• View in gallery

    Parasites' quantification in the peripheral blood of 21 patients with VL in the course of treatment with antimony and follow-ups in southern Iran. Dotted horizontal line indicates mean parasite level. The thick horizontal line indicates diagnostic cut off point.

  • 1.

    WHO, 2010. Control of the leishmaniasis. Proceedings of a meeting of the WHO Expert Committee on the Control of Leishmaniases, March 22–26, 2010, Geneva, Switzerland.

    • Search Google Scholar
    • Export Citation
  • 2.

    Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M; WHO Leishmaniasis Control Team, 2012. Leishmaniasis worldwide and global estimates of its incidence. PLoS ONE 7: e35671.

    • Search Google Scholar
    • Export Citation
  • 3.

    Alborzi A, Rasouli M, Shamsizadeh A, 2006. Leishmania tropica-isolated patient with visceral leishmaniasis in southern Iran. Am J Med Hyg 74: 306307.

    • Search Google Scholar
    • Export Citation
  • 4.

    Murray HW, Berman JD, Davies CR, Saravia NG, 2005. Advances in leishmaniasis. Lancet 366: 15611577.

  • 5.

    Gradoni L, Soteriadou K, Louzir H, Dakkak A, Toz SO, Jaffe C, Dedet JP, Campino L, Cañavate C, Dujardin JC, 2008. Drug regimens for visceral leishmaniasis in Mediterranean countries. Trop Med Int Health 13: 12721276.

    • Search Google Scholar
    • Export Citation
  • 6.

    Karimi A, Alborzi A, Mahmoodi MR, Rakhshani AH, Kadivar MR, 1998. Short course anti-Leishmania therapy in children with visceral leishmaniasis. Iran J Med Sci 23: 610.

    • Search Google Scholar
    • Export Citation
  • 7.

    Shahian M, Alborzi A, 2009. Effect of meglumine antimoniate on the pancreas during treatment of visceral leishmaniasis in children. Med Sci Monit 15: 290293.

    • Search Google Scholar
    • Export Citation
  • 8.

    Alborzi A, Rasouli M, Nademi Z, Kadivar MR, Pourabbas B, 2006. Evaluation of rK39 strip test for the diagnosis of visceral leishmaniasis in infants. East Mediterr Health J 12: 294299.

    • Search Google Scholar
    • Export Citation
  • 9.

    Aoun K, Chouihi E, Amri F, Ben Alaya N, Raies A, Mary C, Bouratbine A, 2009. Short report: contribution of quantitative real-time polymerase chain reaction to follow-up of visceral leishmaniasis patients treated with meglumine antimoniate. Am J Trop Med Hyg 81: 10041006.

    • Search Google Scholar
    • Export Citation
  • 10.

    Mary C, Faraut F, Lascombe L, Dumon H, 2004. Quantitifications of Leishmania infantum DNA by real-time PCR assay with high sensitivity. J Clin Microbiol 42: 52495255.

    • Search Google Scholar
    • Export Citation
  • 11.

    Mary C, Faraut F, Drogoul MP, Xeridat B, Schleinitz N, Cuisenier B, Dumon H, 2006. Reference values for Leishmania infantum parasitaemia in different clinical presentations: quantitative PCR for therapeutic monitoring and patient follow-up. Am J Trop Med Hyg 75: 858863.

    • Search Google Scholar
    • Export Citation
  • 12.

    Sudarshan M, Weirather JL, Wilson ME, Sundar S, 2011. Study of parasite kinetics with antileishmanial drugs using real-time quantitative PCR in Indian visceral leishmaniasis. J Antimicrob Chemother 66: 17511755.

    • Search Google Scholar
    • Export Citation
  • 13.

    Lachaud L, Dereure J, Chabbert E, Reynes J, Mauboussin JM, Oziol E, Dedet JP, Bastien P, 2000. Optimized PCR using patient blood samples for diagnosis and follow-up of visceral leishmaniasis, with special reference to AIDS patients. J Clin Microbiol 38: 236240.

    • Search Google Scholar
    • Export Citation
  • 14.

    Alborzi A, Pourabbas B, Shahian F, Mardaneh J, Pouladfar GR, Ziyaeyan M, 2008. Detection of Leishmania infantum kinetoplast DNA in the whole blood of asymptomatic individuals by PCR-ELISA and comparison with other infection markers in endemic areas, southern Iran. Am J Trop Med Hyg 79: 839842.

    • Search Google Scholar
    • Export Citation
  • 15.

    Smyth AJ, Ghosh A, Hassan MQ, Basu D, De Bruijn MH, Adhya S, Mallik KK, Barker DC, 1992. Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of kala-azar patients. Parasitology 105: 183192.

    • Search Google Scholar
    • Export Citation
  • 16.

    le Fichoux Y, Quaranta JF, Aufeuvre JP, Lelievre A, Marty P, Suffia I, Rousseau D, Kubar J, 1999. Occurrence of Leishmania infantum parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J Clin Microbiol 37: 19531957.

    • Search Google Scholar
    • Export Citation
  • 17.

    Tupperwar N, Vineeth V, Rath S, dya T, 2008. Development of a real-time polymerase chain reaction assay for the quantification of Leishmania species and the monitoring of systemic distribution of the pathogen. Diagn Microbiol Infect Dis 61: 2330.

    • Search Google Scholar
    • Export Citation
  • 18.

    Mondal S, Bhattacharya P, Rahaman M, Ali N, Goswami RP, 2010. A curative immune profile one week after treatment of Indian kala-azar patients predicts success with a short-course liposomal amphotericin B therapy. PLoS Negl Trop Dis 4: e764.

    • Search Google Scholar
    • Export Citation
  • 19.

    van der Meide W, Guerra J, Schoone G, Farenhorst M, Coelho L, Faber W, Peekel I, Schallig H, 2008. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites. J Clin Microbiol 46: 7378.

    • Search Google Scholar
    • Export Citation
  • 20.

    Costa CH, Stewart JM, Gomes RB, Garcez LM, Ramos PK, Bozza M, Satoskar A, Dissanayake S, Santos RS, Silva MR, Shaw JJ, David JR, Maguire JH, 2002. Asymptomatic human carriers of Leishmania chagasi. Am J Trop Med Hyg 66: 334337.

    • Search Google Scholar
    • Export Citation
  • 21.

    Davis AJ, Murray HW, Handman E, 2004. Drugs against leishmaniasis: a synergy of technology and partnerships. Trends Parasitol 20: 7376.

  • 22.

    Ghalib HW, Whittle JA, Kubin M, Hashim FA, el-Hassan AM, Grabstein KH, Trinchieri G, Reed SG, 1995. IL-12 enhances Th1-type responses in human Leishmania donovani infections. J Immunol 154: 46234629.

    • Search Google Scholar
    • Export Citation
  • 23.

    Holaday BJ, Pompeu MM, Jeronimo S, Texeira MJ, Sousa A de A, Vasconcelos AW, Pearson RD, Abrams JS, Locksley RM, 1993. Potential role for interleukin-10 in the immunosuppression associated with kala azar. J Clin Invest 92: 26262632.

    • Search Google Scholar
    • Export Citation
  • 24.

    Saha S, Mondal S, Ravindran R, Bhowmick S, Modak D, Mallick S, Rahman M, Kar S, Goswami R, Guha SK, Pramanik N, Saha B, Ali N, 2007. IL-10 and TGF-beta-mediated susceptibility in kala-azar and post-kala-azar dermal leishmaniasis: the significance of amphotericin B in the control of Leishmania donovani infection in India. J Immunol 179: 55925603.

    • Search Google Scholar
    • Export Citation
  • 25.

    Engwerda CR, Murphy ML, Cotterell SE, Smelt SC, Kaye PM, 1998. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur J Immunol 28: 669680.

    • Search Google Scholar
    • Export Citation
  • 26.

    Theodos CM, Povinelli L, Molina R, Sherry B, Titus RG, 1991. Role of tumor necrosis factor in macrophage leishmanicidal activity in vitro and resistance to cutaneous leishmaniasis in vivo. Infect Immun 59: 28392842.

    • Search Google Scholar
    • Export Citation
  • 27.

    Haldar AK, Sen P, Roy S, 2011. Use of antimony in the treatment of leishmaniasis: current status and future directions. Mol Biol Int 1: 571242.

 

 

 

 

Quantification of Leishmania infantum Kinetoplast DNA for Monitoring the Response to Meglumine Antimoniate Therapy in Visceral Leishmaniasis

View More View Less
  • Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran; Department of Pediatrics, Yasouj University of Medical Sciences, Yasouj, Iran

Meglumine antimoniate (Glucantime) remains the therapeutic cornerstone of visceral leishmaniasis (VL). Twenty-one VL patients were treated with Glucantime, extending for 1 week after defervescence. For monitoring the response, Leishmania infantum kinetoplast DNA loads were evaluated using real-time polymerase chain reaction (PCR) assay in the blood. The maximum duration of treatment was 14 days. The loads before treatment ranged from 8 to 1,300,000 parasites/mL (mean = 73,095 parasites/mL), and the mean values on days 3, 7, 14, 28, and 90 were 4,902, 506, 6.33, 0.26, and 0.14, respectively. The loads decline to < 1 parasite/mL for 16 (76%) and 20 (95%) patients on days 14 and 28, respectively, and they decline for all patients by day 90. Results showed a dramatic decrease of the parasite loads, although complete clearance was not accomplished at the end of treatment. Only one relapse (4.5%) was observed. The parasite load can also serve as a dependable index for monitoring the response to Glucantime.

Introduction

Visceral leishmaniasis (VL; kala-azar) is a life-threatening parasitic infection that is endemic in 62 countries worldwide, including the Mediterranean region.1 Based on regional reported incidences, approximately 0.2–0.4 million VL cases occur each year in the world.2 Leishmania infantum is the most common cause of VL in Iran, where it mainly affects children, with an annual incidence rate of 300–600.2,3 VL is characterized by prolonged fever, weight loss, progressive anemia or pancytopenia, and hypergammaglobulinemia.1

Antimony (sodium antimony gluconate and meglumine antimoniate) has been its therapeutic cornerstone throughout the world for more than 70 years.4 The World Health Organization (WHO) Expert Committee recommended that meglumine antimoniate (Glucantime) be administered in doses of 20 mg/kg per day up to a maximum of 850 mg for 28–30 days.1 Importantly, cure rates exhibited by different drugs, including antimonials in the areas where they are still in routine use, are similarly high (95%) in immunocompetent patients. Data show that antimony resistance does not seem to be an emerging problem in Mediterranean countries, which is in contrast to the situation documented in Indian VL cases caused by L. donovani.5 In the endemic regions of southern Iran, treatment with meglumine antimoniate for a short duration (20 mg/kg per day intramuscularly, extending for 1 week after defervescence) remains the first-line treatment of VL patients.3,68

In recent years, real-time polymerase chain reaction (PCR) has been developed and used successfully for the diagnosis and quantification of parasitic loads.912 Rapid and accurate methods for parasite detection and monitoring parasite loads in VL would greatly enhance the clinical management of the disease. Monitoring during therapy with amphotericin in immunocompromised patients has been promising, but therapeutic monitoring in immunocompetent patients treated with other regimens, such as Glucantime, has hardly ever been addressed in literature.10

In this study, L. infantum parasite loads in the blood were evaluated by the kinetoplast DNA (kDNA) leishmania quantitative real-time PCR assay for monitoring the response to Glucantime in 21 VL patients, extending for 1 week after defervescence, in southern Iran.

Materials and Methods

Patients.

Two groups were enrolled in this study, namely patients and controls. The patient group consisted of 21 individuals (13 males and 8 females), with a mean age of 19 months (range = 4–72 months), admitted with a diagnosis of VL to Nemazi Hospital, a tertiary referral center affiliated with Shiraz University of Medical Sciences, Iran. The study was conducted between January of 2009 and July of 2010. The patients were referred from the southern provinces of Iran, where VL is endemic. Diagnosis of the disease was based on the clinical signs associated with the detection of a titer of 1:128 or higher of antibodies to Leishmania detected by the indirect immunofluorescence test (IFAT) and K39 strip tests. The 21 patients diagnosed with VL received treatment with meglumine antimoniate, 20 mg/kg per day intramuscularly, extending for 1 week after defervescence.3,68 Clinical response was defined as defervescence, and all of the patients who received the treatment were responsive to it.6,8 The day of defervescence was defined as the day at which fever dissipated and the patient subsequently maintained a temperature below 38°C. The second group (control) consisted of 40 individuals (31 males and 9 females), with a mean age of 7 years, similarly living in the leishmaniasis-endemic area of southern Iran with no history of clinical symptoms for VL or immunosuppression. This study was conducted with the approval of the Ethics Committee of Shiraz University of Medical Sciences, Iran, and informed consents were obtained from the individuals' guardians.

Samples.

Two-milliliter peripheral blood samples from all of the participants, collected in EDTA-coated tubes, were aliquoted and frozen at −70°C for real-time PCR assay. At the time of sampling, the sera for IFAT and K39 strip tests were obtained from 2-mL clot blood samples. Additionally, 2-mL whole-blood samples were obtained from the patient group on days 3, 7, 14, 28, and 90 after the beginning of therapy and also, 2 or 3 days after defervescence. These samples were sent to the Professor Alborzi Clinical Microbiology Research Center (PACMRC) for determination of the parasite loads. Monthly follow-ups were carried out for all of the patients for a period of 14 months.

Serological tests.

The IFAT was made using antigens of L. infantum prepared from a reference human strain (strain MCAN/IR/96/LON-49). IFAT was determined from a serial dilution of 1:64 to 1:1,024 for each serum sample according to the WHO/LEISH/96.40 protocol. Human antiglobulin (Binding Site Group, Birmingham, UK) with a dilution of 1:300 was used. Control serum (titer = 1:1,024) was collected from the patients with VL. K39 strip test (InBios International, Seattle, WA) was used according to the manufacturer's instructions.

Quantitative detection of kDNA.

DNA extraction was performed on 500-μL whole-blood samples. To achieve maximum yield, digestion was performed on one volume blood in two volumes 0.5% Tween 20, 0.5% Nonidet P-40, 10 mM NaOH, 10 mM Tris (pH 7.2), and 320 μg proteinase K per 1 mL (proteinase K lysis buffer) for 24 hours at 56°C and then boiled for 10 minutes.13 A simplified phenol-chloroform extraction was performed on this lysate followed by ethanol precipitation and resuspension in 50 μL sterile distilled water and storage at −70°C.

Quantification of parasite load was performed according to a previously described technique with some modifications.10,11 An Applied Biosystem 7500 (Foster City, CA) was used for amplification and detection. Optimization experiments led us to use the TaqMan Gene Expression Master Mix (catalog number 4369016), 20 pmol direct primer (CTTTTCTGGTCCTCCGGGTAGG), 20 pmol reverse primer (CCACCCGGCCCTATTTTACACCAA), and 50 pmol TaqMan probe (FAM-TTTTCGCAGAACGCCCCTACCCGC-TAMRA). Assays were performed with a 25 μL final volume with 5 μL sample DNA. The standard curve was established from Leishmania DNA extracted from 5 × 106 parasites; 5 μL serial dilutions, ranging from 50,000 to 0.0005 parasites, were added to the reaction tubes. TaqMan Chemistry allowed two-step temperature (94°C and 60°C) cycling over 45 cycles. Primers were designed to hybridize to kDNA L. infantum, and the hybridization probe was specific for VL parasites. This assay had a sensitivity of 0.001 parasite/mL.

Statistical analysis.

Data were analyzed using Spearman's correlation and the Mann–Whitney and paired-sign tests.

Results

Parasite loads in the control group.

Among the blood samples from 40 individuals living in the endemic area without any history of leishmaniasis, we detected leishmania kDNA in 55% of the cases (22 of 40). The parasite load was less than 1 parasite/mL, detected within a range of 0.02–0.9 parasite/mL, with a mean of 0.08 in all 22 individuals.

Parasite loads pre-treatment.

Leishmania kDNA was found in all 21 patients with VL at the time of diagnosis, with a broad range (8–1,300,000 parasites/mL). The mean and median of the parasite loads were 74,357 and 280 parasites/mL, respectively. The load was not significantly correlated with age, duration of fever before treatment, or titer of anti-Leishmania antibodies at the time of diagnosis (Table 1).

Table 1

Monitoring of kDNA loads in patients with VL treated with Glucantime in southern Iran

No.Sex*Age (months)Duration of fever before treatment (days)Anti-Leishmania Ab (titer)Day of defervescenceLeishmania kDNA (parasites/mL)Leishmania kDNA (parasites/mL) after starting treatment
3rd day7th day2–3 days after defervescence14th day28th day90th day
1M6281:25658.001.600.000.000.100.000.00
2M7141:25648.000.400.100.100.000.000.00
3F30141:128332.007.000.600.500.900.400.05
4F36211:12851,330.006.001.000.000.000.000.00
5M7281:128480.0016.000.000.000.000.000.00
6M36141:5125227.00200.000.000.000.000.000.00
7M24211:256410.004.001.201.200.800.000.00
8F6281:12859,600.00520.000.900.200.900.100.40
9M30141:128549.009.004.004.000.000.500.00
10M10211:1285280.0040.004.004.000.300.000.00
11M13211:1285350.00400.008.008.000.200.300.04
12F9211:512420.0010.0010.002.000.000.000.08
13M18281:128444.0010.0012.0012.000.020.000.00
14F24211:25651,000.0028.0016.002.000.500.050.20
15F4141:12846,400.001,560.0080.0080.000.300.000.10
16M72141:51255,600.003,000.00180.0040.000.900.100.30
17M12281:256634,900.006,400.001,000.0050.004.000.800.80
18M24141:2565254.00290.00130.0082.0022.000.900.03
19M36211:12851,320.00292.00108.00108.0012.000.400.60
20F7211:51261,300,000.005,040.00160.00160.0014.000.000.00
21F9211:1,0247200,000.0085,120.008,920.008,920.0076.002.000.40

F = female; M = male.

Parasite load was 1,000 parasites/mL at the time of clinical relapse, which was observed 135 days after the end of treatment.

Parasite load during treatment.

Table 1 shows the parasite loads during treatment. The mean and median for defervescence were 5.14 and 5 days, respectively. The treatment with meglumine antimoniate extended for 1 week after defervescence, with a range of treatment durations from 10 to 14 days, with a mean of 11.8 days (Table 1).

A rapid decrease in parasitemia was observed during treatment with meglumine antimoniate, and the decrease of parasite load in each succeeding day was statistically significant (P < 0.05). The mean load of parasitemia was 4,902 on day 3, 506 on day 7, and 6.39 on day 14 after the treatment.

On the 14th day after the treatment, the parasite load was less than 1 parasite/mL in 16 patients (76%), and the mean parasite load in 5 patients was 26 parasites/mL (Table 1).

Parasite load post-treatment.

On the 28th day after treatment, the parasite load was less than 1 parasite/mL in 20 patients (95%). One patient had a load of 2 parasites/mL. On the 90th day after treatment, the parasite load was less than 1 parasite/mL in all patients. The patient with 2 parasites/mL on the 28th day after treatment developed clinical relapse, and 135 days after the end of treatment, the respective parasite load was 1,000 parasites/mL.

Discussion

In this study, L. infantum kDNA parasite loads were determined by real-time PCR, because previous studies had shown that methods based on kDNA amplification were the most sensitive ones; this molecular target is present at ∼10,000 copies in a single parasite and more suitable for detecting cases of less than 1 parasite/mL in the blood.10,11,1416 Twenty-one VL patients were treated with meglumine antimoniate, 20 mg/kg per day intramuscularly, extending for 1 week after defervescence. This treatment method is routine in southern Iran.3,68

At the time of diagnosis, the parasite load ranging from 8 to 1,300,000 parasites/mL showed individual variations that were not correlated with age, duration of fever before treatment, or IFAT antibodies (Table 1). A wide range of loads was previously reported by Mary and others11 in immunocompetent patients (from 8 to 1,400,000 parasites/mL). This wide range of parasite loads may be explained by (1) the different parasite loads entered by sandfly bites, (2) the kDNA released from phagocytic cells to the blood in reticuloendothelial systems, and (3) the parasite replication controlled by host cellular immune responses.12,17,18

In healthy individuals living in the endemic areas, parasitemia has been reported to be 7.4–50.8% using different PCR methods. This variation can be explained by the various levels of sensitivity of the PCR methods.11,16,19,20 In this study, parasite loads of less than 1 parasite/mL were circulated in the peripheral bloods of a high percentage (55%) of individuals in the control group. This point can serve as a cutoff point for the diagnosis of VL patients, which was shown in the works by Mary and others.10,11 Therefore, this point could be a target point for a successful treatment of VL patients receiving antimonial treratment. Being of high sensitivity, quantitative real-time PCR seems to be a reliable method to detect asymptomatic infected individuals.

A dramatic rapid decline was observed during treatment with meglumine antimonite (Figure 1). On day 14, when treatment was discontinued in all patients, the load ranged between 0 and 76 parasites/mL. At that time, the kDNA of parasites was cleared from peripheral blood in the majority (76%) of patients. On day 28, 2 weeks after the discontinuation of treatment, it was cleared in almost all (95%) patients, and finally, on day 90, it was cleared from all patients. Fourteen months after the discontinuation of treatment, no relapses were detected in any of the patients, except one case. The clearance of parasites after discontinuation of meglumine antimonite treatment could be because of the potentiation of the host immune function by up-regulating interferon-γ (IFN-γ) and interleukin-12 (IL-12) synchronized with a decline in IL-10 and transforming growth factor-β (TGF-β) levels.2124 IL-12 helps the expansion of IFN-γ, which synergistically acts with tumor necrosis factor-β (TNF-β) to activate macrophages to kill leishmania parasites through the release of nitric oxide (NO).2527

Figure 1.
Figure 1.

Parasites' quantification in the peripheral blood of 21 patients with VL in the course of treatment with antimony and follow-ups in southern Iran. Dotted horizontal line indicates mean parasite level. The thick horizontal line indicates diagnostic cut off point.

Citation: The American Society of Tropical Medicine and Hygiene 88, 5; 10.4269/ajtmh.12-0440

In the current study, clinical relapse was observed in only one patient 135 days after the end of treatment (4.5%). This patient had a delay in the clearance of kDNA and was the only case that harbored Leishmania kDNA in the blood on the 28th day after the beginning of treatment. The same patient had less than 1 parasite/mL on day 90; therefore, we cannot be certain that the disease will not relapse, even if the parasite load decreases to less than 1 parasite/mL.

In conclusion, treatment with meglumine antimoniate in a short duration, extending for 1 week after defervescence, could be associated with a dramatic decrease of parasite loads, although complete clearance was not accomplished at the end of treatment. Ultimately, parasitemia was < 1 parasite/mL within all of the patients, with only one relapse (4.5%). Quantification of Leishmania load by real-time PCR can also serve as a reliable, rapid, and non-invasive method for VL diagnosis and a dependable index of monitoring the response to meglumine antimoniate in immunocompetent patients.

ACKNOWLEDGMENTS

We express our deep gratitude to H. Khajehei, PhD, for his cooperation in the linguistical editing of this manuscript. The present article was extracted from the thesis written by A.G.M. and financially supported by Shiraz University of Medical Sciences Grant No. 598-2.

  • 1.

    WHO, 2010. Control of the leishmaniasis. Proceedings of a meeting of the WHO Expert Committee on the Control of Leishmaniases, March 22–26, 2010, Geneva, Switzerland.

    • Search Google Scholar
    • Export Citation
  • 2.

    Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M; WHO Leishmaniasis Control Team, 2012. Leishmaniasis worldwide and global estimates of its incidence. PLoS ONE 7: e35671.

    • Search Google Scholar
    • Export Citation
  • 3.

    Alborzi A, Rasouli M, Shamsizadeh A, 2006. Leishmania tropica-isolated patient with visceral leishmaniasis in southern Iran. Am J Med Hyg 74: 306307.

    • Search Google Scholar
    • Export Citation
  • 4.

    Murray HW, Berman JD, Davies CR, Saravia NG, 2005. Advances in leishmaniasis. Lancet 366: 15611577.

  • 5.

    Gradoni L, Soteriadou K, Louzir H, Dakkak A, Toz SO, Jaffe C, Dedet JP, Campino L, Cañavate C, Dujardin JC, 2008. Drug regimens for visceral leishmaniasis in Mediterranean countries. Trop Med Int Health 13: 12721276.

    • Search Google Scholar
    • Export Citation
  • 6.

    Karimi A, Alborzi A, Mahmoodi MR, Rakhshani AH, Kadivar MR, 1998. Short course anti-Leishmania therapy in children with visceral leishmaniasis. Iran J Med Sci 23: 610.

    • Search Google Scholar
    • Export Citation
  • 7.

    Shahian M, Alborzi A, 2009. Effect of meglumine antimoniate on the pancreas during treatment of visceral leishmaniasis in children. Med Sci Monit 15: 290293.

    • Search Google Scholar
    • Export Citation
  • 8.

    Alborzi A, Rasouli M, Nademi Z, Kadivar MR, Pourabbas B, 2006. Evaluation of rK39 strip test for the diagnosis of visceral leishmaniasis in infants. East Mediterr Health J 12: 294299.

    • Search Google Scholar
    • Export Citation
  • 9.

    Aoun K, Chouihi E, Amri F, Ben Alaya N, Raies A, Mary C, Bouratbine A, 2009. Short report: contribution of quantitative real-time polymerase chain reaction to follow-up of visceral leishmaniasis patients treated with meglumine antimoniate. Am J Trop Med Hyg 81: 10041006.

    • Search Google Scholar
    • Export Citation
  • 10.

    Mary C, Faraut F, Lascombe L, Dumon H, 2004. Quantitifications of Leishmania infantum DNA by real-time PCR assay with high sensitivity. J Clin Microbiol 42: 52495255.

    • Search Google Scholar
    • Export Citation
  • 11.

    Mary C, Faraut F, Drogoul MP, Xeridat B, Schleinitz N, Cuisenier B, Dumon H, 2006. Reference values for Leishmania infantum parasitaemia in different clinical presentations: quantitative PCR for therapeutic monitoring and patient follow-up. Am J Trop Med Hyg 75: 858863.

    • Search Google Scholar
    • Export Citation
  • 12.

    Sudarshan M, Weirather JL, Wilson ME, Sundar S, 2011. Study of parasite kinetics with antileishmanial drugs using real-time quantitative PCR in Indian visceral leishmaniasis. J Antimicrob Chemother 66: 17511755.

    • Search Google Scholar
    • Export Citation
  • 13.

    Lachaud L, Dereure J, Chabbert E, Reynes J, Mauboussin JM, Oziol E, Dedet JP, Bastien P, 2000. Optimized PCR using patient blood samples for diagnosis and follow-up of visceral leishmaniasis, with special reference to AIDS patients. J Clin Microbiol 38: 236240.

    • Search Google Scholar
    • Export Citation
  • 14.

    Alborzi A, Pourabbas B, Shahian F, Mardaneh J, Pouladfar GR, Ziyaeyan M, 2008. Detection of Leishmania infantum kinetoplast DNA in the whole blood of asymptomatic individuals by PCR-ELISA and comparison with other infection markers in endemic areas, southern Iran. Am J Trop Med Hyg 79: 839842.

    • Search Google Scholar
    • Export Citation
  • 15.

    Smyth AJ, Ghosh A, Hassan MQ, Basu D, De Bruijn MH, Adhya S, Mallik KK, Barker DC, 1992. Rapid and sensitive detection of Leishmania kinetoplast DNA from spleen and blood samples of kala-azar patients. Parasitology 105: 183192.

    • Search Google Scholar
    • Export Citation
  • 16.

    le Fichoux Y, Quaranta JF, Aufeuvre JP, Lelievre A, Marty P, Suffia I, Rousseau D, Kubar J, 1999. Occurrence of Leishmania infantum parasitemia in asymptomatic blood donors living in an area of endemicity in southern France. J Clin Microbiol 37: 19531957.

    • Search Google Scholar
    • Export Citation
  • 17.

    Tupperwar N, Vineeth V, Rath S, dya T, 2008. Development of a real-time polymerase chain reaction assay for the quantification of Leishmania species and the monitoring of systemic distribution of the pathogen. Diagn Microbiol Infect Dis 61: 2330.

    • Search Google Scholar
    • Export Citation
  • 18.

    Mondal S, Bhattacharya P, Rahaman M, Ali N, Goswami RP, 2010. A curative immune profile one week after treatment of Indian kala-azar patients predicts success with a short-course liposomal amphotericin B therapy. PLoS Negl Trop Dis 4: e764.

    • Search Google Scholar
    • Export Citation
  • 19.

    van der Meide W, Guerra J, Schoone G, Farenhorst M, Coelho L, Faber W, Peekel I, Schallig H, 2008. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites. J Clin Microbiol 46: 7378.

    • Search Google Scholar
    • Export Citation
  • 20.

    Costa CH, Stewart JM, Gomes RB, Garcez LM, Ramos PK, Bozza M, Satoskar A, Dissanayake S, Santos RS, Silva MR, Shaw JJ, David JR, Maguire JH, 2002. Asymptomatic human carriers of Leishmania chagasi. Am J Trop Med Hyg 66: 334337.

    • Search Google Scholar
    • Export Citation
  • 21.

    Davis AJ, Murray HW, Handman E, 2004. Drugs against leishmaniasis: a synergy of technology and partnerships. Trends Parasitol 20: 7376.

  • 22.

    Ghalib HW, Whittle JA, Kubin M, Hashim FA, el-Hassan AM, Grabstein KH, Trinchieri G, Reed SG, 1995. IL-12 enhances Th1-type responses in human Leishmania donovani infections. J Immunol 154: 46234629.

    • Search Google Scholar
    • Export Citation
  • 23.

    Holaday BJ, Pompeu MM, Jeronimo S, Texeira MJ, Sousa A de A, Vasconcelos AW, Pearson RD, Abrams JS, Locksley RM, 1993. Potential role for interleukin-10 in the immunosuppression associated with kala azar. J Clin Invest 92: 26262632.

    • Search Google Scholar
    • Export Citation
  • 24.

    Saha S, Mondal S, Ravindran R, Bhowmick S, Modak D, Mallick S, Rahman M, Kar S, Goswami R, Guha SK, Pramanik N, Saha B, Ali N, 2007. IL-10 and TGF-beta-mediated susceptibility in kala-azar and post-kala-azar dermal leishmaniasis: the significance of amphotericin B in the control of Leishmania donovani infection in India. J Immunol 179: 55925603.

    • Search Google Scholar
    • Export Citation
  • 25.

    Engwerda CR, Murphy ML, Cotterell SE, Smelt SC, Kaye PM, 1998. Neutralization of IL-12 demonstrates the existence of discrete organ-specific phases in the control of Leishmania donovani. Eur J Immunol 28: 669680.

    • Search Google Scholar
    • Export Citation
  • 26.

    Theodos CM, Povinelli L, Molina R, Sherry B, Titus RG, 1991. Role of tumor necrosis factor in macrophage leishmanicidal activity in vitro and resistance to cutaneous leishmaniasis in vivo. Infect Immun 59: 28392842.

    • Search Google Scholar
    • Export Citation
  • 27.

    Haldar AK, Sen P, Roy S, 2011. Use of antimony in the treatment of leishmaniasis: current status and future directions. Mol Biol Int 1: 571242.

Author Notes

* Address correspondence to Abdolvahab Alborzi, Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran. E-mail: alborziiraj2004@yahoo.com

Authors' addresses: Bahman Pourabbas, Gholamreza Pouladfar, Zahra Rezaee, and Abdolvahab Alborzi, Professor Alborzi Clinical Microbiology Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, E-mails: bpourabbas@yahoo.com, pooladfar@yahoo.com, zahraa_rezaee@yahoo.com, and alborziiraj2004@yahoo.com. Abdolkarim Ghadimi Moghadam, Department of Pediatrics, Yasouj University of Medical Sciences, Yasouj, Iran, E-mail: dr_karim56@yahoo.com.

Save