Introduction
Schistosoma haematobium, the cause of urogenital schistosomiasis in humans, afflicts about 130 million people in 53 countries in Africa and the Middle East.1 We have previously described a polymerase chain reaction (PCR) assay based on amplification of the highly repeated DraI sequence of S. haematobium2 for sensitive detection of S. haematobium-infected intermediate snail hosts (Bulinus spp.) from early infection onward.3 We subsequently carried out a large-scale survey of snail infection by S. haematobium in coastal Kenya, and demonstrated a correspondence between snail infection rates and local human prevalence and average intensity of infection near the surveyed snail habitats.2,3 Those findings suggested the potential of molecular monitoring of snail infection rates to assess focal persistence of parasite transmission.
However, the DraI-PCR assay is group- and not species-specific. That is, it also detects animal schistosome parasite species related to S. haematobium, most of which circulate between ruminants and the same bulinid snail hosts of S. haematobium. Of these, Schistosoma bovis is most often sympatric with S. haematobium in endemic areas of Africa and the Middle-East.4,5 In these areas, a differential identification of snails infected with S. haematobium is required to accurately determine snail infection rates with the human schistosome.3,6 This required going deeper into the genome structure of S. haematobium, now completely sequenced,7 for selecting repeated sequences suitable for differential diagnosis.
Differentiation between snails infected with S. haematobium and those infected with Schistosoma bovis (or with other related schistosomes) has been successfully accomplished by PCR of an inter-repeat sequence located between the Sh110 sequence of S. haematobium and the schistosomal splice-leader sequence.8 Although this assay is fairly sensitive (10 pg sensitivity) and species-specific, it does not provide amplicon formation for S. bovis or Schistosoma mattheei DNA, which leaves a margin of uncertainty whenever positive species identification is required. A multiplex PCR using primers designed from the cytochrome oxidase subunit 1 (COX 1) has been recently developed at the Natural History Museum of London that enables discrimination of adults and larvae of S. haematobium and S. bovis. Differentiation, when using this PCR, was based on species-specific amplicons band size, with a detection sensitivity of 0.8 ng of genomic DNA.9 However, that assay was not tested for direct identification of infected snails. The COX1-based assay was further refined for use in real-time PCR, with higher detection sensitivity (pg range), but requiring a restriction enzyme fragment length analysis for S. haematobium-S. bovis species differentiation.10
The purpose of this study was to develop a simpler and more sensitive PCR assay that enables direct discrimination of S. haematobium from related animal schistosomes, notably the more widespread S. bovis and S. mattheei, by differential identification of electrophoretic bands of corresponding amplicons. The World Health Organization (WHO) is now considering applying schistosomiasis monitoring and diagnosis by loop-mediated isothermal amplification (LAMP). This is expected to facilitate large-scale screening of snail infection prevalence, whether prepatent or patent (i.e., shedding cercariae), in endemic areas where bulinids snails might be infected either with S. haematobium, veterinary Schistosoma species, or both.
Materials and Methods
Snails and parasites:
Laboratory snails.
Uninfected laboratory-bred snails (Bulinus nasutus) from snail culture in the Division of Vector Borne and Neglected Tropical Diseases (DVBNTD) laboratories in Msambweni, Kenya3 were used as negative controls in experiments involving PCR assays of infected field snails. Snails (Bulinus truncatus) obtained from the National Institute of Allergy and Infectious Diseases (NIAID) Schistosomiasis Resource Center, Bethesda, MD, were used in DNA spiking experiments testing PCR sensitivity in detecting genomic parasite DNA.
Field snails were collected and preserved in ethanol by DVBNTD team members based at the Msambweni laboratories on the southern coast of Kenya. Snail collection was carried out at Katchetu pond (3.94060°S; 39.54026°E; elevation 146 m), near the Mombasa-Nairobi highway in Katchetu village, Mazeras. This pond contains significant numbers of Bulinus globosus infected with schistosomes, as previously determined by DraI PCR (Hamburger and Abbasi, unpublished data). Goats, cattle, and humans frequent this pond.
Adult worms of S. haematobium, S. bovis, S. mattheei, S. margrebowiei, Schistosoma curassoni, and Schistosoma intercalatum preserved in ethanol were provided by Dr. David Johnston of the Natural History Museum, London.8 Preparation of DNA from the adult worms was carried out as previously described.8 For this purpose 2–3 pairs of male and female adult worms were kept in 300 μL lysis buffer (0.1M EDTA, pH 8.0, 0.1M Tris-HCl pH 7.5, 0.2M NaCl, 1% sodium dodecyl sulfate, 0.2% 2-mercaptoethanol, and 100 μg Proteinase K) at 65°C for 2 hours. The DNA was further purified by phenol/chloroform extraction followed by ethanol DNA precipitation.
Identification of specific repeated genomic sequences.
Repeated sequences were identified as previously described.8 Briefly, this involved preparing genomic libraries from S. haematobium and from five related animal schistosomes (S. bovis, S. mattheei, S. margrebowiei, S. curassoni, and S. intercalatum), initially selecting clones strongly hybridizing with genomic DNA of the homologous schistosome species and among them, selecting clones that did not hybridize with the DraI repeated sequence of S. haematobium. These clones underwent a third cycle of selection involving cross-hybridization with DNA from the other S. haematobium-related species and selecting those having hybridization signals only with S. haematobium DNA. A fourth level of selection took place after sequence analysis, with final selection of those exhibiting each of the following features: 1) they were not similar to the DraI repeat; 2) they were not similar to known sequences from other schistosomes or to schistosomal sequences presented in the GenBank; and 3) when aligned with other sequences of the same species, the sequences were found to be of high copy number. The nucleotide sequence analysis was carried out using the Dye Terminator Cycle DNA Sequencing Kit (Perkin Elmer, Wallington, UK), according to the instruction of the manufacturer.
Primer design.
Primers were designed by using the PRIME software version 9.0, of the Wisconsin Package (Genetic Computer Group [GCG], Madison, WI).
Extraction and purification of DNA from whole snails.
The DNA extraction from individual snail tissue was initiated by removing excess ethanol fixative by blotting on tissue paper. The snail bodies were removed from the shell using a fine needle, then macerated with wooden sticks in a 1.5 mL Eppendorf tube after adding 250 μL of snail lysis solution for a snail up to 5 mm, and 500 μL for larger snails. The lysis buffer consisted of 100 mM Tris base, 20 mM EDTA, 1.4 M NaCl, 0.2% β-mercaptoethanol, 2% hexadecyltrimethylammonium bromide and Proteinase K. Snails tissue were digested at 60°C for 2 hours followed by phenol extraction and ethanol precipitation. The extracted DNA was suspended in TE buffer and stored at −70°C until used.
PCR.
The PCR reactions were carried out in a volume of 25 μL using ready-mix PCR tubes, which contain Taq polymerase, buffer, and dNTPs (Syntezza, Jerusalem, Israel). Each reaction was performed by mixing 1 μL of the direct and reverse primers (20 pmoles each), and 18 μL of double distilled water (DNA/RNA free). A total quantity of the 20 μL was added to each ready-mix tube. This was followed by adding 5 μL of the test DNA (purified parasite genomic DNA or snail-extracted DNA). Primer sequences are listed in Table 1, and the thermocycler profile as previously described by Hamburger and others2 for S. haematobium DNA detection. Briefly, the thermal profile involved 5 minutes at 95°C followed by 35 cycles each of 1 minute at 95°C, 1 minute at 58°C followed by 1 minute at 72°C, and a final elongation step at 72°C for 10 minutes. Gel electrophoresis using 1.5% agarose then followed.
Sequence information of the designed primers based on the newly selected Sh73 and Sh77 repetitive sequences, for comparison, the DraI reverse primer previously used in Schistosoma haematobium DraI PCR amplification
| Sequence | Primer name | Primer sequence |
|---|---|---|
| Sh73 repeat | 73d | CCTTGGTCACGTGATTTTC |
| 73r | CTCCACCTTATGCCGGTC | |
| Sh77 repeat | 77d | CCTGGGTGTGCACGTCTTGTT |
| 77r | CTAAATGCCTAGCAACGGGGC | |
| DraI repeat | DraI reverse primer | TCACAACGATACGACCAAC |
Results
Newly selected repetitive genomic sequences of S. haematobium.
The DNA sequence analysis, which included multiple sequence alignments and the basic local alignment search tool (BLAST) comparison searches in GenBank, were applied to the repetitive sequences that emerged from our four-step selection process (see Materials and Methods) for clones from genomic libraries of the different Schistosoma spp. having terminal spined ova. Using this approach, it was possible to select two promising repetitive DNA sequences of 73 and 77 bp, subsequently named Sh73 and Sh77, respectively (Table 2). These fragments were not similar to any previously identified Schistosoma sequences in GenBank, but should be included within the now completely sequenced genome of S. haematobium.7 Based on these sequences, new primers (Table 1) were designed and developed for use in sensitivity and specificity testing in PCR assays.
DNA sequence analysis of the two newly selected repeated Schistosoma haematobium segments (Sh77 and Sh73)*
| Repeat name | DNA sequence |
|---|---|
| (Sh77) | 5′- CCTGGGTGTG CACGTCTTGT TTGTGCACTCCAAACCTCAA GGGTCACCGT GGTGGAGCCCCGTTGCTAGG CATTTAG-3′ |
| (Sh73) | 5′- CCTTGGTCAC GTGATTTTCA GTTTGCCCCACCCTGATGCT GGCTGCCCCA CCTCGACCGGCATAAGGTGG AGC-3′ |
The bold sequences represent the segments used to construct direct and reverse primers used in this project's polymerase chain reaction (PCR) amplification.
PCR assays employing Sh73 and Sh77 primers.
Primers designed from these newly selected repeated sequences were next used in PCR assays to amplify corresponding sequences of genomic DNA in S. haematobium, S. bovis, and S. mattheei.
Amplification was accomplished with primers of both sequences, yielding a banding pattern typical of tandemly arranged repeated sequences (results not shown). Although reactions employing these primers reached a sensitivity limit of 0.1 pg for amplifying S. haematobium genomic DNA, they also amplified low concentrations of DNA from S. bovis and S. mattheei. For the separate sets of Sh73 and Sh77 primers, the similar amplification patterns from the three Schistosoma species (results not shown) did not provide any useful discriminative test.
We also used mixed Sh73 and Sh77 primers in amplification experiments attempting to amplify inter-repeats between them. Amplification was accomplished in these experiments, but again, without a discriminative banding pattern (results not shown).
PCR assays employing combinations of primers for identifying inter-repeat sequences.
Subsequently, trials for inter-repeat amplification between the new Sh73 and Sh77 repeat sequences and the previously identified DraI repetitive sequence2 were undertaken, employing different primer combinations from the Sh73 and Sh77 sequences and from the DraI sequence. The primer combination of DraI reverse primer and Sh73 direct primer (73d) yielded a S. haematobium amplicon with a banding pattern that included a band at 200 bp, and another one of 350 bp (Figure 1A). A ladder of larger bands is also shown Figure 2. When using these primers for amplifying S. bovis DNA, the banding pattern obtained included a 150 bp band and another one of 300 bp. This banding pattern of S. bovis could be clearly differentiated from that of S. haematobium. However, PCR of S. mattheei DNA by the Sh73/DraI primers did not yield an amplicon (Figure 1A). The sensitivity of S. haematobium detection was 1 pg, whereas S. bovis detection was 10 pg (Figure 2).
Successful species discrimination using inter-repeat polymerase chain reaction (PCR) amplification with reverse primer from Schistosoma haematobium DraI repeat, and direct primer from newly selected Sh73 repeat (4297-73d, panel A), or direct primer from Sh77 repeat (4297-77d, panel B). The amplification assay at different concentrations of S. haematobium genomic DNA is shown (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg), Schistosoma bovis DNA (lane 6: 10 ng; lane 7: 1 ng), and Schistosoma mattheei DNA (lane 8: 10 ng; lane 9: 1 ng). Lanes 10–11: negative controls, M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and Schistosoma bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Successful species discrimination using inter-repeat polymerase chain reaction (PCR) amplification with reverse primer from Schistosoma haematobium DraI repeat, and direct primer from newly selected Sh73 repeat (4297-73d, panel A), or direct primer from Sh77 repeat (4297-77d, panel B). The amplification assay at different concentrations of S. haematobium genomic DNA is shown (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg), Schistosoma bovis DNA (lane 6: 10 ng; lane 7: 1 ng), and Schistosoma mattheei DNA (lane 8: 10 ng; lane 9: 1 ng). Lanes 10–11: negative controls, M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and Schistosoma bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Successful species discrimination using inter-repeat polymerase chain reaction (PCR) amplification with reverse primer from Schistosoma haematobium DraI repeat, and direct primer from newly selected Sh73 repeat (4297-73d, panel A), or direct primer from Sh77 repeat (4297-77d, panel B). The amplification assay at different concentrations of S. haematobium genomic DNA is shown (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg), Schistosoma bovis DNA (lane 6: 10 ng; lane 7: 1 ng), and Schistosoma mattheei DNA (lane 8: 10 ng; lane 9: 1 ng). Lanes 10–11: negative controls, M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and Schistosoma bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Comparison of polymerase chain reaction (PCR) amplicon banding patterns and sensitivity for Schistosoma haematobium and Schistosoma bovis genomic DNA using the new inter-repeat approach (primers 4297-73d). The amplification reactions shown here used different concentrations of S. haematobium genomic DNA (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg; 6: 0.1 pg), or S. bovis genomic DNA (lane 7: 10 ng; lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 0.01 ng; lane 11: 1 pg). Lane 13: No DNA (negative control) and M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and S. bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Comparison of polymerase chain reaction (PCR) amplicon banding patterns and sensitivity for Schistosoma haematobium and Schistosoma bovis genomic DNA using the new inter-repeat approach (primers 4297-73d). The amplification reactions shown here used different concentrations of S. haematobium genomic DNA (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg; 6: 0.1 pg), or S. bovis genomic DNA (lane 7: 10 ng; lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 0.01 ng; lane 11: 1 pg). Lane 13: No DNA (negative control) and M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and S. bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Comparison of polymerase chain reaction (PCR) amplicon banding patterns and sensitivity for Schistosoma haematobium and Schistosoma bovis genomic DNA using the new inter-repeat approach (primers 4297-73d). The amplification reactions shown here used different concentrations of S. haematobium genomic DNA (lane 1: 10 ng; lane 2: 1 ng; lane 3: 0.1 ng; lane 4: 0.01 ng; lane 5: 1 pg; 6: 0.1 pg), or S. bovis genomic DNA (lane 7: 10 ng; lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 0.01 ng; lane 11: 1 pg). Lane 13: No DNA (negative control) and M: DNA size marker. Arrows point to specific bands of S. haematobium (Sh) and S. bovis (Sb).
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
When using the DraI reverse primers and the Sh77 direct primer (77d), the banding patterns of the three schistosome species enabled species differentiation but with less sensitive detection (Figure 1B). The banding pattern of S. haematobium amplicon consisted of two bands (150 and 300 bp) plus a smear, with detection sensitivity of 1 ng. The banding pattern of S. bovis amplicon included one clear band (200 bp) plus a smear with a vague second band within. The banding pattern of S. mattheei amplicon in this case exhibited a single clear band of 150 bp, similar to the small first band of S. haematobium. The larger band of S. haematobium (300 bp) did not appear in the S. mattheei amplicon, and therefore the banding patterns of these species are discriminative. The sensitivity of detection in this case was 1 ng for S. haematobium and S. bovis, and perhaps also for S. mattheei, where a very weak band was shown with 1 ng DNA (Figure 1B).
Because the detection sensitivity for amplifying the inter-repeat when using Sh77-derived primer was too low for our purposes, and because the primers required yielded a heavy primer-dimer response, we did not further pursue this line of investigation.
Detection of S. haematobium and S. bovis in snail tissues.
DNA spiking experiments in laboratory-bred snails.
Extracts of laboratory bred B. nasutus were spiked with different concentrations of genomic DNA from S. haematobium, S. bovis, or a mixture thereof. The PCR was subsequently performed using a combination of Sh73-direct and DraI-reverse primers. The primers were found to retain their sensitivity in amplifying DNA from each of the two species, and even showed a third amplicon banding pattern for a mixed DNA from these two Schistosoma species (Figure 3).
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primers at different concentrations of Schistosoma haematobium genomic DNA (lane 1: 0.1 ng; pg). Lanes 8–11, represent PCR amplification of “mixed target DNA” composed of 1 pg S. haematobium genomic DNA with different added concentrations of Schistosoma bovis genomic DNA (lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 10 pg; lane 11: 1 pg). Lanes 12–15: show negative PCR amplification results for extracts from different uninfected Bulinus snails. Lane 16: No DNA (negative control), and M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primers at different concentrations of Schistosoma haematobium genomic DNA (lane 1: 0.1 ng; pg). Lanes 8–11, represent PCR amplification of “mixed target DNA” composed of 1 pg S. haematobium genomic DNA with different added concentrations of Schistosoma bovis genomic DNA (lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 10 pg; lane 11: 1 pg). Lanes 12–15: show negative PCR amplification results for extracts from different uninfected Bulinus snails. Lane 16: No DNA (negative control), and M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primers at different concentrations of Schistosoma haematobium genomic DNA (lane 1: 0.1 ng; pg). Lanes 8–11, represent PCR amplification of “mixed target DNA” composed of 1 pg S. haematobium genomic DNA with different added concentrations of Schistosoma bovis genomic DNA (lane 8: 1 ng; lane 9: 0.1 ng; lane 10: 10 pg; lane 11: 1 pg). Lanes 12–15: show negative PCR amplification results for extracts from different uninfected Bulinus snails. Lane 16: No DNA (negative control), and M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Field collected snails.
Examination of field snails from Katchetu pond (where snail infections by either S. haematobium or S. bovis was likely) by PCR employing the 73d and the DraI reverse primers indicated the presence of both Schistosoma species, including single infections and mixed infections within individual snails (Figure 4, Lanes 2, 3, and 6).
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer targeting different Bulinus snails (1–21) that were collected from a region co-endemic for Schistosoma haematobium and Schistosoma bovis. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer targeting different Bulinus snails (1–21) that were collected from a region co-endemic for Schistosoma haematobium and Schistosoma bovis. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer targeting different Bulinus snails (1–21) that were collected from a region co-endemic for Schistosoma haematobium and Schistosoma bovis. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
PCR assay with DNA from different schistosome species belonging to the S. haematobium group (species with terminal spined ova).
Although this study focuses on differentiating S. haematobium from S. bovis (the most prevalent and widespread schistosome of ruminants) we also examined its ability to differentiate S. haematobium from other non-bovis species belonging to the same group. The PCR amplification using the 73d/DraI reverse primer combination showed very different banding patterns for DNA from these other schistosomal species. Figure 5 summarizes these results and shows that if larger concentrations of DNA are used (10 ng), different banding patterns can be obtained with amplicons from S. curassoni, S. intercalatum, S. bovis, and S. haematobium. By contrast, S. margrebowiei and S. mattheei DNA did not yield detectable amplicons.
Discussion
Schistosoma haematobium-related animal parasites are present in many locations of S. haematobium transmission and can infect the same intermediate-host snail species as S. haematobium, thus interfering with accurate determination of infection rates of snails infected with the human schistosome.
A year-long snail survey by PCR employing primers designed from the DraI highly repeated sequence (which also amplifies DNA from Schistosoma spp. related to S. haematobium) was previously carried out in the Msambweni District, on the south coast of Kenya, where animal schistosomes are rare.3 The results indicated that DNA testing could serve as a useful marker of water contamination as part of control surveillance programs aiming to detect residual transmission.6 As a result, evaluation of the effect of elimination activities on snail infection rates in Zanzibar, where animal schistosomes of the S. haematobium group are absent, will be based on DraI-based PCR testing (Rollinson D, personal communication). However, in many other areas of sub-Saharan Africa and the Middle East, S. haematobium and its related schistosome species share habitat, and can infect the same host snail species.4,11,12 Of these species, S. bovis is the most widespread and prevalent,4,5 and thus has the widest potential to interfere in testing for S. haematobium infection.
Given the abundance and wide distribution of S. bovis, our present study focused on differentiating S. haematobium from S. bovis (Figures 1–4), although differentiation from other schistosomes was also addressed (Figures 1 and 5). Thus, S. mattheei could be differentiated from S. haematobium by lack of amplicon when amplification used the Sh73-direct and the DraI-reverse primers (Figure 1A), or from both S. haematobium and S. bovis by different electrophoretic patterns (Figure 1B) when employing the Sh77-direct and DraI-reverse primers. Differentiation of S. haematobium from S. curassoni, S. margrebowiei, and S. intercalatum was also possible by differential banding patterns (Figure 5). The possibility of detecting a mixed infection now enables studying various aspects of mixed infections (e.g., possibility of interference or enhancement, which may affect infectivity of the human schistosome).
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer for different species of terminal spined schistosomes. Lane 1: Schistosoma curassoni, 10 ng; lane 2: Schistosoma margrebowiei 10 ng; lane 3: Schistosoma intercalatum 10 ng; lane 4: S mattheei, 10 ng; lane 5: Schistosoma bovis, 10 ng; lane 6: Schistosoma haematobium 1 ng; lane 7: S. haematobium 0.1ng; lane 8: no DNA. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer for different species of terminal spined schistosomes. Lane 1: Schistosoma curassoni, 10 ng; lane 2: Schistosoma margrebowiei 10 ng; lane 3: Schistosoma intercalatum 10 ng; lane 4: S mattheei, 10 ng; lane 5: Schistosoma bovis, 10 ng; lane 6: Schistosoma haematobium 1 ng; lane 7: S. haematobium 0.1ng; lane 8: no DNA. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Inter-repeat polymerase chain reaction (PCR) amplification using DraI reverse primer and 73 direct primer for different species of terminal spined schistosomes. Lane 1: Schistosoma curassoni, 10 ng; lane 2: Schistosoma margrebowiei 10 ng; lane 3: Schistosoma intercalatum 10 ng; lane 4: S mattheei, 10 ng; lane 5: Schistosoma bovis, 10 ng; lane 6: Schistosoma haematobium 1 ng; lane 7: S. haematobium 0.1ng; lane 8: no DNA. M: DNA size marker.
Citation: The American Society of Tropical Medicine and Hygiene 87, 6; 10.4269/ajtmh.2012.12-0243
Detection sensitivity will affect practical aspects of using this test for screening infection rates. In this study, the detection sensitivity for S. haematobium was 1 pg as compared with 10 pg detection sensitivity for S. bovis when amplification used the 73d and the DraI reverse primers (Figure 1A and 2). This sensitivity enabled detection of mixed genomic DNA and of snail infections with both S. haematobium and S. bovis (Figures 3 and 4). Because the estimated DNA concentration of a single miracidium is about 1–2 ng/μL,9 it can be assumed that detection of snails infected with S. haematobium will be accomplished from very early prepatency and infection with S. bovis infection will be detected a very short time after infection, taking into consideration that less than a tenth of the extracted DNA is used for amplification. With the other related species yielding positive amplification signals at the 1 ng DNA level (Figures 1B and 5), it is expected that PCR signals of S. haematobium will be readily detected earlier in prepatency, whereas the signals of the other schistosomes may not be detected at all in the majority of the snails examined. This outcome should actually facilitate discrimination of S. haematobium from these other species of veterinary parasites for purposes of surveillance of human-to-snail parasite transmission.
The situation of a positive PCR signal with S. haematobium and no signal with the related schistosomes8 could also enable direct identification of S. haematobium in snails by more user-friendly LAMP assays.13,14 However, in cases where all suspected schistosome species yield amplicons (e.g., S. haematobium with S. bovis, Figures 1–2, and 5), adaptation of the assay to a LAMP format cannot provide direct species differentiation without using specific hybridization probes in an additional step (Abbasi and others, unpublished data). Another matter that can be addressed by species-specific PCR is a better definition of animal schistosome distribution, resolving questions of inter-species competition12 or reaffirming species identity, as in the case of S. curassoni.11 In addition, the present PCR assay differentiating S. haematobium from S. bovis, yielding positive amplification signals for both, may help clarify the matter of hybridization between the two, which has been tentatively reported as causing an emerging disease in humans.10
We hope this study will lead to the development of assay kits for discriminating S. haematobium from related schistosome species for use in field laboratories performing surveillance of transmission sites. Such assays are expected to be possible after further validation using larger numbers of field snails for large-scale monitoring of post-intervention residual transmission.
ACKNOWLEDGMENTS
We thank Fred Lewis of the NIH-NIAID Schistosomiasis Resource Center, Bethesda, MD, for providing the laboratory-bred Bulinus snails used in this study.
- 1.↑
WHO, 2002. Prevention and control of schistosomiasis and soil transmitted helminthiases: report of a WHO expert committee. World Health Organ Tech Rep Ser 912: 2–3.
- 2.↑
Hamburger J, He N, Abbasi I, Ramzy RM, Jourdane J, Ruppel A, 2001. Polymerase chain reaction assay based on highly repeated sequence of Schistosoma haematobium: a potential tool for monitoring schistosome infested water. Am J Trop Med Hyg 65: 907–911.
- 3.↑
Hamburger J, Hoffman O, Kariuki HC, Muchiri EM, Ouma JH, Koech DK, Sturrock RF, King CH, 2004. Large-scale, polymerase chain reaction-based surveillance of Schistosoma haematobium DNA in snails from transmission sites in coastal Kenya: a new tool for studying the dynamics of snail infection. Am J Trop Med Hyg 71: 765–773.
- 4.↑
Christensen NO, Mutani A, Frandsen F, 1983. A review of the biology and transmission ecology of African bovine species of the genus Schistosoma. Z Parasitenkd 69: 551–570.
- 5.↑
Mone H, Mowahid G, Monard S, 2000. The distribution of Schistosoma bovis Sonsino, 1876 in relation to intermediate host mollusc-parasite relationship. Adv Parasitol 44: 100–138.
- 6.↑
King CH, Sturrock RF, Kariuki HC, Hamburger J, 2006. Transmission control for schistosomiasis-why it matters now. Trends Parasitol 22: 575–582.
- 7.↑
Young ND, Jex AR, Li B, Liu S, Yang L, Xiong Z, Li Y, Cantacessi C, Hall RS, Xu X, Chen F, Wu X, Zerlotini A, Oliveira G, Hofmann A, Zhang G, Fang X, Kang Y, Campbell BE, Loukas A, Ranganathan S, Rollinson D, Rinaldi G, Brindley PJ, Yang H, Wang J, Wang J, Gasser RB, 2012. Whole-genome sequence of Schistosoma haematobium. Nat Genet 44: 221–225.
- 8.↑
Abbasi I, King CH, Sturrock RF, Kariuki HC, Muchiri E, Hamburger J, 2007. Differentiation of Schistosoma haematobium from related schistosomes by PCR amplifying an inter-repeat sequence. Am J Trop Med Hyg 76: 950–955.
- 9.↑
Webster BL, Rollinson D, Stothard JR, Huyse T, 2010. Rapid diagnostic multiplex PCR (RD-PCR) to discriminate Schistosoma haematobium and S. bovis. J Helminthol 84: 107–114.
- 10.↑
Huyse T, Webster BL, Geldof S, Stothard RJ, Diaw OT, Polman K, Rollinson D, 2009. Bidirectional introgressive hybridization between a cattle and human schistosome species. PLoS Pathog 5: e1000571.
- 11.↑
Jourdane J, Southgate VR, Pages JR, Durand P, Tchuem-Tchuente LA, 2001. Recent studies on Schistosoma intercalatum: taxonomic status, puzzling distribution, and transmission foci revised. Mem Inst Oswaldo Cruz 96: 45–48.
- 12.↑
Vercruysse J, Southgate VR, Rollinson D, DeClerq D, Sacko M, De Bont J, Mungomba LM, 1994. Studies on transmission and schistosome interactions in Senegal, Mali, and Zambia. Trop Geogr Med 46: 220–226.
- 13.↑
Xu J, Rong R, Zang HQ, Shi CJ, Zhu XQ, Xia CM, 2010. Sensitive and rapid detection of Schistosoma japonicum DNA by loop-mediated isothermal amplification (LAMP). Int J Parasitol 40: 327–331.
- 14.↑
Abbasi I, King CH, Muchiri EM, Hamburger J, 2010. Detection of Schistosoma mansoni and Schistosoma haematobium DNA by loop-mediated isothermal amplification: identification of infected snails from early prepatency. Am J Trop Med Hyg 83: 427–432.