.png)
Rickettsia massiliae is a spotted fever group Rickettsia broadly distributed around the world and is associated with Rhipicephalus ticks.1–4 Its pathogenic role was suspected because its seroprevalence in humans was observed, and some authors reported that this Rickettsia could be the causative agent of some cases of Mediterranean spotted fever (MSF).5 To date, only two human cases of R. massiliae infection in Europe have been documented and confirmed with molecular methods. The first case was detected in a blood sample from a patient diagnosed with MSF in Italy; the blood sample had been stored for 20 years before the case was detected.6 The second case was in a patient with spotted fever and acute loss of vision in southern France.7
On July 1, 2005, a 56-year-old woman living in Buenos Aires, Argentina, was admitted to the emergency department of a hospital in Villagarcía de Arosa, Galicia, Spain, because of fever, chills, and malaise for 72 hours and a rash that was present for a few hours. The patient had arrived in Spain 48 hours earlier on a flight from Argentina. She had a history of convulsions related to arterio-venous malformation in the frontal brain area and was treated with phenobarbital. She had a fever (40°C) and a palpable purpuric rash all over the trunk and on the upper and lower extremities with the palms and soles affected (Figure 1).
Purpuric rash on lower extremities of the patient, which affected the soles of her feet. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
Purpuric rash on lower extremities of the patient, which affected the soles of her feet. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
Purpuric rash on lower extremities of the patient, which affected the soles of her feet. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
Hemocultures were prepared and treatment was initiated with amoxicillin-clavulanic acid and an infusion of amikacin. An allergic reaction was suspected, phenobarbital was discontinued, and gabapentin treatment was initiated. Laboratory evaluation showed a leukocyte count of 1.83 × 104 cells/µL with 18% immature forms, a prothrombin ratio of 73%, an aspartate aminotransferase level of 111 IU/L, an alanine aminotransferase level of 449 IU/L, a gamma-glutamyl transpeptidase level of 1,102 IU/L, an alkaline phosphatase level of 546 U/L, and a lactate dehydrogenase level of 1,132 U/L. The patient reported the next day that she removed ticks from her dog one week earlier and found several engorged ticks in her garden. Doxycycline (100 mg every 12 hours) was then administered.
The same day, a skin lesion on the right leg compatible with tache noire was observed (Figure 2). The patient had a torpid course and a pleural effusion was developed. Treatment with prednisone was prescribed. A biopsy specimen was obtained from the lesion (eschar). On day 12, the patient was afebrile and recovered. Blood cultures and results of serologic testing for hepatitis A, B, and C viruses, Epstein-Barr virus, cytomegalovirus, Rickettsia conorii, Coxiella burnetti, Borrellia burgdorferi, and human immunodeficiency virus (performed with a serum sample obtained the day after her admission to hospital) were negative. The absence of antibodies against R. conorii could have been the result of the antibiotic treatment, which may have reduced the antibody response.
Tache noire on the right leg of the patient. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
Tache noire on the right leg of the patient. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
Tache noire on the right leg of the patient. This figure appears in color at www.ajtmh.org.
Citation: The American Society of Tropical Medicine and Hygiene 82, 4; 10.4269/ajtmh.2010.09-0662
The biopsy sample of the eschar was sent to the Department of Infectious Diseases at the Hospital San Pedro–Centro de Investigación Biomédica de La Rioja in La Rioja, Spain, because rickettsiosis was suspected. DNA was extracted from the biopsy specimen by using QIAamp Tissue Kit (Qiagen, Hilden, Germany). Presumptive diagnosis of rickettsiosis was confirmed by nested polymerase chain reaction (PCR) assays that amplified fragments of the citrate synthase (gltA) and outer membrane protein (ompB) rickettsial genes (Table 1).8,9 Negative controls (one with template DNA but without primers and the other with primers and water instead of template DNA) and a positive control (DNA from R. conorii strain Malish #7) were included in all PCR assays. To minimize the potential for DNA contamination, three separate, designated areas were used for extraction of DNA and preparation of PCRs. Amplicons of the expected size were subjected to sequence determination. The nucleotide sequences obtained were found to share > 99% similarity with the corresponding gltA and ompB fragments of R. massiliae.
Primers used for amplification of partial rickettsial genes*
| Gene | Primer | Sequence (5′→3′) | Amplified fragment, basepairs | Annealing temperature (°C) | Reference |
|---|---|---|---|---|---|
| ompB | rompB OF | GTAACCGGAAGTAATCGTTTCGTAA | 511 | 54 | 9 |
| rompB OR | GCTTTATAACCAGCTAAACCACC | ||||
| rompB SFG IF | GTTTAATACGTGCTGCTAACCAA | 420 | 56 | 9 | |
| rompB SFG/TG IR | GGTTTGGCCCATATACCATAAG | ||||
| gltA | RpCS.877p | GGGGGCCTGCTCACGGCGG | 381 | 48 | 8 |
| RpCS.1,258n | ATTGCAAAAAGTACAGTGAACA | ||||
| RpCS.896p | GGCTAATGAAGCAGTGATAA | 337 | 56 | 9 | |
| RpCS.1,233n | GCGACGGTATACCCATAGC |
ompB = outer membrane protein; OF = outer forward primer; OR = outer reverse primer; SFG = spotted fever group; TG = typhus group; gltA = citrate synthase.
We report the third case of human R. massiliae infection and the first acquired in the New World (Argentina). Until recently, this Rickettsia species was not known to be distributed in the Americas,4 and only two demonstrated human cases had been reported in Europe.6,7 The potential role of this Rickettsia (strain Bar-29) as a human pathogen had also been suggested on the basis of the presence of antibodies against this organism in humans.5,10 However, spotted fever group rickettsiae can cross-react, and definitive identification of the agent that stimulated the antibodies is problematic because it relies on the assumptions that all species in a region are known and that the quality of the antigens used for each species is ideal.
Our findings extend the role of R. massiliae as an etiologic agent of tick-borne spotted fever rickettsiosis in the New World, where it had been previously detected in R. sanguineus, a tick species widely distributed around the world.
Acknowledgments:
We thank Fátima Bacellar, Rita de Sousa, and Natacha Milhano (Centro de Estudos de Vectores e Doenças Infecciosas, Instituto Nacional de Saúde Dr. Ricardo Jorge, Lisbon, Portugal) for supplying spotted fever group Rickettsia-positive controls. The American Committee on Clinical Tropical Medicine and Travelers' Health (ACCTMTH) assisted with publication expenses.
- 1.↑
Beati L, Raoult D, 1993. Rickettsia massiliae sp. nov., a new spotted fever group Rickettsia. Int J Syst Bacteriol 43: 839–840.
- 2.
Tissot Dupont H, Cornet JP, Raoult D, 1994. Identification of rickettsiae from ticks collected in the Central African Republic using the polymerase chain reaction. Am J Trop Med Hyg 50: 373–380.
- 3.
Oteo JA, Portillo A, Santibáñez S, Pérez-Martínez L, Blanco JR, Jiménez S, Ibarra V, Pérez-Palacios A, Sanz M, 2006. Prevalence of spotted fever group Rickettsia species detected in ticks in La Rioja, Spain. Ann NY Acad Sci 1078: 320–323.
- 4.↑
Eremeeva M, Bosserman EA, Demma LJ, Zambrano LM, Blau DM, Dasch G, 2006. Isolation and identification of Rickettsia massiliae from Rhipicephalus sanguineus ticks collected in Arizona. Appl Environ Microbiol 72: 5569–5577.
- 5.↑
Cardeñosa N, Segura F, Raoult D, 2003. Serosurvey among Mediterranean spotted fever patients of a new spotted fever group rickettsial strain (Bar29). Eur J Epidemiol 18: 351–356.
- 6.↑
Vitale G, Mansueto S, Rolain JM, Raoult D, 2006. Rickettsia massiliae human isolation. Emerg Infect Dis 12: 174–175.
- 7.↑
Parola P, Socolovschi C, Jeanjean L, Bitam I, Fournier PE, Sotto A, Labauge P, Raoult D, 2008. Warmer weather linked to tick attack and emergence of severe rickettsioses. PLoS Negl Trop Dis 2: e338.
- 8.↑
Regnery RL, Spruill CL, Plikaytis BD, 1991. Genotypic identification of rickettsiae and estimation of intraspecies sequence divergence for portions of two rickettsial genes. J Bacteriol 173: 1576–1589.
- 9.↑
Choi YJ, Jang WJ, Ryu JS, Lee SH, Park KH, Paik HS, Koh YS, Choi MS, Kim IS, 2005. Spotted fever group and typhus group rickettsioses in humans, South Korea. Emerg Infect Dis 11: 237–244.
- 10.↑
Bernabeu-Wittel M, del Toro MD, Nogueras MM, Muniain MA, Cardeñosa N, Segura F, Pachon J, 2006. Presence of human past infections due to the Bar29 rickettsial strain in southern Spain. J Infect 52: e117–e119.