• View in gallery

    Geographic origin of Triatoma infestans specimens analyzed. For more details, see Table 1.

  • View in gallery

    Haplotype network for mitochondrial NADH dehydrogenase subunit 5 and NADH dehydrogenase subunit 4 genes of Triatoma infestans. The maximum number of steps connecting parsimoniously two haplotypes is indicated. One step is indicated by lines between two haplotypes, and each additional base substitution is indicated by a solid circle. The haplotype with the highest ancestral probability (H) is displayed as a square, and the other haplotypes are displayed as circles.

  • 1.

    Roderick GK, 1996. Geographic structure of insect populations: gene flow, phylogeography, and their uses. Annu Rev Entomol 41: 325352.

  • 2.

    Monteiro FA, Pérez R, Panzera F, Dujardin JP, Galvão C, Rocha D, Noireau F, Schofield C, Beard CB, 1999. Mitochondrial DNA variation of Triatoma infestans populations and its implication on the specific status of T. melanosoma. Mem Inst Oswaldo Cruz 94: 229238.

    • Search Google Scholar
    • Export Citation
  • 3.

    García BA, Manfredi C, Fichera L, Segura EL, 2003. Variation in mitochondrial 12S and 16S ribosomal DNA sequences in natural populations of Triatoma infestans (Hemiptera: Reduviidae). Am J Trop Med Hyg 68: 692694.

    • Search Google Scholar
    • Export Citation
  • 4.

    Segura EL, Torres AG, Fusco O, García BA, 2009. Mitochondrial 16S DNA variation in populations of Triatoma infestans from Argentina. Med Vet Entomol 23: 3440.

    • Search Google Scholar
    • Export Citation
  • 5.

    Piccinali RV, Marcet PL, Noireau F, Kitron U, Gurtler RE, Dotson EM, 2009. Molecular population genetics and phylogeography of the Chagas disease vector Triatoma infestans in South America. J Med Entomol 46: 796809.

    • Search Google Scholar
    • Export Citation
  • 6.

    Michel AP, Grushko O, Guelbeogo WM, Lobo NF, Fale Sagnon N, Costantini C, Besansky NJ, 2006. Divergence with gene flow in Anopheles fenustus from the Sudan Savanna of Burkina Faso, West Africa. Genetics 173: 13891395.

    • Search Google Scholar
    • Export Citation
  • 7.

    Meraner A, Brandstätter A, Thaler R, Aray B, Unterlechner M, Niederstätter H, Parson W, Zelger R, Dalla Via J, Dallinger R, 2008. Molecular phylogeny and population structure of the codling moth (Cydia pomonella) in central Europe: I. Ancient clade splitting revealed by mitochondrial haplotype markers. Mol Phylogenet Evol 48: 825837.

    • Search Google Scholar
    • Export Citation
  • 8.

    Grisales N, Triana O, Angulo V, Jaramillo N, Parra-Henao G, Panzera F, Gómez-Palacio A, 2010. Diferenciación genética de tres poblaciones Colombianas de Triatoma dimidiata (Latreille, 1811) mediante análisis molecular del gen mitocondrial ND4. Biomedica 30: 207214.

    • Search Google Scholar
    • Export Citation
  • 9.

    Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 15961599.

    • Search Google Scholar
    • Export Citation
  • 10.

    Watterson GA, 1975. On the number of segregating sites in genetical models without recombination. Theor Popul Biol 7: 256276.

  • 11.

    Nei M, 1987. Molecular Evolutionary Genetics. New York: Columbia University Press.

  • 12.

    Tajima F, 1983. Evolutionary relationship of DNA sequences in finite populations. Genetics 105: 437460.

  • 13.

    Librado P, Rozas J, 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 14511452.

  • 14.

    Clement M, Posada D, Crandrall KA, 2000. TCS: a computer program to estimate gene genealogies. Mol Ecol 9: 16571659.

 

 

 

 

Variation in Mitochondrial NADH Dehydrogenase Subunit 5 and NADH Dehydrogenase Subunit 4 Genes in the Chagas Disease Vector Triatoma infestans (Hemiptera: Reduviidae)

View More View Less
  • Cátedra de Bioquímica y Biología Molecular, Facultad de Ciencias Médicas, INICSA (CONICET-Universidad Nacional de Córdoba), Ciudad Universitaria, Córdoba, Argentina

Variation in mitochondrial NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 4 (ND4) genes was surveyed in Triatoma infestans from 24 localities of Argentina. The DNA sequence comparisons of 2,183 basepairs of the mitochondrial genome, which include the complete sequence of ND5 (1,712 basepairs) and 401 basepairs of ND4 genes, showed 19 haplotypes determined by 48 variable sites and a nucleotide diversity value of 0.292%. Twenty-six (65%) substitutions were synonymous, and there were 14 (35%) predicted amino acid replacements in ND5. In ND4, 5 (62.5%) substitutions were synonymous and 3 (37.5%) were replacement sites. Samples from six localities studied shared one haplotype and the rest of the localities had different haplotypes. The amplified regions should be useful for population genetic studies.

Chagas disease is caused by infection with Trypanosoma cruzi, which is transmitted by hematophagous insects of the subfamily Triatominae (Hemiptera: Reduviidae). Triatoma infestans is the main vector of T. cruzi in the Southern Cone of Latin American countries between the latitudes 10° S and 46° S. Genetic analyses of populations of this species may provide information for development of control strategies.

Mitochondrial DNA (mtDNA) genes have been used in a number of population genetic analyses and have been recognized as particularly useful for phylogeographic studies in many species of insects.1 However, the maternally inherited markers analyzed in T. infestans either exhibited low levels of variation24 or have not been useful for phylogeographic inferences of the Chagas disease vector in Argentina.5 The mitochondrial NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 4 (ND4) are two of the most variable protein-coding genes in insects.68 We tested variation of the ND5 and ND4 genes in individual T. infestans from 24 localities in Argentina.

The geographic origin of the specimens of T. infestans analyzed is shown in Figure 1 and Table 1. The specimen obtained in each locality was considered to belong to one population.

Figure 1.
Figure 1.

Geographic origin of Triatoma infestans specimens analyzed. For more details, see Table 1.

Citation: The American Society of Tropical Medicine and Hygiene 88, 5; 10.4269/ajtmh.12-0451

Table 1

Sampling site and its code for Triatoma infestans from Argentina, including length of the mitochondrial DNA region analyzed, haplotypes, and corresponding GeneBank accession numbers*

Sampling siteLocality, county, provinceCodeNo.LatitudeLongitudeLength (bp)HaplotypeGenBank accession no.
1Chuña, Ischilin, CórdobaCCI130°28′S64°40′W2,343AKC196504
2Sauce Arriba, San Alberto, CórdobaCSA131°54′S65°10′W2,362BKC196505
3Caucete, Caucete, San JuanSJC131°40′S68°16′W2,358HKC196511
4Sabagasta, Salavina, Santiago del EsteroSES128°37′S63°29′W2,350GKC196510
5Vaca Human, Salavina, Santiago del EsteroSEV128°47′S63°37′W2,350EKC196508
6Taco Totorayo, Salavina, Santiago del EsteroSET128°49′S63°26′W2,356FKC196509
7Vaca Huañuna, Figueroa, Santiago del EsteroSEH127°27′S63°27′W2,352HKC196511
8Tres Isletas, Maipú, ChacoCHT126°21′S60°26′W2,349QKC196520
9Siete Árboles, Gral. San Martín, ChacoCHS126°24′S59°25′W2,194PKC196519
10Palo Santo, Bermejo, FormosaFPS124°19′S60°55′W2,262MKC196516
11Pozo del Zuri, Bermejo, FormosaFPZ123°41′S61°09′W2,263NKC196517
12La Esperanza, Bermejo, FormosaFES123°40′S61°09′W2,302OKC196518
13El Zapallo, General Paz, CorrientesCOZ127°41′S57°37′W2,349HKC196511
14Santa Rosa, Capital, La PampaLPS136°35′S64°20′W2,363CKC196506
15El Nochero, 9 de Julio, Santa FéSFN129°01′S61°15′W2,274SKC196522
16Moraju, General Obligado, Santa FéSFM128°30′S59°30′W2,352RKC196521
17Salvador Mazza, San Martín, SaltaSSM122°03′S63°42′W2,350DKC196507
18Santa Rosa, Valle Viejo, CatamarcaCSR128°28′S65°47′W2,364HKC196511
19Saujil, Pomán, CatamarcaCSP128°12′S66°14′W2,358HKC196511
20Saujil, Tinogasta, CatamarcaCST127°34′S67°37′W2,335HKC196511
21Fiambalá, Tinogasta, CatamarcaCFI127°41′S67°37′W2,365LKC196515
22Copacabana, Tinogasta, CatamarcaCCO128°12′S67°29′W2,351KKC196514
23Huillapima, Capayán, CatamarcaCHU128°44′S65°59′W2,345JKC196513
24Medanitos, Tinogasta, CatamarcaCME127°31′S67°36′W2,362IKC196512

bp = basepairs.

Haplotypes detected from DNA sequence comparisons of 2,183 bp of the mitochondrial DNA region analyzed.

The primer pairs (Table 2) used for polymerase chain reaction (PCR) and direct sequencing were designed from conserved fragments of aligned sequences of several insects available in GeneBank. Sequences were aligned using CLUSTAL implemented in MEGA 4.9 The PCR amplifications were conducted with genomic DNA by using a Professional Basic thermal cycler (Biometra, Goettingen, Germany). Reaction products were purified by using a QIAquick PCR Purification Kit (QIAGEN, Hilden, Germany) for direct sequencing in an ABI Prism 3130 automated DNA sequencer (Applied Biosystems, Foster City, CA).

Table 2

Primers used for amplification and direct sequencing of NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 4 (ND4) genes in Triatoma infestans, Argentina

PrimerSequence (5′ → 3′)Fragment size (basepairs)
Ser –FGCTAACTATCTTTTAAAGCGG1,294
ND5-R1GCTCARATTCCKTTTTCTTC1,294
ND5-F1GCAGTAACYAAAGTAGAAGAATG1,269
ND4-R1ATTGCTTATTCTTCDGTTGCTC1,269
ND5-F2AAAGGGCAAACCACACAAAG822
ND5-R2ATGGGTTCTGATGTTGATCG822

DNA sequences were aligned using CLUSTAL in MEGA 4. Nucleotide diversity was estimated according to the estimator (θW) of Watterson,10 average nucleotide diversity (π),11 and average number of nucleotide differences (K)12 by using DnaSp version 5.1.13 Absolute distances and maximum composite likelihood distances between haplotypes were obtained by using MEGA 4. A haplotype network was generated on the basis of the parsimony method using the TCS program.14

A total of 2,365 basepairs (GeneBank accession no. KC182516) of mtDNA were amplified and sequenced from T. infestans. The region studied includes 55 basepairs of the glutamic acid tRNA gene (tRNA-Glu), 69 basepairs of the phenylalanine tRNA gene (tRNA-Phe), the complete ND5 gene (1712 basepairs), 65 basepairs of the histidine tRNA gene (tRNA-His), and the first 461 basepairs of the ND4 gene.

Fragments of the mtDNA region characterized above were analyzed in 24 T. infestans, each collected at a different site in Argentina. The length of the mtDNA fragments ranged from 2,194 to 2,365 basepairs (Table 1). The DNA sequence comparisons of 2,183 basepairs of this region showed 19 haplotypes involving 48 variable sites (Table 3). The observed total nucleotide variability was of 0.00589 and 0.292% according to θW and π, respectively. The average number of nucleotide differences (K) was 6.370.

Table 3

Haplotypes found in NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 4 (ND4) mitochondrial DNA genes of Triatoma infestans*

Haplotypes
ND5ND4
                            1111111111111        
   11123334455666777888889991112223455566   12333
 251255149566705855606778014239016861278915862134
 444208229231541989124355722227350368182586883610
ACGGCCCTCTTTAGGGAAAGACTAGTGCAGAATGGCACCCCTTATTGTA
B...TT.C................AC........A...T....GC...G
C....TT..C....AA........AC............T.........G
D....T.....C.A.A........AC.T........G.TT........G
E....T..................AC............T.........G
F....T.....C...A.......GAC.T........GTT.......A.G
G....T.....C...A......CGAC.T........G.T.........G
H....T.....C...A.......GAC.T........G.T.........G
I....T.....C...A........AC...C........T.T.......G
J....T.....C...A.CCTC..GAC.T........G.T.........G
K....T.........A........AC.....G.A....T..C......G
L..A.T..................AC.........T..T.........G
M....T..T...G...........AC............T......C.CG
N....T.....C...A...........T........G.T.........G
O....T.....C...A.........C.T........G.T.........G
PA...T.....C....C....T.GAC.T........G.T.........G
Q....T....CC...A.......GAC.T........G.T.........G
R....T.........A........ACA.G.G.......T.........G
S.A..T.........A........AC......C.........A....CG

Variable nucleotide positions are indicated in sequential order in both genes. The sequence of the first haplotype is used as a reference. Nucleotides identical to the reference are indicated by a dot. Replacement sites are shown in boxes for ND5 (position 24, L → F; 122, V → I; 452, K → E; 463, S → K; 604, T → M; 689, C → G; 758, C → G; 759 and 761, H → K; 802, F → C; 907, S → K; 1132, T → S; 1466, G → S; 1682, G → S) and ND4 (position 18, S → G; 56, H → L; 168, I → V).

The percentages of sequence variation over ND5 and ND4 gene regions are shown in Table 4. The variable nucleotide positions included 40 transitions and 8 transversions and were classified by codon positions in both genes. As expected, most variation occurred in third codon positions in ND5 and ND4 genes (65% and 62.5%, respectively), and the second codon positions showed the least variation (only 5 of the 571 second codon positions varied in ND5 and 1 of the 134 second codon positions varied in ND4); 26 (65%) of the substitutions were synonymous and 14 (35%) predicted amino acid replacements in ND5. In ND4, 5 (62.5%) were synonymous and 3 (37.5%) were replacement sites (Table 3).

Table 4

Percentages of variable sites in NADH dehydrogenase subunit 5 (ND5) and NADH dehydrogenase subunit 4 (ND4) genes across Triatoma infestans haplotypes*

CharacteristicND4ND5
1st codon position2nd codon position3rd codon positionTotal1st codon position2nd codon position3rd codon positionTotal
Unvaried98.50 (131)99.25 (133)96.27 (129)98.00 (393)98.42 (562)99.13 (566)95.44 (544)97.66 (1,672)
Transitions1.50 (2)0.00 (0)3.73 (5)1.75 (7)1.05 (6)0.52 (3)4.21 (24)1.93 (33)
Transversions0.00 (0)0.75 (1)0.00 (0)0.25 (1)0.53 (3)0.35 (2)0.35 (2)0.41 (7)
Total (bp)1331341344015715715701712

Values in parentheses are number of sites. bp = basepairs.

Insects from Caucete, Caucete, San Juan; Santa Rosa, Valle Viejo, Catamarca; Saujil, Tinogasta, Catamarca; Saujil, Pomán, Catamarca; Vaca Huañuna, Figueroa, Santiago del Estero; and El Zapallo, General Paz, Corrientes shared haplotype H and the rest of the localities showed different haplotypes. These different haplotypes, found in the only specimen analyzed in the remaining 18 localities, suggest that this portion of the mitochondrial genome might provide a valuable tool for genetic analysis of T. infestans populations.

Sequences were closely related; the pair of haplotypes did not differ by more than 14 nucleotides. Pairwise divergence among T. infestans haplotypes ranged from 0.0005 (1 of 2,183) between haplotypes G-H, Q-H, and O-N to 0.0066 (14 of 2,183) between haplotypes A-J and B-J. Thirty nine of the 48 variable positions observed across all the haplotypes detected differed by a single substitution in one haplotype (Table 3). These sites are parsimony uninformative sites and the remaining nine nucleotide positions are informative. In this respect, it is important to point out that eight of these informative sites are from 463 to 1578 nucleotide positions of the ND5 gene.

The haplotype network (Figure 2) obtained with TCS software indicates that the different sequence types observed would have derived from a common ancestral haplotype (H). In contrast, the network shows that the haplotypes A and B (detected in Córdoba Province), as well as M and L (detected in Formosa and Catamarca Provinces, respectively), would have derived from haplotype E (found in Santiago del Estero Province). This haplotype is separated from H by 4 mutational events. In addition, haplotype N would have derived from haplotype O (detected in the geographically closest localities from Formosa [Pozo del Zuri, Bermejo, Formosa and La Esperanza, Bermejo, Formosa], respectively), both separated by a single mutational step.

Figure 2.
Figure 2.

Haplotype network for mitochondrial NADH dehydrogenase subunit 5 and NADH dehydrogenase subunit 4 genes of Triatoma infestans. The maximum number of steps connecting parsimoniously two haplotypes is indicated. One step is indicated by lines between two haplotypes, and each additional base substitution is indicated by a solid circle. The haplotype with the highest ancestral probability (H) is displayed as a square, and the other haplotypes are displayed as circles.

Citation: The American Society of Tropical Medicine and Hygiene 88, 5; 10.4269/ajtmh.12-0451

This is the first ND5 and ND4 gene sequences analysis in the Chagas disease vector T. infestans. The amplified regions, fundamentally a portion of the ND5 gene, should be useful for phylogeographic studies. Because one individual was analyzed per locality, it is important to take into account that more sequences need to be examined.

  • 1.

    Roderick GK, 1996. Geographic structure of insect populations: gene flow, phylogeography, and their uses. Annu Rev Entomol 41: 325352.

  • 2.

    Monteiro FA, Pérez R, Panzera F, Dujardin JP, Galvão C, Rocha D, Noireau F, Schofield C, Beard CB, 1999. Mitochondrial DNA variation of Triatoma infestans populations and its implication on the specific status of T. melanosoma. Mem Inst Oswaldo Cruz 94: 229238.

    • Search Google Scholar
    • Export Citation
  • 3.

    García BA, Manfredi C, Fichera L, Segura EL, 2003. Variation in mitochondrial 12S and 16S ribosomal DNA sequences in natural populations of Triatoma infestans (Hemiptera: Reduviidae). Am J Trop Med Hyg 68: 692694.

    • Search Google Scholar
    • Export Citation
  • 4.

    Segura EL, Torres AG, Fusco O, García BA, 2009. Mitochondrial 16S DNA variation in populations of Triatoma infestans from Argentina. Med Vet Entomol 23: 3440.

    • Search Google Scholar
    • Export Citation
  • 5.

    Piccinali RV, Marcet PL, Noireau F, Kitron U, Gurtler RE, Dotson EM, 2009. Molecular population genetics and phylogeography of the Chagas disease vector Triatoma infestans in South America. J Med Entomol 46: 796809.

    • Search Google Scholar
    • Export Citation
  • 6.

    Michel AP, Grushko O, Guelbeogo WM, Lobo NF, Fale Sagnon N, Costantini C, Besansky NJ, 2006. Divergence with gene flow in Anopheles fenustus from the Sudan Savanna of Burkina Faso, West Africa. Genetics 173: 13891395.

    • Search Google Scholar
    • Export Citation
  • 7.

    Meraner A, Brandstätter A, Thaler R, Aray B, Unterlechner M, Niederstätter H, Parson W, Zelger R, Dalla Via J, Dallinger R, 2008. Molecular phylogeny and population structure of the codling moth (Cydia pomonella) in central Europe: I. Ancient clade splitting revealed by mitochondrial haplotype markers. Mol Phylogenet Evol 48: 825837.

    • Search Google Scholar
    • Export Citation
  • 8.

    Grisales N, Triana O, Angulo V, Jaramillo N, Parra-Henao G, Panzera F, Gómez-Palacio A, 2010. Diferenciación genética de tres poblaciones Colombianas de Triatoma dimidiata (Latreille, 1811) mediante análisis molecular del gen mitocondrial ND4. Biomedica 30: 207214.

    • Search Google Scholar
    • Export Citation
  • 9.

    Tamura K, Dudley J, Nei M, Kumar S, 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Mol Biol Evol 24: 15961599.

    • Search Google Scholar
    • Export Citation
  • 10.

    Watterson GA, 1975. On the number of segregating sites in genetical models without recombination. Theor Popul Biol 7: 256276.

  • 11.

    Nei M, 1987. Molecular Evolutionary Genetics. New York: Columbia University Press.

  • 12.

    Tajima F, 1983. Evolutionary relationship of DNA sequences in finite populations. Genetics 105: 437460.

  • 13.

    Librado P, Rozas J, 2009. DnaSP v5: a software for comprehensive analysis of DNA polymorphism data. Bioinformatics 25: 14511452.

  • 14.

    Clement M, Posada D, Crandrall KA, 2000. TCS: a computer program to estimate gene genealogies. Mol Ecol 9: 16571659.

Author Notes

* Address correspondence to Beatriz A. García, Cátedra de Bioquímica y Biología Molecular, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Pabellón Argentina 2° Piso, Ciudad Universitaria, 5000 Córdoba, Argentina. E-mail: bgarcia@biomed.uncor.edu

Financial support: This study was supported by the grants from the Agencia Nacional de Promoción Científica y Tecnológica (FONCyT), the Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET) of Argentina, and the Secretaría de Ciencia y Tecnología de la Universidad Nacional de Córdoba. Cintia J. Fernández is a Fellow of FONCyT and Beatriz A. García is Career Investigator of CONICET.

Authors' addresses: Cintia J. Fernández, Alicia R. Pérez de Rosas, and Beatriz A. García, Cátedra de Bioquímica y Biología Molecular, Facultad de Ciencias Médicas, Universidad Nacional de Córdoba, Pabellón Argentina 2° Piso, Ciudad Universitaria, 5000 Córdoba, Argentina, E-mails: cjudithfernandez@gmail.com, arperez@biomed.fcm.edu.com.ar, and bgarcia@biomed.uncor.edu.

Save