Korea, E-mail: hungchol.kim2.ln@mail.mil. Heung-Chul Kim and Won-Ja Lee, Division of Malaria and Parasitic Diseases, Korea Center for Disease Control and Prevention, Cheongwon-gun 363-951, South Korea, hungchol.kim2.ln@mail.mil and Leewonja@gmail.com.

  • Figure 1.

    Agarose gel electrophoresis showing polymerase chain reaction amplification by A, semi-nested primers PLF/UNR/VIR; B, nested primers PLU5/PLU6/VIV1/VIV2; C, single-round Pvr47 F/R primers; and D, cytB nested primers GDCW2/GDCW4/PLAS1/PLAS2, for field collected Anopheles spp. mosquitoes. Pos. = positive; Neg. = negative.

  • Figure 2.

    Agarose gel electrophoresis showing multiple banding patterns produced by polymerase chain reactions PLU/VIV (A), PLF/UNR/VIR (B), and Pvr47 (C) used to detect Plasmodium spp. in Anopheles spp. mosquitoes.

  • 1.

    MR4.org V5.2, 2008. Molecular Identification of Plasmodium spp. in Anophelines. Available at: http://www.mr4.org/Portals/3/Pdfs/ProtocolBook/MethodsAnophelesResearchV4c.pdf. Accessed September 2010.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 2.

    Lardeux F, Tejerina R, Aliaga C, Ursic-Bedoya R, Lowenberger C, Chavez T, 2008. Optimization of a semi-nested multiplex PCR to identify Plasmodium parasites in wild-caught Anopheles in Bolivia, and its application to field epidemiological studies. Trans R Soc Trop Med Hyg 102: 485492.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 3.

    Rubio JM, Benito A, Roche J, Berzosa PJ, Garcia ML, Mico M, Edu M, Alvar J, 1999. Semi-nested, multiplex polymerase chain reaction for detection of human malaria parasites and evidence of Plasmodium vivax infection in Equatorial Guinea. Am J Trop Med Hyg 60: 183187.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 4.

    Rubio JM, Post RJ, Docters van Leeuwen WM, Henry MC, Lindergard G, Hommel M, 2002. Alternative polymerase chain reaction method to identify Plasmodium species in human blood samples: the semi-nested multiplex malaria PCR (SnM–PCR). Trans R Soc Trop Med Hyg Suppl S1: 199204.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 5.

    Schriefer ME, Sacci JB, Wirtz RA, Azad AF, 1991. Detection of polymerase chain reaction-amplified malarial DNA in infected blood and individual mosquitoes. Exp Parasitol 73: 311316.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 6.

    Foley DH, Klein TA, Kim HC, Kim MS, Wilkerson RC, Harrison G, Rueda LM, Lee WJ, 2012. Synchronous peaks in trap catches of malaria infected mosquito species at a border village between North and South Korea. J Vector Ecol 37: 2936.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 7.

    Sequencher, 2011. Tutorial for Windows and Macintosh, Quality Scores. Ann Arbor, MI: Gene Codes Corporation, 16.

  • 8.

    Peyton EL, Harrison BA, 2010. Anopheles (Cellia) takasagoensis Morishita 1946, an additional species in the Balabacensis Complex of Southeast Asia (Diptera: Culicidae). Mosquito Systematics 1: 335347.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 9.

    Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, Rosario VE, Thaithong S, Brown KN, 1993. High sensitivity detection of human malaria parasites by use of nested polymerase chain reaction. Mol Biochem Parasitol 61: 315320.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 10.

    Steenkeste N, Incardona S, Chy S, Duval L, Ekala MT, Lim P, Hewitt S, Sochantha T, Socheat D, Rogier C, Mercereau-Puijalon O, Fandeur T, Ariey F, 2009. Towards high-throughput molecular detection of Plasmodium: new approaches and molecular markers. Malar J 8: 8698.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 11.

    Demas A, Oberstaller J, DeBarry J, Lucchi NW, Srinivasamoorthy G, Sumari D, Kabanywanyi AM, Villegas L, Escalante AA, Kachur SP, Barnwell JW, Peterson DS, Udhayakumar V, Kissinger JC, 2011. Applied fenomics: sata mining reveals species-specific malaria diagnostic targets more sensitive than 18S rRNA. J Clin Microbiol 49: 24112418.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 12.

    Mascarin GM, Duarte V da S, Brandão MM, Delalibera I Jr, 2012. Natural occurrence of Zoophthera radicans (Entomopthorales: Entomophthoraceae) on Thaumastocoris peregrinus (Heteroptera: Thaumastocoridae), an invasive pest recently found in Brazil. J Invertebr Pathol 110: 401404.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 13.

    Koch KA, Ragsdale DW, 2011. Impacts of thiamethoxam seed treatment and host plant resistance on the soybean aphid fungal pathogen, Pandora neoaphidis. J Econ Entomol 104: 18241832.

    • PubMed
    • Search Google Scholar
    • Export Citation
  • 14.

    Genc A, Eroglu F, Koltas SI, 2010. Detection of Plasmodium vivax by nested PCR and real-time PCR. Korean J Parasitol 48: 99103.

Past two years Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 435 88 11
PDF Downloads 157 48 2
 
 
 
 
Affiliate Membership Banner
 
 
Research for Health Information Banner
 
 
CLOCKSS
 
 
 
Society Publishers Coalition Banner
Save