Introduction
Toxoplasma gondii is an important zoonotic infection worldwide and may lead to uveitis, pneumonia, pericarditis, and neurologic disorders in immunocompetent hosts.1 Hemophagocytic syndrome is a rare, but potentially fatal, disease resulting from unregulated activation and proliferation of lymphocytes.2 Hemophagocytic syndrome associated with T. gondii infection occurs most commonly in acquired immunodeficiency syndrome (AIDS) patients or transplant recipients,3–6 but are very rare in immunocompetent humans. Here, we describe the first case of fatal disseminated toxoplasmosis in a previously healthy adult from China with clinical manifestation conforming to hemophagocytic syndrome.
Case Description
The patient was a previously healthy 41-year-old male forest policeman, which required him to have contact with wild animals in a virgin forest. His family members indicated that the patient on occasion hunted mammals (hares, civets, etc.) and drank stream water while on duty.
He was admitted to an emergency unit with a 4-day history of fever, adynamia, dry cough, and mental dysfunction. On physical examination, the patient exhibited a temperature of 39.0°C, heart rate of 80, blood pressure of 95/66 mm of Hg, and respiratory rate of 20. Blood chemistry revealed a hemoglobin of 6.2 g/dL (normal: 11–16), red blood cell count of 2,120,000/μL (normal: 3,500,000–5,500,000), white blood cell: 2,290/μL, with 42.8% neutrophils (normal white blood cell: 4,000–9,000; neutrophils 50–70%), platelets 9,000/μL (normal: 100,000–300,000), glucose 9.5 mmol/L (normal: 3.2–5.6),direct bilirubin 23.7 μmol/L (normal: 1.7–7.1), alanine aminotransferase 104 IU/L (normal: 4–40), aspartate aminotransferase 216 IU/L (normal: 8–40), lactic dehydrogenase 1,528 IU/L (normal: 114–240), triglyceride 3.21 mmol/L (normal: 0.37–1.80), ferritin 23,800 μg/L (normal: 20–280), fibrinogen 95 mg/dL (normal: 200–400). A blood culture was negative for bacteria and viruses. Serological testing for human immunodeficiency virus, hepatitis B virus, hepatitis C virus, and antinuclear antibody were negative. A chest x-ray revealed an interstitial and alveolar infiltrate. Hepatosplenomegaly was observed using B-ultrasonography and tomography.
On admission, the patient was given an empirical antimicrobial treatment with cefoperazone plus tazobactam and etimicin. However, fever, dyspnea, and dry cough persisted and his clinical condition rapidly worsened and mechanical ventilation was required by the third day following admission. On the fifth day, bone marrow was biopsied for further diagnosis. The patient finally died of multiorgan failure 8 days after admission. Bone marrow examination revealed a few nuclear cells and a great amount of T. gondii cysts and tachyzoites (Figure 1) using Wright's stain. The cyst sizes (N = 13) ranged from 10 to 25 μm.
A group of Toxoplasma gondii tachyzoites (arrow) in bone marrow smear of the patient, Wright's stain.
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
A group of Toxoplasma gondii tachyzoites (arrow) in bone marrow smear of the patient, Wright's stain.
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
A group of Toxoplasma gondii tachyzoites (arrow) in bone marrow smear of the patient, Wright's stain.
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
For further assessment of the pathogen, a bone marrow smear was submitted to the parasite research laboratory of Yunnan University. Total DNA from the bone marrow sample was isolated and polymerase chain reaction (PCR) analysis was performed using the T. gondii-specific primer pairs TOX4 (CGCTGCAGGGAGGAAGACGAAAGTTG) and TOX5 (CGCTGCAGACACAGTGCATCTGGATT).7 The target fragment of 527 bp could be amplified from this sample (Figure 2). The sequence of the PCR product was identical with the published sequence of T. gondii (AF146527).
Species-specific polymerase chain reaction (PCR) amplification of the 529 bp DNA fragment using the Toxoplasma gondii-specific primer pairs TOX4/TOX5. Lanes: 2 kb DNA ladder (M); negative control using TE buffer (A); positive control using T. gondii oocysts stored at parasitic research laboratory of Yunnan University (B); and bone marrow of the patient (C).
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
Species-specific polymerase chain reaction (PCR) amplification of the 529 bp DNA fragment using the Toxoplasma gondii-specific primer pairs TOX4/TOX5. Lanes: 2 kb DNA ladder (M); negative control using TE buffer (A); positive control using T. gondii oocysts stored at parasitic research laboratory of Yunnan University (B); and bone marrow of the patient (C).
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
Species-specific polymerase chain reaction (PCR) amplification of the 529 bp DNA fragment using the Toxoplasma gondii-specific primer pairs TOX4/TOX5. Lanes: 2 kb DNA ladder (M); negative control using TE buffer (A); positive control using T. gondii oocysts stored at parasitic research laboratory of Yunnan University (B); and bone marrow of the patient (C).
Citation: The American Society of Tropical Medicine and Hygiene 88, 6; 10.4269/ajtmh.12-0556
Discussion
Seroprevalence of T. gondii infection is common in humans, ∼12.3% in China,8 but severe, or even fatal cases, are rarely described. Disseminated toxoplasmosis is associated with fever and multivisceral involvement. The organs most often involved are the lungs, heart, and brain, but any organ or system can eventually be involved.9–12 In this case, our patient developed an atypical pneumonia, with cavities and pleural effusion. Biological findings revealed elevated concentrations of liver enzymes, glucose, and direct bilirubin, suggesting the patient had developed hepatitis. Although hepatitis B virus and hepatitis C virus are frequent causes of hepatitis, the serology results were negative.
At admission, the patient's laboratory findings included high fever, hepatosplenomegaly, cytopenia, hypertriglyceridemia, hypofibrinogenemia, and hyperferritinemia. These signs and symptoms conformed to the diagnostic guidelines for hemophagocytic syndrome proposed by the Histiocyte Society in 199113 and updated in 2004.14 Hemophagocytic syndrome has been associated with a variety of viral, bacterial, fungal, and parasitic infections. Infections associated with hemophagocytic syndrome are most frequently caused by viruses, particularly Epstein-Barr virus.2 Toxoplasma gondii can cause hemophagocytic syndrome that mostly occurs in immunocompromised patients or in transplant recipients; a rare clinical presentation of toxoplasma-associated hemophagocytic syndrome has been reported in an immunocompetent 12-year-old boy in France.15 Hemophagocytic syndrome is probably underdiagnosed, as T. gondii-associated multiorgan failure is usually explained by other more common causes such as sepsis syndrome/shock.16,17
Diagnosis of T. gondii in this case was based on the presence of cysts and tachyzoites in a bone marrow smear and molecular characterization. Visualization of tachyzoites or cysts in bone marrow smear is difficult because of their small size. The use of both morphology and PCR supported the diagnosis. The 529 bp DNA fragment have been proved valuable and currently represent a sensitive PCR target for T. gondii detection.18
Congenital infection, ingestion of infected tissues, and ingestion of oocysts are the three main modes of transmission of T. gondii.19 It is likely that the major routes of transmission are different in human populations with differences in culture, eating habits, and/or environmental factors.20 In this case, the patient resided in Anning Prefecture, Yunan Province, located in the southwest of China. People living in this area are accustomed to drinking stream water and enjoy eating raw or half-raw meat or animal internal organs as part of their culture. Because the deceased patient regularly performed his duties in a subtropical forest region and was frequently exposed to risk factors, it is difficult for us to determine the incubation period.
ACKNOWLEDGMENTS
We thank the directors, doctors, and nurses of First Affiliated Hospital of Kunming Medical University.
- 2.↑
Rouphael NG, Talati NJ, Vaughan C, Cunningham K, Moreira R, Gould C, 2007. Infections associated with hemophagocytic syndrome. Lancet Infect Dis 7: 814–822.
- 3.↑
Guillaume MP, Driessens N, Libert M, De Bels D, Corazza F, Karmali R, 2006. Hemophagocytic syndrome associated with extracerebral toxoplasmosis in an HIV-infected patient. Eur J Intern Med 17: 503–504.
- 4.
Blanche P, Robert F, Dupouy-Camet J, Sicard D, 1994. Toxoplasmosis-associated hemophagocytic syndrome in a patient with AIDS: diagnosis by the polymerase chain reaction. Clin Infect Dis 19: 989–990.
- 5.
Karras A, Thervet E, Legendre C, 2004. Hemophagocytic syndrome in renal transplant recipients: report of 17 cases and review of literature. Transplantation 77: 238–243.
- 6.↑
Duband S, Cornillon J, Tavernier E, Dumollard JM, Guyotat D, Péoc'h M, 2008. Toxoplasmosis with hemophagocytic syndrome after bone marrow transplantation: diagnosis at autopsy. Transpl Infect Dis 10: 372–374.
- 7.↑
Homan WL, Vercammen M, De Braekeleer J, Verschueren H, 2000. Identification of a 200- to 300-fold repetitive 529 bp DNA fragment in Toxoplasma gondii, and its use for diagnostic and quantitative PCR. Int J Parasitol 30: 69–75.
- 8.↑
Xiao Y, Yin JG, Jiang N, Xiang M, Hao LL, Lu HJ, Sang H, Liu XY, Xu HJ, Ankarklev J, Lindh J, Chen QJ, 2001. Seroepidemiology of human Toxoplasma gondii infection in China. BMC Infect Dis 10: 4.
- 10.
Habek M, Ozretić D, Zarković K, Djaković V, Mubrin Z, 2009. Unusual cause of dementia in an immunocompetent host: toxoplasmic encephalitis. Neurol Sci 30: 45–49.
- 11.
Pergola G, Cascone A, Russo M, 2010. Acute pericarditis and myocarditis by Toxoplasma gondii in an immunocompetent young man: a case report. Infez Med 18: 48–52.
- 12.↑
Nunura J, Vásquez T, Endo S, Salazar D, Rodriguez A, Pereyra S, Solis H, 2010. Disseminated toxoplasmosis in an immunocompetent patient from Peruvian Amazon. Rev Inst Med Trop Sao Paulo 52: 107–110.
- 13.↑
Henter JI, Elinder G, Ost A, 1991. Diagnostic guidelines for hemophagocytic lymphohistiocytosis. The FHL Study Group of the Histiocyte Society. Semin Oncol 18: 29–33.
- 14.↑
Henter JI, Horne A, Aricó M, Egeler RM, Filipovich AH, Imashuku S, Ladisch S, McClain K, Webb D, Winiarski J, Janka G, 2007. HLH-2004: diagnostic and therapeutic guidelines for hemophagocytic lymphohistiocytosis. Pediatr Blood Cancer 48: 124–131.
- 15.↑
Briand PY, Gangneux JP, Favaretto G, Ly-Sunnaram B, Godard M, Robert-Gangneux F, Fest T, 2008. Hemophagocytic syndrome and toxoplasmic primo-infection. Ann Biol Clin (Paris) 66: 199–205.
- 16.↑
Barbosa CJ, Molina RJ, de Souza MB, Silva AC, Micheletti AR, dos Reis MA, de Paula Antunes Teixeira V, Silva-Vergara ML, 2007. Disseminated toxoplasmosis presenting as sepsis in two AIDS patients. Rev Inst Med Trop Sao Paulo 49: 113–116.
- 17.↑
Lucet JC, Bailly MP, Bedos JP, Wolff M, Gachot B, Vachon F, 1993. Septic shock due to toxoplasmosis in patients infected with the human immunodeficiency virus. Chest 104: 1054–1058.
- 18.↑
Su C, Shwab EK, Zhou P, Zhu XQ, Dubey JP, 2010. Moving towards an integrated approach to molecular detection and identification of Toxoplasma gondii. Parasitology 137: 1–11.
- 19.↑
Dubey JP, Jones JL, 2008. Toxoplasma gondii infection in humans and animals in the United States. Int J Parasitol 38: 1257–1278.
- 20.↑
Tenter AM, Heckeroth AR, Weiss LM, 2000. Toxoplasma gondii: from animals to humans. Int J Parasitol 30: 1217–1258.