• View in gallery

    Mosquito collection sites in Menghai County of Yunnan Province, China. The star indicates location of the mosquito collection sites and shading indicates location of the serum collection sites. Distance between Manguo Village and Manen Village is 20.2 km, distance between Manguo Village and Manxi Village is 52.2 km, and distance between Manen Village and Manxi Village is 69.0 km.

  • View in gallery

    Phylogenetic tree based on the envelope (E) gene of selected Japanese encephalitis virus strains, Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are indicated. Murray Valley encephalitis (MVE) E gene was used as an outgroup. Genotypes I–IV are indicated on the right.

  • View in gallery

    Phylogenetic tree based on the nonstructural protein 2 gene of Sindbis MX10 virus from Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are shown in the tree. SINV = Sindbis virus; CHIKV = chikungunya virus; ONNV = O'nyong-nyong virus; MAYV = Mayaro virus; SFV = Semliki forest virus; MIDV = Middelburg virus; GATV = Getah virus; RRV = Ross River virus; BHV = Barmah forest virus; VEEV = Venezuelan equine encephalitis virus; WEEV = western equine encephalomyelitis virus; EEEV = eastern equine encephalitis virus; P = paleoarctic/Ethiopian; O = Oriental/Australian. Genotypes (O and P) are indicated on the right.

  • View in gallery

    Electrophoretic migration patterns of genomic double-stranded RNA of orbivirus isolates from Yunnan Province, China, as analyzed by polyacrylamide gel electrophoresis. Lane 1, C6/36 cell control; lane 2, MZ93; lane 3, MZ43; lane 4, MZ65; lane 5, MZ30; lane 6, MZ25; lane 7, MZ20; lane 8, MZ11. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Phylogenetic tree based on 430 nucleotides of segment 6 of Yunan orbivirus isolates from Yunnan Province, China. Strains used in this analysis and their GenBank accession numbers are shown in the tree. YUOV = Yunnan orbivirus; BTV-8 = bluetongue virus 8; BTV-15 = bluetongue virus 15; EHDV = epizootic hemorrhagic disease virus; AHSV = African horse sickness virus; PHSV = Peruvian horse sickness virus; PCV = Palyam chuzan virus; StCRV = St. Croix River virus; CMPV = California mosquito pool virus.

  • View in gallery

    Electrophoretic migration patterns of genomic double-stranded RNA of seadornavirus isolate MX6 from Yunnan Province, China, as analyzed by polyacrylamide gel electrophoresis. Lane BAV, Beijing-75; lane KDV, YN0557; lane LNV, LNV-31. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Phylogenetic tree based on 1,085 nucleotides of segment 9 of novel Banna virus isolate MX6 from Yunnan Province, China. Strains used in this analysis and their GenBank accession numbers are shown in the tree. BAV = Banna virus; KDV = Kappdio virus; LNV = Liaoning virus.

  • View in gallery

    Phylogenetic tree based on 903 nucleotides of the nonstructural protein 1 gene of densovirus isolate from Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are shown in the tree. CppDNV = Culex pipiens pallens densovirus; AaeDNV = Aedes densonucleosis virus; AalDNV = Aedes albopictus densovirus; HeDNV = Haemagogus equinus densovirus; DsDNV = Diatraea saccharalis densovirus; GmDNV = Galleria mellonella densovirus; BmDNV = Bombyx mori densovirus; JcDNV = Junonia coenia densovirus; PfDNV = Periplaneta fuliginosa densovirus.

  • 1.

    Wang JL, Zhang HL, Sun XH, Fu SH, Feng Y, 2008. First isolation and identification of Sindbis virus from mosquito pools in Yunnan [in Chinese]. Zhongguo Ren Chu Gong Huan Bing Xue Bao 24: 16.

    • Search Google Scholar
    • Export Citation
  • 2.

    Zhang HL, Shi HF, Mi ZQ, 2000. Investigation of arboviruses in Jinghong City, Yunnan Province [in Chinese]. Zhongguo Di Fang Bing Tong Bao 15: 4044.

    • Search Google Scholar
    • Export Citation
  • 3.

    Li ZX, Zhang HL, Gong ZD, 1998. The characteristic of mosquitoes distribution and relation with the arboviruses in Jing Hong City in Yunnan Province [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Kong Zhi Za Zhi 9: 255257.

    • Search Google Scholar
    • Export Citation
  • 4.

    Zhang HL, Mi ZQ, Shi HF, 1999. Investigation of mosquitoes and arboviruses in Mengla County, Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 15: 337339.

    • Search Google Scholar
    • Export Citation
  • 5.

    Tao SJ, Zhang HL, Yang DR, 2003. Investigation of arboviruses in Lancang River down-stream area in Yunnan Province [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 17: 322326.

    • Search Google Scholar
    • Export Citation
  • 6.

    Zhang HL, Tao SJ, Zhang YZ, 2006. Study on arboviruses in Lancang River downstream area in Yunnan Province [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 20: 9598.

    • Search Google Scholar
    • Export Citation
  • 7.

    Sun XH, Fu SH, Gong ZD, Ge JQ, Meng WS, Feng Y, Wang J, Zhai Y, Wang H, Nasci R, Wang H, Tang Q, Liang G, 2009. Distribution of arboviruses and mosquitoes in northwestern Yunnan Province, China. Vector Borne Zoonotic Dis 9: 623630.

    • Search Google Scholar
    • Export Citation
  • 8.

    Zhang HL, Zi DY, Gong ZD, 1999. The epidemiological survey of dengue fever in Yunnan Province, China [in Chinese]. Di Fang Bing Tong Bao 14: 5054.

    • Search Google Scholar
    • Export Citation
  • 9.

    Wang JL, Zhang HL, Sun XH, Fu SH, Zhai YG, 2008. Identification and sequence analysis of NS1 and NS2a of two strains of dengue type-4 virus from mosquitoes in Yunnan Province [in Chinese]. Zhongguo Ren Shou Gong Huan Bing Xue Bao 24: 636640.

    • Search Google Scholar
    • Export Citation
  • 10.

    Zhang YZ, Zhang HL, Mi ZQ, 1998. Investigation of mosquitoes and arboviruses in Hekou City Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 14: 3738.

    • Search Google Scholar
    • Export Citation
  • 11.

    Huang WL, Zhang HL, Hou ZL, 2001. Investigation on arboviruses antibodies of patients with fever in Xishuangbanna, Yunnan Province [in Chinese]. Di Fang Bing Tong Bao 16: 2930.

    • Search Google Scholar
    • Export Citation
  • 12.

    Zhang HL, Zhang YZ, Yang WH, Min ZQ, 2004. Investigation on the antibodies against arboviruses in sera of human being and animal in the lower reaches area of Lancang river in Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 20: 207211.

    • Search Google Scholar
    • Export Citation
  • 13.

    Baolin L, Houyong W, 2003. Classification and identification of important medical insects of China. Henan Science and Technology Publishing House. 10: 167.

    • Search Google Scholar
    • Export Citation
  • 14.

    Bryant JE, Crabtree MB, Nam VS, Yen NT, Duc HM, Miller BR, 2005. Isolation of arboviruses from mosquitoes collected in northern Vietnam. Am J Trop Med Hyg 73: 470473.

    • Search Google Scholar
    • Export Citation
  • 15.

    Zhai YG, Lv XJ, Sun XH, Fu SH, Gong ZD, Fen Y, Tong SX, Wang ZX, Tang Q, Attoui H, Liang GD, 2008. Isolation and characterization of the full coding sequence of a novel densovirus from the mosquito Culex pipiens pallens. J Gen Virol 89: 195199.

    • Search Google Scholar
    • Export Citation
  • 16.

    Li WJ, Wang JL, Li MH, Fu SH, Wang HY, Wang ZY, Jiang SY, Wang XW, Guo P, Zhao SC, Shi Y, Lu NN, Nasci RS, Tang Q, Liang GD, 2010. Mosquitoes and mosquito-borne arboviruses in the Qinghai-Tibet Plateau focused on the Qinghai area, China. Am J Trop Med Hyg 82: 705711.

    • Search Google Scholar
    • Export Citation
  • 17.

    Liang GD, He Y, Chen BQ, Zhao ZJ, Huang YJ, 1993. Preparation of arbovirus group-specific PcAb and their use to identify newly isolated viruses [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 7: 374376.

    • Search Google Scholar
    • Export Citation
  • 18.

    Ronald WJ, Jerri R, Yasutaka H, 2003. Identification of parental origin of cognate dsRNA genome segment(s) of rotavirus reassortants by constant denaturant gel electrophoresis. J Clin Virol 26: 347354.

    • Search Google Scholar
    • Export Citation
  • 19.

    Pfeffer M, Probster B, Kinney RM, 1997. Genus-specific detection of alphavirus by a semi-nested reverse transcription-polymerase chain reaction. Am J Trop Med Hyg 57: 709718.

    • Search Google Scholar
    • Export Citation
  • 20.

    Kuno G, 1998. Universal diagnostic RT-PCR for arbovirus. J Virol Methods 72: 2741.

  • 21.

    Xu LH, Liang GD, 2002. Advances in research of coltivirus [in Chinese]. Zhongguo Bing Du Xue 17: 385391.

  • 22.

    Kumar S, Tamura K, Nei M, 1994. MEGA: molecular evolutionary genetics analysis software for microcomputers. Comput Appl Biosci 10: 189191.

  • 23.

    Attoui H, Mohd Jaafar F, Belhouchet M, Aldrovandi N, Tao S, Chen B, Liang G, Tesh RB, de Micco O, de Lamballerie X, 2005. Yunnan Orbivirus, a new Orbivirus species isolated from Culex tritaeniorhynchus mosquitoes in China. J Gen Virol 86: 34093417.

    • Search Google Scholar
    • Export Citation
  • 24.

    Tytti M, Satu K, Antti V, Olli V, 2008. Diagnostics of Pogosta disease: antigenic properties and evaluation of Sindbis virus IgM and IgG enzyme immunoassays. Vector Borne Zoonotic Dis 8: 303313.

    • Search Google Scholar
    • Export Citation
  • 25.

    Zheng FY, Lin GZ, Qiu CQ, Zhou JZ, Cao XA, Gong XW, 2009. Development and application of G1-ELISA for detection of antibodies against bovine ephemeral fever virus. Res Vet Sci 87: 211212.

    • Search Google Scholar
    • Export Citation
  • 26.

    Wang HY, Takasaki T, Fu SH, Sun XH, Zhang HL, Wang ZX, Hao ZY, Zhang JK, Tang Q, Kotaki A, Tajima S, Liang XF, Yang WZ, Kurane I, Liang GD, 2007. Molecular epidemiological analysis of Japanese encephalitis virus in China. J Gen Virol 88: 885894.

    • Search Google Scholar
    • Export Citation
  • 27.

    Leanne MS, Michael DL, Michael P, Robert JC, 1999. Geographic distribution and evolution of Sindbis virus in Australia. J Gen Virol 80: 739748.

  • 28.

    Zhou GL, Liang GD, Li L, 1999. Complete nucleotide sequence of the nonstructural gene of Alphavirus YN87448 strain isolated in China and its relationship to other Sindbis viruses [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 13: 314320.

    • Search Google Scholar
    • Export Citation
  • 29.

    Zhou GL, Liang GD, Li L, Fu SH, Li FS, 1999. The complete nucleotide sequence of the structural region gene of the alphavirus YN87448 strain isolated in China and its relationship to other Sindbis virus [in Chinese]. Zhongguo Bing Du Xue 15: 205211.

    • Search Google Scholar
    • Export Citation
  • 30.

    Liang GD, Li L, Zhou GL, Fu SH, Li QP, Li FS, He HH, Jin Q, He Y, Chen BQ, Hou YD, 2000. Isolation and complete nucleotide sequence of a Chinese Sindbis-like virus. J Gen Virol 81: 13471351.

    • Search Google Scholar
    • Export Citation
  • 31.

    Dong XS, Zhou HN, Gong ZD, Dong LM, Wang XS, 2005. Studies on the regional areas of mosquitoes in Yunnan [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 16: 3436.

    • Search Google Scholar
    • Export Citation
  • 32.

    Li XL, Gao BH, Li CZ, 2006. Analysis of baseline survey of malaria prevalent status in Menghai county,Yunnan Province. Yi Xue Dong Wu Fang Zhi 22: 567570.

    • Search Google Scholar
    • Export Citation
  • 33.

    Zhang HL, Zi DY, Shi HF, 1999. Investigation on mosquitoes and mosquito-borne-virus in Menghai County of Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 15: 285288.

    • Search Google Scholar
    • Export Citation
  • 34.

    Zhang HL, Zi DY, Gong ZD, 2000 Host and vector of Japanese encephalitis virus in Yunnan Province, China [in Chinese]. Zhongguoi Yi Fang Shou Yi Xue Bao 22:8183.

    • Search Google Scholar
    • Export Citation
  • 35.

    Mi ZQ, Zhang HL, Zhang YZ, Zhang YZ, 2005. Epidemiologic survey and serological investigation of Japanese encephalitis virus in Xishuangbanna and Simao region of Yunnan Province [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 16: 470471.

    • Search Google Scholar
    • Export Citation
  • 36.

    Zhang HL, 2004. The advance on arbovirus in Yunnan [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 15: 410414.

  • 37.

    Wang XJ, Zhang YP, Zhang RZ, 2004. Analysis on epidemic trend of Japanese B encephalitis during 1998–2002 [in Chinese]. Zhongguo Yimiao He Mianyi 10: 215217.

    • Search Google Scholar
    • Export Citation
  • 38.

    Wang PY, Zhou HN, Zhang ZX, Wu C, Gu YA, 2008. Investigation on the current situation of Japanese encephalitis transmission and control in Yunnan, China [in Chinese]. Zhongguo Bingyuan Shengwu Xue Zaizhi 3: 1922.

    • Search Google Scholar
    • Export Citation
  • 39.

    Brummer-Korvenkontio M, Vapalahti O, Kuusisto P, Saikku P, Manni T, Koskela P, Nygren T, Brummer-Korvenkontio H, Vaheri A, 2002. Epidemiology of Sindbis virus infections in Finland 1981–96: possible factors explaining a peculiar disease pattern. Epidemiol Infect 129: 335345.

    • Search Google Scholar
    • Export Citation
  • 40.

    Satu K, Tytti M, Antti V, Olli V, 2004. Causative agent of Pogosta disease isolated from blood and skin lesions. Emerg Infect Dis 10: 889894.

  • 41.

    Lvov DK, Vladimirtseva EA, Butenko AM, Karabatsos N, Trent DW, Calisher CH, 1998. Identity of Karelian fever and Ockelbo viruses determined by serum dilution-plaque reduction neutralization tests and oligonucleotide mapping. Am J Trop Med Hyg 39: 607610.

    • Search Google Scholar
    • Export Citation
  • 42.

    Malherbe H, Strickland-Cholmley M, Jackson AL, 1963. Sindbis virus infection in man. Report of a case with recovery of virus from skin lesions. S Afr Med J 37: 547552.

    • Search Google Scholar
    • Export Citation
  • 43.

    Rentier-Delrue F, Young NA, 1980. Genomic divergence among Sindbis virus strains. Virol. 106: 5970.

  • 44.

    Wang JL, Huang WL, Zhang HL, 2000. Seroepidemiological investigation on Sindbis virus in Yunnan Province [in Chinese]. Di Fang Bing Tong Bao 15: 3942.

    • Search Google Scholar
    • Export Citation
  • 45.

    Cowled C, Melville L, Weir R, Walsh S, Hyatt A, Van Driel R, Davis S, Gubala A, Boyle D, 2007. Genetic and epidemiological characterization of Middle Point orbivirus, a novel virus isolated from sentinel cattle in northern Australia. J Gen Virol 88: 34133422.

    • Search Google Scholar
    • Export Citation
  • 46.

    Attoui H, Mohd Jaafar F, de Micco P, de Lamballerie X, 2005. Coltiviruses and seadornaviruses in North America, Europe, and Asia. Emerg Infect Dis 11: 16731679.

    • Search Google Scholar
    • Export Citation
  • 47.

    Xu PT, Wang YM, Zuo JM, 1990. New orbivirus isolated from patients with encephalitis or with unknow fever in Yunnan Province [in Chinese]. Bing Du Xue Bao 6: 2733.

    • Search Google Scholar
    • Export Citation
  • 48.

    Xu PT, Wang YM, Zhao ZJ, 1988. Isolation and identification of two orbivirus from Yunnan Province [in Chinese]. Bing Du Xue Bao 4: 218222.

  • 49.

    Tao SJ, Wang HQ, Cao YX, Yang DR, Liu QZ, 2002. Prearation and storage of coltivirus antigen and its application in detection of coltivirus antibodies in serum from patients [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 16: 232235.

    • Search Google Scholar
    • Export Citation
  • 50.

    Chen BQ, Tao SJ, 1996. Arbovirus survey in China in recent ten years. Chin Med J (Engl) 109: 1315.

  • 51.

    O'Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76: 20672074.

    • Search Google Scholar
    • Export Citation

 

 

 

 

Distribution of Mosquitoes and Mosquito-Borne Arboviruses in Yunnan Province near the China–Myanmar–Laos Border

View More View Less
  • State Key Laboratory for Infectious Disease Prevention and Control, Institute for Viral Disease Control and Prevention, China Centers for Disease Control, Beijing, People's Republic of China; Yunnan Institute of Endemic Disease Control and Prevention, Dali, Yunnan, People's Republic of China

Economic development and increased tourism in the southern region of Yunnan Province in China, adjacent to several countries in Southeast Asia, has increased the likelihood of import and export of vectors and vector-borne diseases. We report the results of surveillance of mosquitoes and mosquito-borne arboviruses along the border of China–Myanmar–Laos in 2005 and 2006, and information associating several arboviruses with infections and possibly disease in local human populations. Seventeen mosquito species representing four genera were obtained, and 14 strains of mosquito-borne viruses representing six viruses in five genera were isolated from Culex tritaeniorhynchus. In addition, IgM against Japanese encephalitis virus, Sindbis virus, Yunnan orbivirus and novel Banna virus was detected in acute-phase serum samples obtained from hospitalized patients with fever and encephalitis near the areas where the viruses were isolated. This investigation suggests that Japanese encephalitis virus, Sindbis virus, and lesser-known arboviruses circulate and may be infecting humans in the China–Myanmar–Laos border region.

Introduction

Yunnan Province, located in southwestern China, has a 4,061 km border with Myanmar, Laos, and Vietnam. This area is characterized by low elevation and a tropical to southern subtropical climate with high temperatures, abundant rain, and high humidity. A great diversity of hosts and mosquito vectors are found in Yunnan Province, which support transmission of numerous arboviruses.17 Surveillance conducted in the area showed that Japanese encephalitis (JE) and dengue (DEN) fever cases have been frequently reported in recent years.5,810 In addition, fevers and encephalitis of unknown etiology are commonly reported in this area during the JE and DEN epidemic seasons.11

Previous investigations in this area also indicated that antibodies against multiple arboviruses, including Japanese encephalitis virus (JEV), dengue virus, chikungunya virus, Sindbis virus (SINV), and Batai virus (BATV), were detected in serum samples of local residents and animals.11,12 However, no investigations of arboviruses and related infections in humans have been conducted specifically in the border of southern Yunnan Province.

Therefore, to describe the vectors and arboviruses in this area and provide a scientific basis for further investigations of fever and encephalitis, we collected mosquito samples in the border area in 2005 and 2006 and identified the mosquito species and the viruses in those specimens. In addition, we collected serum samples from hospitalized patients with fever and encephalitis in the Xishuangbanna region of the border between China, Myanmar, and Laos.

Materials and Methods

Mosquito collection.

Mosquito samples were collected during July 2005 and July 2006 in residential regions of three villages of Manxi (Daluo Town) (21°42′16.01²N, 100°02′50.09²E, altitude = 676 meters); Manguo (Menghun Town) (21°48′05.53²N, 100°23′28.11²E, altitude = 1,203 meters); and Manen (Mengzhe Town) (21°56′38.35²N, 100°21′50.75²E, altitude = 1,195 meters) in Menghai County, Xishuangbanna, in southern Yunnan Province (Figure 1).

Figure 1.
Figure 1.

Mosquito collection sites in Menghai County of Yunnan Province, China. The star indicates location of the mosquito collection sites and shading indicates location of the serum collection sites. Distance between Manguo Village and Manen Village is 20.2 km, distance between Manguo Village and Manxi Village is 52.2 km, and distance between Manen Village and Manxi Village is 69.0 km.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Mosquitoes were collected from dwellings and from chicken and bovine shelters at night by using light traps (12 V, 300 mA; Wuhan Lucky Star Environmental Protection Tech Co., Ltd., Hubei, China). Traps were used from 9:00 pm to 5:00 am the next morning, which spanned the period from sunset to sunrise. Captured mosquitoes were killed by freezing at –20°C for at least 40 minutes. Specimens were placed on a chill plate, and species were identified by using morphologic characteristics.13 Mosquitoes were combined into pools of ≤ 100 specimens and stored in liquid nitrogen until virus testing was conducted.

Virus isolation.

Pools of mosquitoes were homogenized in a sterile glass grinder and centrifuged as reported.14,15 To isolate the virus, 150 μL of supernatant from each pool was inoculated onto monolayers of BHK-21 cells (2 × 105 cells/mL) and C6/36 cells (1 × 106 cells/mL) in a 1-mL tube. After seven days, the 150-μL supernatant from the previous passage was inoculated onto the new passage in BHK-21 cells or C6/36 cells as above. The cells were maintained at 37°C or 28°C, respectively, and examined daily for cytopathic effect (CPE) from day 1 through day 7 post-inoculation. A specimen was regarded as a positive isolate if it caused CPE in three successive cell passages. Infected cell supernatants were harvested and stored at –80°C until further identification.

Identification of virus.

Immunofluorescent assay.

Cell cultures that exhibited 75% CPE were treated with trypsin and collected by centrifugation at 1,000 rpm for 10 minutes. They were washed three times with 0.01 M phosphate-buffered saline (PBS). After re-suspension in PBS, aliquots of the cell suspension were placed on onto multi-well slides, dried at room temperature, and fixed in acetone for 15 minutes at 4°C. The fixed slides were probed with a panel of mouse antisera against alphaviruses and flaviviruses and incubated at 37°C for 30 minutes as described.16,17 The antisera were prepared in our laboratory and included broadly reactive immune ascites against alphaviruses, specific antisera to SINV, Getah virus, Mayaro virus, chikungunya virus, and Simliki Forest virus, and antisera against the flaviviruses JEV, dengue virus, and West Nile virus. Antisera were diluted 1:50 in PBS before use. After subsequent rinses in PBS and sterile water, the slides were probed with the secondary rabbit anti-mouse monoclonal fluorescein isothiocyanate conjugate (Sigma, St. Louis, MO) at 37°C for 30 minutes before visualization with a fluorescent microscopy. Positive and negative controls of immune ascites against alphaviruses were SINV (YN87448) and JEV (P3), respectively. Positive and negative controls of immune ascites against flavivirus antisera were JEV (P3) and SINV (YN87448), respectively.

Polyacrylamide gel electrophoresis, RNA extraction, cDNA synthesis, reverse transcription–polymerase chain reaction, and sequence analysis.

RNA extraction and polyacrylamide gel electrophoresis were performed as described.18 Briefly, double-stranded RNA was extracted from approximately 400 μL of cell suspension with phenol/chloroform. Each RNA sample was mixed with sample buffer and subjected to electrophoresis at room temperature on a standard discontinuous 7%, 10%, or 15% acrylamide (acrylamide/bisacrylamide 29:1; Bio-Rad Laboratories, Hercules, CA) slab gel (18 × 16 × 0.075 cm) (Hoefer Pharmacia Biotech Inc., San Francisco, CA) with a 3.5% acrylamide stacking gel in Tris-glycine buffer (25 mM Tris, 192 mM glycine, pH 8.3) (Bio-Rad Laboratories). After electrophoresis, virus double-stranded RNAs were visualized by staining with silver nitrate.

Viral RNA was extracted by using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA), and cDNA was synthesized by using Ready-To-Go You-Prime First Strand Beads (Amersham Pharmacia Biotech, Piscataway, NJ) according to the manufacturer's procedure. Samples were tested by polymerase chain reaction (PCR) with flavivirus-specific primers,19 alphavirus-specific primers20 and primers to detect the SINV nonstructural protein 2 (NS2) gene, the JEV envelope (E) gene, the 12th segment of Banna virus (BAV),21 the VP7 gene of Yunnan orbivirus (YUOV),22 and the densovirus (DNV) partial NS1 gene15 (Table 1).

Table 1

Primers used to identify and sequence viruses in this study*

PrimersPrimers sequence (5′→3′)Size, basepairs (reference)
Alphavirus
M2wYAGAGCDTTTTCGCAYSTRGCHW430(17)
cMw3ACATRAANKGNGTNGTRTCRAANCCDAYCC
SINV NS2 gene primers
SINV-NS2F (1761–1780)CACCGACCTCTGTACTGAAG1,438
SINV-NS2R (3198–3179)GGGAACAACTCACTCCACTG
Flavivirus
Fu1TACCACATGATGGGAAAGAGAGAGAA310(18)
cFD3GTGTCCCAGCCGGCGGTGTCATCAGC
JEV E gene primers
JEV-EF (955–974)TGYTGGTCGCTCCGGCTTA1,526
JEV-ER (2481–2461)GATGTCAATGGCACATCCAGT
BAV S12 gene primers
12-854-SAAATTGATAGYGYTTGCGTAAGAG845(19)
12-B2-RGTTCTAAATTGGATACGGCGTGC
YUOV VP7 gene primers
YUOVS7FAGCATTCGGTACGCAGTATCTCG470(20)
YUOVS7RGCCGAGCCGATCATGTCACGTGT
DNV NS1 gene primers
DNVNS1F (298–317)GGTGATTCTGGTTCTGACTCTTG1,035(13)
DNVNS1R (1332–1354)GARRGVCARAGYGAGWDATG

SINV = Sindbis virus; NS = nonstructural; JEV = Japanese encephalitis virus; E = envelope; BAV = Bannan virus; YUOV = Yunnan orbivirus; DNV = densovirus

The reverse transcription–PCR conditions were 1 hour at 37°C, 5 min at 94°C, and 35 cycles of amplification (30 seconds at 94°C, 30 seconds at 55°C, and 2 minutes at 72°C), and final extension at 72°C for 10 minutes. Amplified products were separated by electrophoresis on 1% agarose gels in 1× TAE buffer (40 mM Tris-acetate, 1 mM EDTA, pH 8.0), visualized by staining with ethidium bromide, and viewing under ultraviolet light. The PCR products were purified by using the TaKaRa DNA fragment Purification Kit Version 2.0 (TaKaRa, Dalian, China), and sequenced by the Beijing Genome Institute, Beijing, China.

Initial sequence assembly and analysis were conducted by using the ATGC software package Version 4.0 (GENETYX Corp, Tokyo, Japan). Homology and alignment analysis was carried out by using the Clustal X (Version 1.83) and MegAlign (DNASTAR, Madison, USA). MEGA 3.123 was used for phylogenetic analysis and tree construction was based on the neighbor-joining assay. The bootstrap value (the number of replications) was 1,000.

Serologic investigation.

Sample collection.

Serum specimens from patients with acute fever or encephalitis were obtained from hospitals and clinics in the Xishuangbanna region near locations where mosquito samples were obtained. Specimens were sent to the Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention for testing.

Serologic testing.

IgM against JEV was detected by using the JEV-IgM enzyme-linked immunosorbent assay (ELISA) Kit (Beixi, Shanghai, China) as described in the manufacturer's protocol. Serum samples were not tested for IgG against JEV because JE was an important disease in the China–Myanmar–Laos border region in previous surveillance, and serum specimens were obtained from patients with acute fever or encephalitis within one week. After identification of the viruses isolated from mosquitoes in the area, ELISA detection of IgM or IgG was performed on the specimens that were negative for IgM against JEV as described.24

Briefly, isolate MX10 (SINV) was inoculated into BHK-21 cells and isolates MZ93 (YUOV), MZ65 (novel Yunnan orbivirus [NYUOV]) and MX6 novel BAV virus (NBAV) were propagated in C6/36 cells. Culture supernatants were obtained when they showed 75% CPE and centrifuged for 15 minutes at 5,000 rpm at 4°C. The supernatant was filtered through a 0.22-μm filter, and the filtrate was concentrated by using a 100k Millipore tube (Millipore Corporation Billerica, MA). The virus was inactivated at 56°C for 30 minutes and stored at –70°C.

Human serum samples were tested for virus-specific IgM and IgG against SINV, NBAV, YUOV, or NYUOV by using the MX10, MZ93,MZ65 and MX6 antigens produced in cell culture.24 Box titration was performed to determine the optimal antigen dilution (1:400 in bicarbonate buffer, pH 9.6). After incubation with 100 μL of antigen dilution overnight at 4°C, 96-well plates were washed five times with PBS, 0.05% Tween 20 (PBS-T) and blocked with 200 μL of 5% skim milk in PBS for 2 hours at 37°C. Diluted sera (1:200 in PBS-T and 5% skim milk) were incubated for 60 minutes at 37°C on antigen-coated wells, washed five times with PBS-T, and incubated for 60 minutes at 37°C with 100 μL of horseradish peroxidase–labeled rabbit-anti-human IgM (diluted 1:50,000) or IgG (diluted 1:4,000) (Sigma), and washed. The substrate reaction with 100 μL of A and B solutions (Sigma) at room temperature for 10 minutes was stopped by addition of 4N H2SO4. Optical density was measured at 450 nm. A serum sample was considered seropositive if the positive/negative value was > 2.1.25

Serum samples that had had high antibody neutralization titers were used as positive control serum samples for the ELISA. Mixtures of 20 serum specimens obtained from healthly persons of difference ages were use as controls. All specimens were negative for IgM and IgG against viruses isolated from the China–Myanmar–Laos border region by ELISA and neutralization tests.

Results

Mosquito collection.

A total of 7,952 mosquitoes were obtained in July 2005, and 6,771 mosquitoes were obtained in July 2006 (Table 2). Mosquitoes obtained in the three sites represented 17 species belonging to four genera (Culex, Linnaeus; Anopheles, Meigen; Armigeres, Theobald; and Lutzia, Theobald). In Manxi, 11 species were collected, among which Cx. tritaeniorhynchus Giles was the dominant species (63.2% in 2005 and 61.1% in 2006), followed by Ar. subalbatus (Coquillett) (12.1% in 2005 and 12.6% in 2006) and Cx. bitaeniorhynchus Giles (9.9% in 2005 and 11.4% in 2006). The other eight species accounted for less than 9% of the total. In Manen, 11 species were collected. Culex tritaeniorhynchus was the dominant species (90.4% in 2005 and 91.7% in 2006) and Anopheles sinensis Wiedemann was the next highest (4.7% in 2005 and 4.3% in 2006). The other nine species accounted for less than 3% of the total. Only six mosquito species were obtained in Manguo and the dominant species was An. sinensis (66.5% in 2005 and 68.1% in 2006). Culex tritaeniorhynchus comprised 26.4% in 2005 and 25.2% in 2006, and the remaining species accounted for less than 7% of the total obtained in Manguo.

Table 2

Mosquito abundance in border areas in Yunnan, China–Myanmar–Laos, July 2005 and July 2006*

GenusSpeciesManxiManguoManenTotal
20052006200520062005200620052006
No%No.%No.%No.%No.%No.%No.%No.%
CulexCx. tritaeniorhynchus1,36463.247461.191226.446325.23,43490.42,49091.75,71060.73,42764.38
Cx.whitmorei231.0760.7000050.12< 0.1280.280.1
Cx. pseudovishnui00000000320.8180.6320.3180.3
Cx. fuscocephala231.070.950.130.1812.1501.81091.1601.1
Cx. gelidus00000000110.260.2110.160.1
Cx. nigropunctatus00003< 0.11< 0.100003< 0.11< 0.1
Cx. pallidothorax50.220.2000000005< 0.12< 0.1
Cx. bitaeniorhynchus2159.98911.4000000002152.2891.6
LutziaLu. fuscanus1< 0.110.1000000001< 0.11< 0.1
AnophelesAn. sinensis1647.6638.12,29466.51,25068.11814.71174.32,63928.02,05038.5
An. vagus0000000080.240.18< 0.14< 0.1
An. peditaeniatus532.4212.72256.51146.2310.8190.73093.21542.9
An. maculatus000000002< 0.11< 0.12< 0.11< 0.1
An. tessellafus000080.230.170.140.1150.170.1
An. annularis361.6111.400000000360.3110.2
An. barbirostris110.530.300000000110.13< 0.1
ArmigeresAr. subalbatus26112.19812.6000050.130.12662.81011.9
Total2,1567753,4471,8343,7972,7149,4005,323

Values are no. mosquito adults collected and percentage of the total collection for each species within the location and year.

Virus isolation and identification.

A total of 14 strains were isolated from the 152 pools of mosquitoes obtained in three sites during July 2005 and July 2006. Isolate MX10 showed a CPE in BHK21 cells; 11 isolates (MX6, MZ11, MZ13, MZ20, MZ25, MZ30, MZ31, MZ43, MZ65, MH76, and MZ93) showed a CPE only in C6/36 cells, and the remaining 2 isolates (MZ24 and MZ66) showed a CPE in BHK-21 cells and C6/36 cells. All 14 strains of viruses were isolated from Cx. tritaeniorhynchus (Table 3).

Table 3

Virus isolates from Culex tritaeniorhynchus mosquitoes collected in the Manxi, Manen, and Manguo areas of Yunnan Province, China*

IsolateLocationHabitatCell lineYear of isolationVirus
MX6ManxiCattle penC6/362005BAV
MX10ManxiCattle penBHK-21, C6/362005SINV
MZ11ManenCattle penC6/362005YUOV
MZ13ManenCattle penC6/362005DNV
MZ20ManenCattle penC6/362005YUOV
MZ24ManenCattle penBHK-21, C6/362005JEV
MZ25ManenCattle penC6/362005YUOV
MZ30ManenCattle penC6/362005YUOV
MZ31ManenCattle penC6/362005DNV
MZ43ManenCattle penC6/362005YUOV
MZ65ManenCattle penC6/362006NYUOV
MZ66ManenHuman houseBHK-21, C6/362006JEV
MH76ManguoCattle penC6/362006DNV
MZ93ManenCattle penC6/362006YUOV

BAV = Banna virus; SINV = Sindbis virus; YOUV = Yunnan orbivirus; DNV = Densovirus; JEV = Japanese encephalitis virus; NYUOV = Novel Yunnan orbivirus.

Japanese encephalitis virus.

Virus isolates MZ24 and MZ66 reacted with antibody against JEV by immunofluorescent assay (IFA), suggesting that these isolates were JEV or a related flavivirus. Polymerase chain reaction and sequence analysis showed that that these 2 isolates contained gene sequences indicative of JEV. The E gene sequence of MZ24 and MZ66 was amplified and produced a 1,500-nucleotide segment that belonged to a JE virus genotype similar to JEV YN03-A151 (percentage nucleotide identities for MZ24 and MZ66 were 99.1%) and YN04-25-3 (percentage nucleotide identities for MZ24 and MZ66 were 97.1%) strains isolated in China26 and showed the closest relationship with the JEV-P3 (percentage nucleotide identities for MZ24 and MZ66 were 98.9%) strain isolated in 1949, which also belonged to genotype III (Figure 2).

Figure 2.
Figure 2.

Phylogenetic tree based on the envelope (E) gene of selected Japanese encephalitis virus strains, Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are indicated. Murray Valley encephalitis (MVE) E gene was used as an outgroup. Genotypes I–IV are indicated on the right.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Sindbis virus.

The IFA results demonstrated that MX10 had a strong reaction with antibodies against alphavirus and SINV and a weak reaction with antibodies against chikungunya, Mayaro, and Getah viruses. Identification of MX10 as an alphavirus was confirmed by PCR and sequence analysis, which showed that the sequence was highly homologous to the prototype of Oriental/Australian genotype SINV MRE16 (90.8%). Phylogenetic analysis of the MX10 NS2 gene sequence (1,000 nucleotides) (Figure 3) showed that MX10 can be placed within a cluster formed with other SINV sequences. Two relatively independent branches, including the Paleoarctic/Ethiopian genotype represented by SAAR86 virus and Oriental/Australian genotype represented by MRE-16 virus isolated in Malaysia, have been described.27 MX10 was in the Oriental/Australian branch, and the other isolates of SINV isolated in China (YN87448 virus from the border area of China/Laos in 198728,29 and XJ-160 virus from Xinjiang Uighur Autonomous Region of Western Province in China30) belong to the Paleoarctic/Ethiopian genotype.

Figure 3.
Figure 3.

Phylogenetic tree based on the nonstructural protein 2 gene of Sindbis MX10 virus from Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are shown in the tree. SINV = Sindbis virus; CHIKV = chikungunya virus; ONNV = O'nyong-nyong virus; MAYV = Mayaro virus; SFV = Semliki forest virus; MIDV = Middelburg virus; GATV = Getah virus; RRV = Ross River virus; BHV = Barmah forest virus; VEEV = Venezuelan equine encephalitis virus; WEEV = western equine encephalomyelitis virus; EEEV = eastern equine encephalitis virus; P = paleoarctic/Ethiopian; O = Oriental/Australian. Genotypes (O and P) are indicated on the right.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Orbivirus.

Eleven isolates that caused a CPE in C6/36 cells but did not react with alphavirus and flavivirus antisera by IFA were identified by polyacrylamide gel electrophoresis. Results for seven strains (MZ11, MZ20, MZ30, MZ25, MZ43, MZ65, and MZ93) showed that all the virus isolates were 10-segment double-stranded RNA viruses (Figure 4). The migration pattern of bands for MZ65 distinguished it from the other six strains. Six strains (MZ11, MZ20, MZ30, MZ25, MZ43, and MZ93) were amplified by using primers derived from segment 7 of YUOV, but MZ65 failed to amplify. The phylogenetic tree based on the six new isolates and other orbiviruses demonstrated a close genetic relationship between the six new isolates and the YUOV 77-2 strain,1 nucleotide sequence identity of > 93%, and a distant relationship with the other seven orbiviruses analyzed, indicating that the six new isolates from the China–Myanmar–Laos border area were strains of YUOV (Figure 5).

Figure 4.
Figure 4.

Electrophoretic migration patterns of genomic double-stranded RNA of orbivirus isolates from Yunnan Province, China, as analyzed by polyacrylamide gel electrophoresis. Lane 1, C6/36 cell control; lane 2, MZ93; lane 3, MZ43; lane 4, MZ65; lane 5, MZ30; lane 6, MZ25; lane 7, MZ20; lane 8, MZ11. This figure appears in color at www.ajtmh.org.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Figure 5.
Figure 5.

Phylogenetic tree based on 430 nucleotides of segment 6 of Yunan orbivirus isolates from Yunnan Province, China. Strains used in this analysis and their GenBank accession numbers are shown in the tree. YUOV = Yunnan orbivirus; BTV-8 = bluetongue virus 8; BTV-15 = bluetongue virus 15; EHDV = epizootic hemorrhagic disease virus; AHSV = African horse sickness virus; PHSV = Peruvian horse sickness virus; PCV = Palyam chuzan virus; StCRV = St. Croix River virus; CMPV = California mosquito pool virus.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Strain MZ65 is also a 10-segment double-stranded RNA virus, but was distinguished from the other six orbivirus strains by the band migration pattern, and the observation that MZ65 virus was not amplified with the primers designed for the segment 7 of YUOV.21 Further sequence analysis showed that segment 10 had a low level of nucleotide sequence identity with YUOV (54.4%) and formed relatively independent branches in a phylogenetic tree based on the MZ65 and other orbiviruses, suggesting that MZ65 virus is considerably different from YUOV. This virus is referred to as NYUOV.

Banna virus.

Results of polyacrylamide gel electrophoresis demonstrated that the MX6 strain was a 12-segmented double-stranded RNA with migrating bands different from those found in Liaoning virus and Kadipiro virus, but with a pattern more similar to BAV (6-4-2) (Figure 6). Further sequence analysis showed that nucleotide sequence identity of MX6 segment 9 to BAV segment 9, Liaoning virus segment 11 and Kappdio virus segment 10 was 45%, 35.9%, and 37.8%, respectively, and the phylogenetic tree based on the MX6 virus and BAV, Laioning virus, and Kappdio virus further demonstrated that MX6 was placed within a branch formed with the BAV sequences (Figure 7), suggesting that MX6 virus may be an NBAV.

Figure 6.
Figure 6.

Electrophoretic migration patterns of genomic double-stranded RNA of seadornavirus isolate MX6 from Yunnan Province, China, as analyzed by polyacrylamide gel electrophoresis. Lane BAV, Beijing-75; lane KDV, YN0557; lane LNV, LNV-31. This figure appears in color at www.ajtmh.org.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Figure 7.
Figure 7.

Phylogenetic tree based on 1,085 nucleotides of segment 9 of novel Banna virus isolate MX6 from Yunnan Province, China. Strains used in this analysis and their GenBank accession numbers are shown in the tree. BAV = Banna virus; KDV = Kappdio virus; LNV = Liaoning virus.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Densovirus.

Primers specific for densovirus were used to amplify the NS1 gene of MZ13, MZ31, and MH76 isolates to produce 1,000-nucleotide products. Phylogenetic analysis using the sequence of the NS1 gene from 14 densoviruses demonstrated that MZ13, MZ31, and MH76 strains are located in the same cluster as Cx. pipiens pallens densovirus (CppDNV)-XJ058, CppDNV-YN05217, CppDNV-GZWN1 and CppDNV-JZ-16 (Figure 8), with a nucleotide sequence identity > 99%. These results suggest that MZ13, MZ31, and MH76 are densoviruses and have close genetic relationships with other strains isolated from Cx. tritaeniorhynchus in Yunnan and Shanxi provinces.15

Figure 8.
Figure 8.

Phylogenetic tree based on 903 nucleotides of the nonstructural protein 1 gene of densovirus isolate from Yunnan Province, China. Isolates used in this analysis and their GenBank accession numbers are shown in the tree. CppDNV = Culex pipiens pallens densovirus; AaeDNV = Aedes densonucleosis virus; AalDNV = Aedes albopictus densovirus; HeDNV = Haemagogus equinus densovirus; DsDNV = Diatraea saccharalis densovirus; GmDNV = Galleria mellonella densovirus; BmDNV = Bombyx mori densovirus; JcDNV = Junonia coenia densovirus; PfDNV = Periplaneta fuliginosa densovirus.

Citation: The American Society of Tropical Medicine and Hygiene 84, 5; 10.4269/ajtmh.2011.10-0294

Viral antibodies in human serum samples.

The objective of the serum survey in this study was to understand infections with arboviruses, except for JEV. IgM against JEV was first detected in serum samples from patients with acute fever or encephalitis. Detection by ELISA of IgM or IgG against viruses isolated from mosquitoes in the area was then performed on specimens that were negative for IgM against JEV. The results show that of the 184 serum samples obtained from hospitalized patients, 26.6% (49 of 184) were positive for IgM against JEV (Table 4). Of these patients, 19.6% (20 of 102) had fever and 35.3% (29 of /82) had encephalitis. The results suggest that JEV infection persists in the region. Of the remaining 135 serum samples that were negative for antibodies against JEV, antibodies against SINV (0.7% IgM, 12.6% IgG), YUOV (0.7% IgM, 5.9% IgG), NYUOV (0% IgM, 3.7% IgG), and NBAV (0.7% IgM, 5.2% IgG) were detected, demonstrating past and potentially some recent infections with these viruses and suggesting the potential that they may have been the disease etiology. Unfortunately, convalescent-phase serum samples were not available and tests to confirm acute infection associated with the symptoms could not be conducted.

Table 4

Percentage of patients with fever and encephalitis from the Xishuangbanna border region, China, with antibodies against selected arboviruses in acute phase serum samples*

SymptomJEVSINV (MX10)YUOV (MZ93)NYUOV (MZ65)BAV (MX6)
IgMIgMIgGIgMIgGIgMIgGIgMIgG
Fever19.6% (20/102)1.2% (1/82)12.2% (10/82)1.2% (1/82)7.3% (6/82)0 (0/82)6.1% (5/82)1.2% (1/82)7.3% (6/82)
Encephalitis35.3% (29/82)0 (0/53)13.2% (7/53)0 (0/53)3.7% (2/53)0 (0/53)0 (0/53)0 (0/53)1.8% (1/53)
Total26.6% (49/184)0.7% (1/135)12.6% (17/135)0.7% (1/135)5.9% (8/135)0% (0/135)3.7 (5/135)0.7% (1/135)5.2% (7/135)

JEV = Japanese encephalitis virus; SINV = Sindbis virus; YOUV = Yunnan orbivirus; NYUOV = Novel Yunnan orbivirus; BAV = Banna virus. Antibodies against JEV were detected by using a commercial assay. Antibodies against other viruses were detected by using virus strain in parentheses as antigen in enzyme-linked immunosorbent assays as described in text.

Only serum samples negative for IgM against JEV were tested for antibodies against other agents.

Discussion

The topography of the China–Myanmar–Laos border in this area is complex and has numerous mountains, hills, plateaus, and rivers. Characteristic of this area are structures called bazi (small basins) by local residents. These habitats are surrounded by high mountains and are relatively isolated. Although many small basins are only several kilometers apart, their altitude, temperature, and humidity differ and they support distinct biotas.31 The three collection sites in this study were located in different basins with different altitudes (600 meters for Manxi, 1,000 meters for Manen, and 1,400 meters for Manguo). The mosquito species distribution varied though the sites, which are only 7–30 km apart. In this investigation, we found 17 mosquito species belonging to four genera. Anopheles sinensis was the dominant mosquito species in Manguo. In contrast, Cx. tritaeniorhynchus was the dominant mosquito species in Manxi and Manen. In addition, a previous epidemiologic investigation demonstrated that malaria transmitted by An. sinensis was prevalent in Manguo.32 Cases of JE were reported in Manxi and Manen.33 These results are consistent with our observations of the dominant mosquito species in each area.

The local climate characteristics are suitable for survival and reproduction of mosquitoes and conducive to the sustained transmission of arboviruses. Previous studies have demonstrated that the distribution, seasonal peak, and virus infection rate of JEV in Cx. tritaeniorhynchus were coincident with the peak of JE in humans.34 In our investigation, all other virus strains isolated were also from Cx. tritaeniorhynchus, suggesting that this species is an important vector of SINV, YUOV, and BAV in the border area.

Japanese encephalitis is a mosquito-borne arboviral disease that is prevalent in Asia and Southeast Asia. The annual case rate of JE in this region of China is 5.25/100,000,35 which is approximately twice as high as the average case rate in the rest of Yunnan Province (3.04/100 000).36 In contrast, the JE incidence for China as a whole is 2–3/100 000.37 Our virus isolation results demonstrate that Cx. tritaeniorhynchus remains the dominant JEV vector in the region, The prevalence rate of 26.6% for IgM against JEV in serum samples obtained from hospitalized patients suggests that JE remains a public health problem. Although we cannot exclude the possibility that the IgM against JE we detected was from prior vaccination rather than from infection with wild-type JEV, it is unlikely that the IgM was vaccine induced because this area is rural, mass vaccination programs have not been conducted there, and the rate of vaccination is estimated to be < 10% in this area.38

Sindbis virus has a broad distribution and causes fever in humans and symptoms that include arthralgia, rash, and malaise. This virus has caused outbreaks in Finland,39,40 Sweden,41 and South Africa.42 It is divided into Paleoarctic/Ethiopian and Oriental/Australian genetic types.43 The SINV strain MX10 isolated from mosquitoes in this study is in the Oriental/Australian branch, and the other strains of SINV previously isolated in China (YN87448 virus from the border area of China/Laos in 198728,29 and XJ-160 virus from Xinjiang Uighur Autonomous Region of Western Province in China)30 belong to the Paleoarctic/Ethiopian genotype. This finding indicates that two genotypes of SINV are present in China and that both occur in the border area of Yunnan Province. A previous serosurvey in Yunnan showed that prevalence of IgG against SINV was high in serum of patients with fever and in healthy people, and that antibody to SINV could be found in bats and rats in the region.36,44 Our results are similar and support this observation, reinforcing the speculation that SINV or a closely related alphavirus may be causing human disease in the area.

Yunnan orbivirus is a 10-segmented double-stranded RNA virus that was first isolated from Cx. tritaeniorhynchus obtained in China.21 The six strains of YUOV in this study were also isolated from Cx. tritaeniorhynchus, suggesting that YUOV persists in this area and that Cx. tritaeniorhynchus is likely the main vector. The MPOV isolate, which is similar to YUOV, was isolated from different cattle herds during 1994–2006, including 112 isolates in 2006.45 The mosquitoes from which YUOV was isolated in our study were obtained in a bovine shelter, suggesting that cows may be the likely host YUOV in this region. Detection of IgM and IgG against YUOV in serum of one patient suggests that human infections with this virus may occur. Our results also suggest that MZ65 virus is considerably different from YUOV and that detection of antibodies against this strain in local patients suggests an association between MZ65 and human potential infections that should be investigated.

The MX6 strain was a 12-segmented double-stranded RNA with a pattern more similar to BAV (6-4-2). Sequence analysis showed that the nucleotide sequence identity of MX6 with BAV was 45%. The MX6 strain was placed within a branch formed with BAV, suggesting that MX6 virus may be a novel BAV variant and needs further study. Banna virus, considered a potential pathogen by some investigators,46 was first isolated in China from patients with encephalitis in Xishuangbanna Autonomous Prefecture, Yunnan Province in 1987.47 Subsequently, 10 strains of BAV were isolated from patients with fever and encephalitis and from mosquitoes, pigs, and cows.48,49 In addition, Chen and Tao50 found evidence of four-fold changes in neutralization antibody titer against BAV in acute-phase and convalescent-phase serum samples from the fever and encephalitis patients, suggesting that BAV was the etiologic agent of their illnesses. Our detection of IgM and IgG against BAV and NBAV support speculation that BAV may be a pathogen in the region. In this study, IgM and IgG against NBAV were detected in serum samples of patients with fever and encephalitis, indicating that NBAV may be causing infections in patients with fever and encephalitis in the border area.

Densoviruses are classified as members of the genera Densovirus, Iteravirus, Brevidensovirus, and Pefudensovirus (subfamily Densovirinae) within the family Parvoviridae.15 Identification of DNVs in various mosquito cells and wild mosquitoes suggests that the brevidensoviruses have a widespread distribution.51 Densovirus was isolated from several species of mosquitoes, including Cx. pipiens pallens, Cx. pipiens quinquefasciatus, Cx. tritaeniorhynchus, and An. sinensis in China.15 The three strains of DNV in this study were also isolated from Cx. tritaeniorhynchus, indicating that these insect viruses may be extensively distributed in China. Because densovirus is not known to cause human infection, testing of the patients for antibodies against densovirus was not conducted in this study.

Our study confirms previous results suggesting that there are well-known arboviruses (e.g., JEV) and several relatively unappreciated arboviruses circulating and possibly causing human infections within a relatively small area of the China–Myanmar–Laos border region. It is essential that monitoring of arboviruses other than JEV should be increased in these areas to gain a better understanding of their contribution to human health in the southern Yunnan Province area.

ACKNOWLEDGMENT:

We thank Roger Nasci for comments on the manuscript.

  • 1.

    Wang JL, Zhang HL, Sun XH, Fu SH, Feng Y, 2008. First isolation and identification of Sindbis virus from mosquito pools in Yunnan [in Chinese]. Zhongguo Ren Chu Gong Huan Bing Xue Bao 24: 16.

    • Search Google Scholar
    • Export Citation
  • 2.

    Zhang HL, Shi HF, Mi ZQ, 2000. Investigation of arboviruses in Jinghong City, Yunnan Province [in Chinese]. Zhongguo Di Fang Bing Tong Bao 15: 4044.

    • Search Google Scholar
    • Export Citation
  • 3.

    Li ZX, Zhang HL, Gong ZD, 1998. The characteristic of mosquitoes distribution and relation with the arboviruses in Jing Hong City in Yunnan Province [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Kong Zhi Za Zhi 9: 255257.

    • Search Google Scholar
    • Export Citation
  • 4.

    Zhang HL, Mi ZQ, Shi HF, 1999. Investigation of mosquitoes and arboviruses in Mengla County, Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 15: 337339.

    • Search Google Scholar
    • Export Citation
  • 5.

    Tao SJ, Zhang HL, Yang DR, 2003. Investigation of arboviruses in Lancang River down-stream area in Yunnan Province [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 17: 322326.

    • Search Google Scholar
    • Export Citation
  • 6.

    Zhang HL, Tao SJ, Zhang YZ, 2006. Study on arboviruses in Lancang River downstream area in Yunnan Province [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 20: 9598.

    • Search Google Scholar
    • Export Citation
  • 7.

    Sun XH, Fu SH, Gong ZD, Ge JQ, Meng WS, Feng Y, Wang J, Zhai Y, Wang H, Nasci R, Wang H, Tang Q, Liang G, 2009. Distribution of arboviruses and mosquitoes in northwestern Yunnan Province, China. Vector Borne Zoonotic Dis 9: 623630.

    • Search Google Scholar
    • Export Citation
  • 8.

    Zhang HL, Zi DY, Gong ZD, 1999. The epidemiological survey of dengue fever in Yunnan Province, China [in Chinese]. Di Fang Bing Tong Bao 14: 5054.

    • Search Google Scholar
    • Export Citation
  • 9.

    Wang JL, Zhang HL, Sun XH, Fu SH, Zhai YG, 2008. Identification and sequence analysis of NS1 and NS2a of two strains of dengue type-4 virus from mosquitoes in Yunnan Province [in Chinese]. Zhongguo Ren Shou Gong Huan Bing Xue Bao 24: 636640.

    • Search Google Scholar
    • Export Citation
  • 10.

    Zhang YZ, Zhang HL, Mi ZQ, 1998. Investigation of mosquitoes and arboviruses in Hekou City Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 14: 3738.

    • Search Google Scholar
    • Export Citation
  • 11.

    Huang WL, Zhang HL, Hou ZL, 2001. Investigation on arboviruses antibodies of patients with fever in Xishuangbanna, Yunnan Province [in Chinese]. Di Fang Bing Tong Bao 16: 2930.

    • Search Google Scholar
    • Export Citation
  • 12.

    Zhang HL, Zhang YZ, Yang WH, Min ZQ, 2004. Investigation on the antibodies against arboviruses in sera of human being and animal in the lower reaches area of Lancang river in Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 20: 207211.

    • Search Google Scholar
    • Export Citation
  • 13.

    Baolin L, Houyong W, 2003. Classification and identification of important medical insects of China. Henan Science and Technology Publishing House. 10: 167.

    • Search Google Scholar
    • Export Citation
  • 14.

    Bryant JE, Crabtree MB, Nam VS, Yen NT, Duc HM, Miller BR, 2005. Isolation of arboviruses from mosquitoes collected in northern Vietnam. Am J Trop Med Hyg 73: 470473.

    • Search Google Scholar
    • Export Citation
  • 15.

    Zhai YG, Lv XJ, Sun XH, Fu SH, Gong ZD, Fen Y, Tong SX, Wang ZX, Tang Q, Attoui H, Liang GD, 2008. Isolation and characterization of the full coding sequence of a novel densovirus from the mosquito Culex pipiens pallens. J Gen Virol 89: 195199.

    • Search Google Scholar
    • Export Citation
  • 16.

    Li WJ, Wang JL, Li MH, Fu SH, Wang HY, Wang ZY, Jiang SY, Wang XW, Guo P, Zhao SC, Shi Y, Lu NN, Nasci RS, Tang Q, Liang GD, 2010. Mosquitoes and mosquito-borne arboviruses in the Qinghai-Tibet Plateau focused on the Qinghai area, China. Am J Trop Med Hyg 82: 705711.

    • Search Google Scholar
    • Export Citation
  • 17.

    Liang GD, He Y, Chen BQ, Zhao ZJ, Huang YJ, 1993. Preparation of arbovirus group-specific PcAb and their use to identify newly isolated viruses [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 7: 374376.

    • Search Google Scholar
    • Export Citation
  • 18.

    Ronald WJ, Jerri R, Yasutaka H, 2003. Identification of parental origin of cognate dsRNA genome segment(s) of rotavirus reassortants by constant denaturant gel electrophoresis. J Clin Virol 26: 347354.

    • Search Google Scholar
    • Export Citation
  • 19.

    Pfeffer M, Probster B, Kinney RM, 1997. Genus-specific detection of alphavirus by a semi-nested reverse transcription-polymerase chain reaction. Am J Trop Med Hyg 57: 709718.

    • Search Google Scholar
    • Export Citation
  • 20.

    Kuno G, 1998. Universal diagnostic RT-PCR for arbovirus. J Virol Methods 72: 2741.

  • 21.

    Xu LH, Liang GD, 2002. Advances in research of coltivirus [in Chinese]. Zhongguo Bing Du Xue 17: 385391.

  • 22.

    Kumar S, Tamura K, Nei M, 1994. MEGA: molecular evolutionary genetics analysis software for microcomputers. Comput Appl Biosci 10: 189191.

  • 23.

    Attoui H, Mohd Jaafar F, Belhouchet M, Aldrovandi N, Tao S, Chen B, Liang G, Tesh RB, de Micco O, de Lamballerie X, 2005. Yunnan Orbivirus, a new Orbivirus species isolated from Culex tritaeniorhynchus mosquitoes in China. J Gen Virol 86: 34093417.

    • Search Google Scholar
    • Export Citation
  • 24.

    Tytti M, Satu K, Antti V, Olli V, 2008. Diagnostics of Pogosta disease: antigenic properties and evaluation of Sindbis virus IgM and IgG enzyme immunoassays. Vector Borne Zoonotic Dis 8: 303313.

    • Search Google Scholar
    • Export Citation
  • 25.

    Zheng FY, Lin GZ, Qiu CQ, Zhou JZ, Cao XA, Gong XW, 2009. Development and application of G1-ELISA for detection of antibodies against bovine ephemeral fever virus. Res Vet Sci 87: 211212.

    • Search Google Scholar
    • Export Citation
  • 26.

    Wang HY, Takasaki T, Fu SH, Sun XH, Zhang HL, Wang ZX, Hao ZY, Zhang JK, Tang Q, Kotaki A, Tajima S, Liang XF, Yang WZ, Kurane I, Liang GD, 2007. Molecular epidemiological analysis of Japanese encephalitis virus in China. J Gen Virol 88: 885894.

    • Search Google Scholar
    • Export Citation
  • 27.

    Leanne MS, Michael DL, Michael P, Robert JC, 1999. Geographic distribution and evolution of Sindbis virus in Australia. J Gen Virol 80: 739748.

  • 28.

    Zhou GL, Liang GD, Li L, 1999. Complete nucleotide sequence of the nonstructural gene of Alphavirus YN87448 strain isolated in China and its relationship to other Sindbis viruses [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 13: 314320.

    • Search Google Scholar
    • Export Citation
  • 29.

    Zhou GL, Liang GD, Li L, Fu SH, Li FS, 1999. The complete nucleotide sequence of the structural region gene of the alphavirus YN87448 strain isolated in China and its relationship to other Sindbis virus [in Chinese]. Zhongguo Bing Du Xue 15: 205211.

    • Search Google Scholar
    • Export Citation
  • 30.

    Liang GD, Li L, Zhou GL, Fu SH, Li QP, Li FS, He HH, Jin Q, He Y, Chen BQ, Hou YD, 2000. Isolation and complete nucleotide sequence of a Chinese Sindbis-like virus. J Gen Virol 81: 13471351.

    • Search Google Scholar
    • Export Citation
  • 31.

    Dong XS, Zhou HN, Gong ZD, Dong LM, Wang XS, 2005. Studies on the regional areas of mosquitoes in Yunnan [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 16: 3436.

    • Search Google Scholar
    • Export Citation
  • 32.

    Li XL, Gao BH, Li CZ, 2006. Analysis of baseline survey of malaria prevalent status in Menghai county,Yunnan Province. Yi Xue Dong Wu Fang Zhi 22: 567570.

    • Search Google Scholar
    • Export Citation
  • 33.

    Zhang HL, Zi DY, Shi HF, 1999. Investigation on mosquitoes and mosquito-borne-virus in Menghai County of Yunnan Province [in Chinese]. Yi Xue Dong Wu Fang Zhi 15: 285288.

    • Search Google Scholar
    • Export Citation
  • 34.

    Zhang HL, Zi DY, Gong ZD, 2000 Host and vector of Japanese encephalitis virus in Yunnan Province, China [in Chinese]. Zhongguoi Yi Fang Shou Yi Xue Bao 22:8183.

    • Search Google Scholar
    • Export Citation
  • 35.

    Mi ZQ, Zhang HL, Zhang YZ, Zhang YZ, 2005. Epidemiologic survey and serological investigation of Japanese encephalitis virus in Xishuangbanna and Simao region of Yunnan Province [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 16: 470471.

    • Search Google Scholar
    • Export Citation
  • 36.

    Zhang HL, 2004. The advance on arbovirus in Yunnan [in Chinese]. Zhongguo Mei Jie Sheng Wu Xue Ji Kong Zhi Za Zhi 15: 410414.

  • 37.

    Wang XJ, Zhang YP, Zhang RZ, 2004. Analysis on epidemic trend of Japanese B encephalitis during 1998–2002 [in Chinese]. Zhongguo Yimiao He Mianyi 10: 215217.

    • Search Google Scholar
    • Export Citation
  • 38.

    Wang PY, Zhou HN, Zhang ZX, Wu C, Gu YA, 2008. Investigation on the current situation of Japanese encephalitis transmission and control in Yunnan, China [in Chinese]. Zhongguo Bingyuan Shengwu Xue Zaizhi 3: 1922.

    • Search Google Scholar
    • Export Citation
  • 39.

    Brummer-Korvenkontio M, Vapalahti O, Kuusisto P, Saikku P, Manni T, Koskela P, Nygren T, Brummer-Korvenkontio H, Vaheri A, 2002. Epidemiology of Sindbis virus infections in Finland 1981–96: possible factors explaining a peculiar disease pattern. Epidemiol Infect 129: 335345.

    • Search Google Scholar
    • Export Citation
  • 40.

    Satu K, Tytti M, Antti V, Olli V, 2004. Causative agent of Pogosta disease isolated from blood and skin lesions. Emerg Infect Dis 10: 889894.

  • 41.

    Lvov DK, Vladimirtseva EA, Butenko AM, Karabatsos N, Trent DW, Calisher CH, 1998. Identity of Karelian fever and Ockelbo viruses determined by serum dilution-plaque reduction neutralization tests and oligonucleotide mapping. Am J Trop Med Hyg 39: 607610.

    • Search Google Scholar
    • Export Citation
  • 42.

    Malherbe H, Strickland-Cholmley M, Jackson AL, 1963. Sindbis virus infection in man. Report of a case with recovery of virus from skin lesions. S Afr Med J 37: 547552.

    • Search Google Scholar
    • Export Citation
  • 43.

    Rentier-Delrue F, Young NA, 1980. Genomic divergence among Sindbis virus strains. Virol. 106: 5970.

  • 44.

    Wang JL, Huang WL, Zhang HL, 2000. Seroepidemiological investigation on Sindbis virus in Yunnan Province [in Chinese]. Di Fang Bing Tong Bao 15: 3942.

    • Search Google Scholar
    • Export Citation
  • 45.

    Cowled C, Melville L, Weir R, Walsh S, Hyatt A, Van Driel R, Davis S, Gubala A, Boyle D, 2007. Genetic and epidemiological characterization of Middle Point orbivirus, a novel virus isolated from sentinel cattle in northern Australia. J Gen Virol 88: 34133422.

    • Search Google Scholar
    • Export Citation
  • 46.

    Attoui H, Mohd Jaafar F, de Micco P, de Lamballerie X, 2005. Coltiviruses and seadornaviruses in North America, Europe, and Asia. Emerg Infect Dis 11: 16731679.

    • Search Google Scholar
    • Export Citation
  • 47.

    Xu PT, Wang YM, Zuo JM, 1990. New orbivirus isolated from patients with encephalitis or with unknow fever in Yunnan Province [in Chinese]. Bing Du Xue Bao 6: 2733.

    • Search Google Scholar
    • Export Citation
  • 48.

    Xu PT, Wang YM, Zhao ZJ, 1988. Isolation and identification of two orbivirus from Yunnan Province [in Chinese]. Bing Du Xue Bao 4: 218222.

  • 49.

    Tao SJ, Wang HQ, Cao YX, Yang DR, Liu QZ, 2002. Prearation and storage of coltivirus antigen and its application in detection of coltivirus antibodies in serum from patients [in Chinese]. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi 16: 232235.

    • Search Google Scholar
    • Export Citation
  • 50.

    Chen BQ, Tao SJ, 1996. Arbovirus survey in China in recent ten years. Chin Med J (Engl) 109: 1315.

  • 51.

    O'Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76: 20672074.

    • Search Google Scholar
    • Export Citation

Author Notes

*Address for correspondence: Guo-Dong Liang, State Key Laboratory for Infectious Disease Prevention and Control, Institute for Viral Disease Control and Prevention, Chinese Center for Disease Control and Prevention, 100 Yingxin Street, Xuanwu District, Beijing 100052, People's Republic of China. E-mail: gdliang@hotmail.com

Financial support: This study was supported by grants from the Ministry of Science and Technology, China (no. 2003BA712A08-01, no. 2008ZX10004-001, and no. 2009ZX10004-202), the National Natural Science Foundation of China (no. 30560142), a development grant from the State Key Laboratory for Infectious Disease Prevention and Control (2008SKLID105), and the China Centers for Disease Control and Prevention–U.S. Centers for Disease Control and Prevention Cooperative Agreement U19-GH000004.

Authors' addresses: Jinglin Wang, State Key Laboratory for Infectious Disease Prevention and Control, Institute for Viral Disease Control and Prevention, China Centers for Disease Control and Prevention, Beijing, China, and Yunnan Institute of Endemic Disease Control and Prevention, Dali, Yunnan, China, E-mail: wangjinglin107@yahoo.com.cn. Hailin Zhang and Yun Feng, Yunnan Institute of Endemic Disease Control and Prevention, Dali, Yunnan, China, E-mails: zhanghl715@163.com and ynfy428@163.com. Xiaohong Sun, Shihong Fu, Huanqin Wang, Huanyu Wang, Qing Tang, and Guo-Dong Liang, State Key Laboratory for Infectious Disease Prevention and Control, Institute for Viral Disease Control and Prevention, China Centers for Disease Control and Prevention, Beijing, China, E-mails: dotsun@eyou.com, fushihong_fsh@hotmail.com, wjl200388@yahoo.com.cn, rainoffall@yahoo.com, qtang04@sina.com, and gdliang@hotmail.com.

Save