• View in gallery

    Frequency histograms of quantitative PCR counts spirochetes of B. burgdorferi (A) and B. miyamotoi (B) in the blood and of B. burgdorferi (C) in the ear biopsy tissue of P. leucopus mice at Connecticut field site.

  • View in gallery

    Tick infestations and infections of the blood of P. leucopus by trapping period. A, Prevalence of I. scapularis larvae and nymph infestations. B, Prevalence of B. burgdorferi and B. miyamotoi bacteremia as detected by species-specific quantitative PCR. The number of captured mice for trapping periods 1, 2, 3, and 4 were 110, 170, 162, and 101, respectively. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Frequency histograms of quantitative PCR counts of spirochetes of B. burgdorferi (A) or B. miyamotoi (B) in infected host-seeking I. scapularis nymphs at Connecticut field site.

  • View in gallery

    Frequency histograms of quantitative PCR counts of spirochetes of B. burgdorferi (A) or B. miyamotoi (B) in infected host-seeking I. scapularis nymphs at 46 sites in the northeastern and north-central United States.

  • View in gallery

    Frequency histograms of quantitative PCR counts of spirochetes of B. miyamotoi in infected larvae (A) and nymphs (B) of laboratory-reared I. scapularis.

  • View in gallery

    Standard curves of quantitative PCR of B. miyamotoi (A) and B. burgdorferi (B) DNA in mixtures at various ratios. To DNA extracts of I. scapularis, nymphs with different amounts of B. miyamotoi were added equal volume aliquots of B. burgdorferi DNA in different concentrations. The NH4OH method of extraction of DNA from ticks was used as described in the Materials and Methods section. This figure appears in color at www.ajtmh.org.

  • 1

    Barbour AG, 2001. Borrelia: a diverse and ubiquitous genus of tick-borne pathogens. Scheld WM, Craig WA, Hughes JM, eds. Emerging Infections 5. Washington, DC: American Society for Microbiology Press, 153–174.

  • 2

    Barbour AG, 2005. Relapsing fever. Goodman JL, Dennis D, Sonenshine DE, eds. Tick-Borne Diseases of Humans. Washington, DC: ASM Press, 268–291.

  • 3

    Steere AC, Coburn J, Glickstein L, 2005. Lyme borreliosis. Goodman JL, Dennis D, Sonenshine DE, eds. Tick-Borne Diseases of Humans. Washington, DC: ASM Press, 176–206.

  • 4

    Rich SM, Armstrong PM, Smith RD, Telford SR 3rd, 2001. Lone star tick-infecting borreliae are most closely related to the agent of bovine borreliosis. J Clin Microbiol 39 :494–497.

    • Search Google Scholar
    • Export Citation
  • 5

    Barbour AG, Maupin GO, Teltow GJ, Carter CJ, Piesman J, 1996. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis 173 :403–409.

    • Search Google Scholar
    • Export Citation
  • 6

    Armstrong PM, Rich SM, Smith RD, Hartl DL, Spielman A, Telford SR 3rd, 1996. A new Borrelia infecting Lone Star ticks. Lancet 347 :67–68.

    • Search Google Scholar
    • Export Citation
  • 7

    Varela-Stokes AS, 2007. Transmission of bacterial agents from lone star ticks to white-tailed deer. J Med Entomol 44 :478–483.

  • 8

    Bunikis J, Tsao J, Garpmo U, Berglund J, Fish D, Barbour AG, 2004. Typing of Borrelia relapsing fever group strains. Emerg Infect Dis 10 :1661–1664.

    • Search Google Scholar
    • Export Citation
  • 9

    Fraenkel CJ, Garpmo U, Berglund J, 2002. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J Clin Microbiol 40 :3308–3312.

    • Search Google Scholar
    • Export Citation
  • 10

    Fukunaga M, Takahashi Y, Tsuruta Y, Matsushita O, Ralph D, McClelland M, Nakao M, 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Bacteriol 45 :804–810.

    • Search Google Scholar
    • Export Citation
  • 11

    Mun J, Eisen RJ, Eisen L, Lane RS, 2006. Detection of a Borrelia miyamotoi sensu lato relapsing-fever group spirochete from Ixodes pacificus in California. J Med Entomol 43 :120–123.

    • Search Google Scholar
    • Export Citation
  • 12

    Scoles GA, Papero M, Beati L, Fish D, 2001. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis 1 :21–34.

    • Search Google Scholar
    • Export Citation
  • 13

    Varela AS, Luttrell MP, Howerth EW, Moore VA, Davidson WR, Stallknecht DE, Little SE, 2004. First culture isolation of Borrelia lonestari, putative agent of southern tick-associated rash illness. J Clin Microbiol 42 :1163–1169.

    • Search Google Scholar
    • Export Citation
  • 14

    Bunikis J, Barbour AG, 2005. Third Borrelia species in white-footed mice. Emerg Infect Dis 11 :1150–1151.

  • 15

    Tsao JI, Wootton JT, Bunikis J, Luna MG, Fish D, Barbour AG, 2004. An ecological approach to preventing human infection: vaccinating wild mouse reservoirs intervenes in the Lyme disease cycle. Proc Natl Acad Sci USA 101 :18159–18164.

    • Search Google Scholar
    • Export Citation
  • 16

    Gatewood AG, Liebman KA, Vourc’h G, Bunikis J, Hamer SA, Cortinas R, Melton F, Cislo P, Kitron U, Tsao J, Barbour AG, Fish D, Diuk-Wasser MA, 2009. Climate and tick seasonality predict Borrelia burgdorferi genotype distribution. Appl Environ Microbiol 75 :2476–2483.

    • Search Google Scholar
    • Export Citation
  • 17

    Zhioua E, Aeschlimann A, Gern L, 1994. Infection of field-collected Ixodes ricinus (Acari: Ixodidae) larvae with Borrelia burgdorferi in Switzerland. J Med Entomol 31 :763–766.

    • Search Google Scholar
    • Export Citation
  • 18

    Patrican LA, 1997. Absence of Lyme disease spirochetes in larval progeny of naturally infected Ixodes scapularis (Acari:Ixodidae) fed on dogs. J Med Entomol 34 :52–55.

    • Search Google Scholar
    • Export Citation
  • 19

    Nefedova VV, Korenberg EI, Gorelova NB, Kovalevskii YV, 2004. Studies on the transovarial transmission of Borrelia burgdorferi sensu lato in the taiga tick Ixodes persulcatus. Folia Parasitol (Praha) 51 :67–71.

    • Search Google Scholar
    • Export Citation
  • 20

    Schwan TG, Battisti JM, Porcella SF, Raffel SJ, Schrumpf ME, Fischer ER, Carroll JA, Stewart PE, Rosa P, Somerville GA, 2003. Glycerol-3-phosphate acquisition in spirochetes: distribution and biological activity of glycerophosphodiester phosphodiesterase (GlpQ) among Borrelia species. J Bacteriol 185 :1346–1356.

    • Search Google Scholar
    • Export Citation
  • 21

    Ramakrishnan U, 2001. Methods of controlling white-tailed deer. Front Plant Sci 53 :7.

  • 22

    Tsao J, Barbour AG, Luke CJ, Fikrig E, Fish D, 2001. OspA immunization decreases transmission of Borrelia burgdorferi spirochetes from infected Peromyscus leucopus mice to larval Ixodes scapularis ticks. Vector Borne Zoonotic Dis 1 :65–74.

    • Search Google Scholar
    • Export Citation
  • 23

    Sinsky RJ, Piesman J, 1989. Ear punch biopsy method for detection and isolation of Borrelia burgdorferi from rodents. J Clin Microbiol 27 :1723–1727.

    • Search Google Scholar
    • Export Citation
  • 24

    Pennington PM, Allred CD, West CS, Alvarez R, Barbour AG, 1997. Arthritis severity and spirochete burden are determined by serotype in the Borrelia turicatae-mouse model of Lyme disease. Infect Immun 65 :285–292.

    • Search Google Scholar
    • Export Citation
  • 25

    Falco RC, Fish D, 1992. A comparison of methods for sampling the deer tick, Ixodes dammini, in a Lyme disease endemic area. Exp Appl Acarol 14 :165–173.

    • Search Google Scholar
    • Export Citation
  • 26

    Diuk-Wasser MA, GatewoodAG, Cortinas MR,Yaremych-Hamer S, Tsao J, Kitron U, Hickling G, Brownstein JS, Walker E, Piesman J, Fish D, 2006. Spatiotemporal patterns of host-seeking Ixodes scapularis nymphs (Acari: Ixodidae) in the United States. J Med Entomol 43 :166–176.

    • Search Google Scholar
    • Export Citation
  • 27

    Bunikis J, Tsao J, Luke CJ, Luna MG, Fish D, Barbour AG, 2004. Borrelia burgdorferi infection in a natural population of Peromyscus leucopus mice: a longitudinal study in an area where Lyme borreliosis is highly endemic. J Infect Dis 189 :1515–1523.

    • Search Google Scholar
    • Export Citation
  • 28

    Beati L, Keirans JE, 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J Parasitol 87 :32–48.

    • Search Google Scholar
    • Export Citation
  • 29

    Hanincova K, Kurtenbach K, Diuk-Wasser M, Brei B, Fish D, 2006. Epidemic spread of Lyme borreliosis, northeastern United States. Emerg Infect Dis 12 :604–611.

    • Search Google Scholar
    • Export Citation
  • 30

    Comstedt P, Bergstrom S, Olsen B, Garpmo U, Marjavaara L, Mejlon H, Barbour AG, Bunikis J, 2006. Migratory passerine birds as reservoirs of Lyme borreliosis in Europe. Emerg Infect Dis 12 :1087–1095.

    • Search Google Scholar
    • Export Citation
  • 31

    Barbour AG, 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J Biol Med 57 :521–525.

  • 32

    Bunikis J, Garpmo U, Tsao J, Berglund J, Fish D, Barbour AG, 2004. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150 :1741–1755.

    • Search Google Scholar
    • Export Citation
  • 33

    Hutchinson G, 1959. Homage to Santa Rosalia or why are there so many kinds of animals? Am Nat 93 :145–159.

  • 34

    Anderson JF, Flavell RA, Magnarelli LA, Barthold SW, Kantor FS, Wallich R, Persing DH, Mathiesen D, Fikrig E, 1996. Novel Borrelia burgdorferi isolates from Ixodes scapularis and Ixodes dentatus ticks feeding on humans. J Clin Microbiol 34 :524–529.

    • Search Google Scholar
    • Export Citation
  • 35

    Goethert HK, Telford SR 3rd, 2003. Enzootic transmission of Babesia divergens among cottontail rabbits on Nantucket Island, Massachusetts. Am J Trop Med Hyg 69 :455–460.

    • Search Google Scholar
    • Export Citation
  • 36

    Schneider BS, Zeidner NS, Burkot TR, Maupin GO, Piesman J, 2000. Borrelia isolates in Northern Colorado identified as Borrelia bissettii. J Clin Microbiol 38 :3103–3105.

    • Search Google Scholar
    • Export Citation
  • 37

    Rijpkema S, Golubic D, Molkenboer M, Verbeek-De Kruif N, Schellekens J, 1996. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp Appl Acarol 20 :23–30.

    • Search Google Scholar
    • Export Citation
  • 38

    Kurtenbach K, De Michelis S, Sewell HS, Etti S, Schafer SM, Hails R, Collares-Pereira M, Santos-Reis M, Hanincova K, Labuda M, Bormane A, Donaghy M, 2001. Distinct combinations of Borrelia burgdorferi sensu lato genospecies found in individual questing ticks from Europe. Appl Environ Microbiol 67 :4926–4929.

    • Search Google Scholar
    • Export Citation
  • 39

    Vennestrom J, Egholm H, Jensen PM, 2008. Occurrence of multiple infections with different Borrelia burgdorferi genospecies in Danish Ixodes ricinus nymphs. Parasitol Int 57 :32–37.

    • Search Google Scholar
    • Export Citation
  • 40

    Kurtenbach K, Hanincova K, Tsao JI, Margos G, Fish D, Ogden NH, 2006. Fundamental processes in the evolutionary ecology of Lyme borreliosis. Nat Rev Microbiol 4 :660–669.

    • Search Google Scholar
    • Export Citation
  • 41

    Donahue JG, Piesman J, Spielman A, 1987. Reservoir competence of white-footed mice for Lyme disease spirochetes. Am J Trop Med Hyg 36 :92–96.

    • Search Google Scholar
    • Export Citation
  • 42

    Richter D, Klug B, Spielman A, Matuschka FR, 2004. Adaptation of diverse lyme disease spirochetes in a natural rodent reservoir host. Infect Immun 72 :2442–2444.

    • Search Google Scholar
    • Export Citation
  • 43

    Hanincova K, Ogden NH, Diuk-Wasser M, Pappas CJ, Iyer R, Fish D, Schwartz I, Kurtenbach K, 2008. Fitness variation of Borrelia burgdorferi sensu stricto strains in mice. Appl Environ Microbiol 74 :153–157.

    • Search Google Scholar
    • Export Citation
  • 44

    Piesman J, Gern L, 2004. Lyme borreliosis in Europe and North America. Parasitology 129 (Suppl):S191–S220.

  • 45

    Woolhouse ME, Taylor LH, Haydon DT, 2001. Population biology of multihost pathogens. Science 292 :1109–1112.

  • 46

    Krampitz HE, 1986. In vivo isolation and maintenance of some wild strains of European hard tick spirochetes in mammalian and arthropod hosts. A parasitologist’s view. Zentralbl Bakteriol Mikrobiol Hyg [A] 263 :21–28.

    • Search Google Scholar
    • Export Citation
  • 47

    Stanek G, Burger I, Hirschl A, Wewalka G, Radda A, 1986. Borrelia transfer by ticks during their life cycle. Studies on laboratory animals. Zentralbl Bakteriol Mikrobiol Hyg [A] 263 :29–33.

    • Search Google Scholar
    • Export Citation
  • 48

    Richter D, Matuschka FR, 2006. Modulatory effect of cattle on risk for Lyme disease. Emerg Infect Dis 12 :1919–1923.

  • 49

    Wodecka B, 2007. [Significance of red deer (Cervus elaphus) in the ecology of Borrelia burgdorferi sensu lato]. Wiad Parazytol 53 :231–237.

    • Search Google Scholar
    • Export Citation
  • 50

    Burgdorfer W, Gage KL, 1987. Susceptibility of the hispid cotton rat (Sigmodon hispidus) to the Lyme disease spirochete (Borrelia burgdorferi). Am J Trop Med Hyg 37 :624–628.

    • Search Google Scholar
    • Export Citation
  • 51

    Ullmann AJ, Gabitzsch ES, Schulze TL, Zeidner NS, Piesman J, 2005. Three multiplex assays for detection of Borrelia burgdorferi sensu lato and Borrelia miyamotoi sensu lato in field-collected Ixodes nymphs in North America. J Med Entomol 42 :1057–1062.

    • Search Google Scholar
    • Export Citation
  • 52

    Richter D, Schlee DB, Matuschka FR, 2003. Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. Emerg Infect Dis 9 :697–701.

    • Search Google Scholar
    • Export Citation
  • 53

    Hulinska D, Votypka J, Kriz B, Holinkova N, Novakova J, Hulinsky V, 2007. Phenotypic and genotypic analysis of Borrelia spp. isolated from Ixodes ricinus ticks by using electrophoretic chips and real-time polymerase chain reaction. Folia Microbiol (Praha) 52 :315–324.

    • Search Google Scholar
    • Export Citation
  • 54

    Anderson JF, Magnarelli LA, Burgdorfer W, Barbour AG, 1983. Spirochetes in Ixodes dammini and mammals from Connecticut. Am J Trop Med Hyg 32 :818–824.

    • Search Google Scholar
    • Export Citation
  • 55

    Walker ED, Smith TW, DeWitt J, Beaudo DC, McLean RG, 1994. Prevalence of Borrelia burgdorferi in host-seeking ticks (Acari: Ixodidae) from a Lyme disease endemic area in northern Michigan. J Med Entomol 31 :524–528.

    • Search Google Scholar
    • Export Citation
  • 56

    Wang G, Liveris D, Brei B, Wu H, Falco RC, Fish D, Schwartz I, 2003. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl Environ Microbiol 69 :4561–4565.

    • Search Google Scholar
    • Export Citation
  • 57

    Ornstein K, Barbour AG, 2006. A reverse transcriptase-polymerase chain reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantification of pathogen load in a vector. Vector Borne Zoonotic Dis 6 :103–112.

    • Search Google Scholar
    • Export Citation
  • 58

    Brunet LR, Spielman A, Telford SR 3rd, 1995. Short report: density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am J Trop Med Hyg 53 :300–302.

    • Search Google Scholar
    • Export Citation
  • 59

    Burkot TR, Patrican L, Piesman J, 1994. Field trial of an outer surface protein A (OspA) antigen-capture enzyme-linked immunosorbent assay (ELISA) to detect Borrelia burgdorferi in Ixodes scapularis. Am J Trop Med Hyg 50 :354–358.

    • Search Google Scholar
    • Export Citation
  • 60

    Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP, 1982. Lyme disease—a tick-borne spirochetosis? Science 216 :1317–1319.

    • Search Google Scholar
    • Export Citation
  • 61

    De Silva AM, Fikrig E, 1995. Growth and migration of Borrelia burgdorferi in Ixodes ticks during blood feeding. Am J Trop Med Hyg 53 :397–404.

    • Search Google Scholar
    • Export Citation
  • 62

    Lane RS, Burgdorfer W, 1987. Transovarial and transstadial passage of Borrelia burgdorferi in the western black-legged tick, Ixodes pacificus (Acari: Ixodidae). Am J Trop Med Hyg 37 :188–192.

    • Search Google Scholar
    • Export Citation
  • 63

    Burgdorfer W, Lane RS, Barbour AG, Gresbrink RA, Anderson JR, 1985. The western black-legged tick, Ixodes pacificus: a vector of Borrelia burgdorferi. Am J Trop Med Hyg 34 :925–930.

    • Search Google Scholar
    • Export Citation
  • 64

    Fine PE, 1975. Vectors and vertical transmission: an epidemiologic perspective. Ann N Y Acad Sci 266 :173–194.

 
 
 

 

 

 

 

 

 

Niche Partitioning of Borrelia burgdorferi and Borrelia miyamotoi in the Same Tick Vector and Mammalian Reservoir Species

View More View Less
  • 1 Departments of Microbiology and Molecular Genetics and Medicine, University of California Irvine, Irvine, California; Department of Epidemiology and Public Health, Yale University School of Public Health, New Haven, Connecticut; Departments of Fisheries and Wildlife and Large Animal Clinical Sciences, Michigan State University, East Lansing, Michigan

The Lyme borreliosis agent Borrelia burgdorferi and the relapsing fever group species Borrelia miyamotoi co-occur in the United States. We used species-specific, quantitative polymerase chain reaction to study both species in the blood and skin of Peromyscus leucopus mice and host-seeking Ixodes scapularis nymphs at a Connecticut site. Bacteremias with B. burgdorferi or B. miyamotoi were most prevalent during periods of greatest activity for nymphs or larvae, respectively. Whereas B. burgdorferi was 30-fold more frequent than B. miyamotoi in skin biopsies and mice had higher densities of B. burgdorferi densities in the skin than in the blood, B. miyamotoi densities were higher in blood than skin. In a survey of host-seeking nymphs in 11 northern states, infection prevalences for B. burgdorferi and B. miyamotoi averaged ~0.20 and ~0.02, respectively. Co-infections of P. leucopus or I. scapularis with both B. burgdorferi and B. miyamotoi were neither more nor less common than random expectations.

INTRODUCTION

The spirochete genus Borrelia comprises three major groups of species.1 The first group includes several agents of relapsing fever (RF), such as B. duttonii and B. hermsii. These species, with the exception of B. recurrentis, are transmitted between vertebrates by soft (argasid) ticks.2 The species of the second group are transmitted by hard (ixodid) ticks of the genus Ixodes and include agents of Lyme borreliosis (LB), such as B. burgdorferi and B. afzelii, as well as species, such as B. bissettii, that have not been associated with human disease.3 The species in the third group are closer to the RF species on the basis of DNA sequences, but like the LB organisms, use ixodid rather than argasid ticks as vectors. This group includes B. theileri, which is transmitted by Rhipicephalus ticks and causes infections of cattle and other large livestock,4 and B. lonestari,5,6 which is transmitted by Amblyomma americanum and infects deer.7 Another species in this third group is B. miyamotoi, which is transmitted by Ixodes species, has rodents as reservoirs, and occurs in Asia, Europe, and North America.812 Because B. miyamotoi, B. lonestari, and B. theileri have proven difficult or impossible to cultivate outside of experimental animals, 5,12,13 understanding the biology of this group of spirochetes has advanced slowly.

Where they occur, B. miyamotoi and a LB species, such as B. burgdorferi in North America or B. afzelii in Europe, share an Ixodes sp. tick as a vector and at least one mammalian reservoir. In the eastern United States, B. burgdorferi and B. miyamotoi infect the white-footed mouse (Peromyscus leucopus) and are transmitted between vertebrates by I. scapularis.12,14,15 Infection prevalences in questing nymphal ticks have ranged between 0.20 and 0.50 for B. burgdorferi and 0.01 to 0.05 for B. miyamotoi by polymerase chain reaction (PCR). 15,16 Both species infect the ticks through horizontal transmission from a reservoir host. Unlike B. burgdorferi,1719 but like several RF Borrelia species,2 B. miyamotoi is vertically transmitted from infected females to their offspring. 12 Similarly to RF Borrelia species, B. miyamotoi achieves high densities in the blood of rodents. 14,20

These earlier observations suggested to us that B. burgdorferi and B. miyamotoi use different strategies for maintenance and dissemination in the same reservoir host and vector species. To further assess similarities and differences between B. burgdorferi and B. miyamotoi in the same host and vector populations, we compared the prevalences, burdens, and temporal dynamics of their infections in P. leucopus and sympatric questing ticks from a study site in Connecticut. Previous studies of the site showed that most P. leucopus became infected with B. burgdorferi during the course of the transmission season and that the prevalence of B. burgdorferi infection of questing nymphs averaged 0.36. 15 In the same study, we also documented the occurrence of B. miyamotoi in both P. leucopus and I. scapularis. The null hypothesis was that B. burgdorferi and B. miyamotoi were maintained independently in environments where they co-existed. To evaluate this, we determined the frequencies of each type of infection in P. leucopus and ticks at the Connecticut field site and, additionally, in questing I. scapularis nymphs that had been collected in several other locations across the northeastern, mid-Atlantic, and north-central regions of the United States.

MATERIALS AND METHODS

Field sites and mouse trapping.

There were two parts of the study. In the first part, animal trapping and tick collecting were carried out at a field site at a 1,400-ha private, mixed hardwood forest in southern Connecticut (41.351° N, 72.777° W), as described previously. 15 Hereafter, this is called the “Connecticut field site.” (The second part is described below.) All trapping and handling procedures were approved by the Yale University Institutional Animal Care and Utilization Committee (Study Protocol 07596). From 1998 to 2003, periodic sampling at our field site found nymphal infection prevalence to vary from 0.23 to 0.50 and an average density at the peak nymphal host-seeking period at the beginning of June to range from 0.16 to 0.55 nymphs/m2 (J.I.T., unpublished data). Estimates of deer density have ranged from 25 to 120 deer/km. 2,21 The data reported here were from control treatment sites of an experimental study in 2001 to examine the effects of field vaccination of P. leucopus.15 Three 2.15-ha plots were distributed among each of three sites that had similar landscape features and were separated by 100–1,500 m. After blood and tissue samples had been obtained, trapped mice were injected with the study’s control immunogen, Schistosoma glutathione-S-transferase, and monophosphoryl lipid A and synthetic trehalose dicorynomycolate (Ribi Adjuvant System; Corixa, Seattle, WA). In our previous studies, there was no discernible effect of immunization with the control antigen and adjuvant on B. burgdorferi transmission and infection dynamics under laboratory or field conditions. 15,22

Animals were trapped from June to early September 2001. At each site, mice were trapped for 2–4 nights per trapping period, with a total of four trapping periods per site and ~3 weeks between consecutive trapping periods. Traps were placed 12-m apart and in arrays of 12 × 12. Aluminum live traps (H.B. Sherman Traps, Tallahassee, FL) were baited with crimped oats. Traps were set between 3:00 and 6:00 pm and checked between 8:00 and 9:00 am the following day. Individual mice captured for the first time each trapping period were (1) anesthetized with ketamine at a dose of 150 mg/kg, (2) received a uniquely numbered metal ear tag on initial capture, (3) examined for sex, pelage, mass, and number of attached larval and nymphal ticks, (4) bled of < 150 μL from the retroorbital sinus, and (5) subjected to 2-mm ear punch biopsy as described by Sinsky and Piesman. 23 Pelage was scored as 1 for juvenile, 2 for sub-adult, and 3 for adult. Mass was determined with a Pesola 100-g scale. On recovery from anesthesia, mice were rehydrated by provision of an apple slice and released at the point of capture. Serum was separated from erythrocytes, leukocytes, platelets, fibrin, and spirochetes by centrifugation at 10,000g for 6 minutes 24 and was stored at −20°C until the assays were performed. The blood pellets and biopsy tissues were stored at −70°C until DNA extraction. Mice recaptured within the same trapping period were only weighed and examined for ticks; mice recaptured during subsequent trapping periods were processed as described. 15

Tick collections.

As part of the first part of the study, we sampled grids at the Connecticut field site for host-seeking nymphal I. scapularis ticks by drag sampling 25 from late May through August 2002 with the aims to collect ticks in proportion to their relative abundance on grids and to maximize sample sizes for analysis of infection with B. burgdorferi. We pulled a standard 1-m2 white corduroy drag cloth across the leaf litter for 132-m transects within each grid, stopping every 12 m to collect ticks. After dragging transects, we further sampled in high tick density areas. Ticks were immersed in 70% ethanol for storage at 4°C until processing within 3 months. A preliminary study showed that storage of laboratory-infected I. scapularis nymphs with B. burgdorferi in 70% ethanol at 4°C for 3 months did not decrease the yield of PCR product.

In the second part of the study, host-seeking ticks were collected between mid-May and late August in the years 2004 through 2007 as part of study described by Gatewood and others. 16 Collection sites were selected according to a stratified random selection procedure described by Diuk-Wasser and others. 26 From that study, we used DNA extracts from ticks at the 46 sites at which at least 20 I. scapularis nymphs were collected over the course of the survey. These were in nine states of the northeastern and mid-Atlantic regions (CT, MA, MD, ME, NJ, NY, PA, RI, and VA), which were < 80° W, and six states of the north-central region (IA, IL, IN, MN, and WI), which were > 80° W. The first part’s Connecticut field site was not included in this survey. Each site was visited repeatedly at approximately even intervals throughout the summer months, with a median of five visits during the season. At each visit, host-seeking ticks were collected from vegetation using a 1-m2 drag cloth over five 200-m transects, for a total of 1,000 m2 that were sampled per visit. The cloth was inspected for ticks every 20 m, and nymphal ticks were preserved in transect-specific vials of 70% ethanol. Larvae were either placed in the vial or collected using adhesive tape and stored in plastic bags.

DNA extraction and quantitative PCR.

From blood and skin biopsies from the Connecticut site, DNA was extracted using the Qiagen DNeasy Tissue Kit (Qiagen, Valencia, CA) as described. 27 For ticks collected at the Connecticut site, DNA was extracted from individual nymphal I. scapularis following Beati and Keirans for the 2002 collection. 28 For ticks collected at several locations in 2004–2007 collections, total DNA was extracted using ammonium hydroxide (NH4OH). For this procedure, ticks were incubated for 2 h in 5 μL of 1.4 mol/L NH4OH at 22°C and crushed with a plastic pipette tip. To this was added 95 μL distilled H2O before a second incubation at 95°C for 30 minutes. Material was centrifuged to separate tick debris from DNA solution, and the supernatant was transferred to clean vials containing 1 μL of 100 mmol/L EDTA and stored at −20°C.

In addition to the DNA extracts from blood, tissue, and ticks described above, two other sets of DNA samples, which were extracted from ticks by the method of Beati and Keirans, 28 were available for examination: (1) flat nymphs that were derived from engorged larvae removed from captured mammals at the Connecticut field site, as described by Hanincova and others, 29 and (2) flat larvae and nymphs of laboratory-reared P. leucopus, which were infected with B. miyamotoi, as described. 12

DNA extracts were subjected to quantitative multiplex real-time PCR (qPCR), as described, 15,16,30 with two probes hybridizing to a region of the 16S rDNA that differed between B. burgdorferi and B. miyamotoi. Results were expressed as the number of spirochete cells per tick or volume of blood or tissue. Forward and reverse primers were, respectively, 5′GCTGTAAACGATGCACACTTGGT and 5′GGCGGCACACTTAACACGTTAG. The corresponding dye-labeled probes were 6FAM-TTCGGTACTA ACTTTTAGTTAA and VIC-CGGTACTAACCTTTCGAT TA with 3′ ends modified with a minor groove binding protein (Applied Biosystems, Foster City, CA). The reaction was performed in 25-μL volume in single tubes or wells at a final concentration of 900 nmol/L for each primer and 200 nmol/L for each probe. 15 The final concentration of EDTA was < 0.1 mmol/L. The PCR conditions were 50°C for 2 minutes and 95°C for 10 minutes, followed by 45 cycles of 95°C for 15 seconds and 63°C for 60 seconds on an Applied Biosystems 7300 Real-Time PCR apparatus for the 2002 and 2004 samples and a Rotor-Gene RG-3000 apparatus (Corbett Research, San Francisco, CA) for the 2005–2007 samples. The DNA extractions, PCR reaction preparations, and analysis of the products were carried out in three separated laboratory rooms. To monitor for contamination, negative controls were included with all DNA extraction and PCR procedures.

DNA standards were the same for each experiment: strain B31 (ATCC 35210) for B. burgdorferi and strain HS1 (ATCC 35209) of B. hermsii for the uncultivable B. miyamotoi.15 B. hermsii and B. miyamotoi have identical sequences for the regions of the primers and probe. Borrelia species cells were grown in BSK II medium at 34°C and harvested as described. 31 With DNA standards, the qPCR assays with each probe set was linear with a R2 ≥ 0.99 over a range of 1–106 spirochetes per reaction. The linear regression coefficients (95% confidence intervals [CIs]) for Ct values on log-transformed cell counts were −3.31 (−3.40 to −3.28) for B. burgdorferi and −3.40 (−3.52 to −3.28) for the B. hermsii surrogate (P > 0.05). Samples with estimated spirochete counts of less than one per tick or biopsy specimen were considered negative.

The identities of the Borrelia species in 100 random samples scored by qPCR as B. burgdorferi were confirmed by PCR of the 16S–23S intergenic spacer region (IGR) with species-specific primers. 8,15,32 Random samples scored as B. miyamotoi or B. burgdorferi by qPCR were confirmed by direct sequencing of the IGR on a CEQ 8000 capillary sequencer (Beckman Coulter, Fullerton, CA).

Statistical analysis.

Poisson and logistic regression analyses, goodness-of-fit tests, and non-parametric analyses were performed with LogXact or StatXact v. 6 (Cytel Software, Cambridge, MA) using exact criteria or with Monte Carlo simulation (10,000 replicates). Differences in proportions were assessed with Confidence Interval Analysis v. 2.1.2 (University of Southampton). Spirochete counts generally followed log-normal distributions and, accordingly, were log-transformed first for calculations of mean and 95% CIs and for performance of t tests, ANOVA, or Kruskal-Wallis tests using SYSTAT v. 11 (SYSTAT Software, Inc., Chicago, IL). The antilogs of the means and the asymmetric CIs are given. Odds ratios (ORs) and means are accompanied by 95% CI in parentheses or brackets. Significance tests were two-tailed.

RESULTS

Borrelia infection of blood.

Overall, 69 (0.12) of 556 blood specimens from captured mice had B. burgdorferi, and 36 (0.06) had B. miyamotoi by qPCR (Table 1). The three collecting sites at the Connecticut field site were similar in terms of the prevalences of the two species in the blood of P. leucopus. Although B. burgdorferi was twice as prevalent as B. miyamotoi among captured mice over the sampling period, B. miyamotoi reached densities in the blood that were ~5-fold higher than for B. burgdorferi. The counts of each species in the blood followed a log-normal distribution with peaks at ~100 and 1,000 spirochetes/mL for B. burgdorferi and B. miyamotoi, respectively (Figure 1A and B).

No mice captured during the first trapping period had detectable B. burgdorferi or B. miyamotoi in the blood. Thereafter, both Borrelia species were detected in mice, but they differed in the timing in their peaks of prevalence (Figure 2). B. burgdorferi bacteremia was most frequent during the second trapping period and declined in prevalence with succeeding trapping periods. In contrast, the frequency of B. miyamotoi bacteremia increased in prevalence through Period 4 (Kruskal-Wallis, P = 0.001). We did not detect an association between sex and infection by trapping period for either B. burgdorferi (OR, 1.2 [0.64–2.1]) or B. miyamotoi (OR, 1.9 [0.85–4.0]).

To assess a possible effect of vaccination with the adjuvant and control antigen, we matched by day of capture 120 mice that had not previously been vaccinated with 120 mice that been vaccinated on a prior capture but captured on the same day. The mean and median days of capture were 213 and 207, respectively, for both matched sets. There were 40 males in the non-vaccinated group and 43 males in the vaccinated group (OR, 1.1 [0.7–1.1]). Vaccinated mice were significantly larger than non-vaccinated mice in the matched sets: the mean weights (g) were 20.5 (19.8–21.1) and 18.2 (17.6–18.8), respectively (P < 10 −5). The estimated age by pelage score was also generally higher in the vaccinated group: the mean pelage scores were 2.5 (2.4–2.6) for non-vaccinated mice and 2.8 (2.7–2.9) for vaccinated mice (P < 10 −5). Receipt of the adjuvant, however, did not seem to subsequently protect the mice against infection: 26 vaccinated mice versus 13 non-vaccinated were infected with B. burgdorferi (OR, 2.3 [1.1–4.7]). For 68 mice that were infected with B. burgdorferi, mean spirochete counts in the blood were 67 (37–120) and 46 (33–64) for 22 non-vaccinated and 46 vaccinated mice, respectively (P = 0.24). There was no apparent effect of vaccination on frequency of B. miyamotoi infection for the set matched by day of capture: 7 of 120 non-vaccinated and 6 of 120 of vaccinated mice were infected (OR, 0.8 [0.3–2.6]).

B. burgdorferi bacteremia was associated with infestation with nymphs but not with larvae for the set of 539 captures for which data on infestations were complete (Figure 2). The mean number of larvae per captured mouse for trapping periods 1, 2, 3, and 4 were 2.6, 1.0, 12.4, and 8.1, respectively. The corresponding values for nymphs were 1.4, 0.4, 0.1, and 0.02. Of 42 mice infested with nymphs alone, 10 (0.24) were bacteremic, whereas of 497 mice with no ticks, with larvae only, or with larvae as well as nymphs, only 56 (0.11) were bacteremic with B. burgdorferi (OR, 2.5 [1.2–5.3]; P = 0.03). In contrast, B. miyamotoi bacteremia was associated with infestation with larvae but not with nymphs (Figure 2). Of 301 mice with larvae alone, 25 (0.08) had B. miyamotoi in the blood, whereas of 238 with no ticks, with nymphs alone, or with nymphs as well as larvae, only 10 (0.04) were bacteremic (OR, 2.1 [0.97–7.1]; P = 0.05).

Among 167 mice that were captured at least twice, the prevalence of infection in the blood increased with the succeeding capture for both B. burgdorferi (OR, 1.5 [1.1–1.9]) and B. miyamotoi (OR, 2.2 [1.5–3.1]). With respect to B. burgdorferi in the blood, mice changed from negative at the first capture to positive at a second one as follows: 18 of 83 (0.22) within 3 weeks, 8 of 47 (0.17) within 4 weeks, 10 of 26 (0.39) within 5 weeks, and 2 of 9 within 7 weeks (0.22). Thus, at least 25% of recaptured mice were bacteremic with B. burgdorferi at a successive capture. With B. miyamotoi, the frequencies of conversion from PCR negative to positive were the following: 16 of 70 (0.23) within 3 weeks, 5 of 36 (0.14) within 4 weeks, and 4 of 9 (0.44) within 6 weeks. The negative-to-positive conversion frequency for B. miyamotoi was similar at 0.22. Twenty-one (0.75) of 28 mice that had B. burgdorferi in the blood and 6 (0.67) of 9 mice that had B. miyamotoi in the blood had undetectable spirochetes in the blood when resampled subsequently within 3 weeks. On the basis of the conversion rates for PCR positivity in the blood, the weighted mean incidence for each species was ~0.1 cases/mouse/wk during the period of study.

Borrelia infection of the skin.

During captures later in the summer, skin biopsies of the ears, as well as blood samples, were obtained from 86 mice (Table 1). Of these mice, 65 (0.76) had skin biopsies that were positive for B. burgdorferi by PCR, and 9 (0.11) mice simultaneously had B. burgdorferi in the blood; there were no mice with B. burgdorferi in the blood but not in the skin. Opposite results were found with B. miyamotoi: only 2 (0.02) mice had a positive skin biopsy for B. miyamotoi, whereas 10 (0.12), including the two with positive skin biopsies, had B. miyamotoi in the blood. Taking the blood and tissue results together (Table 1), we observed that B. burgdorferi was more commonly present in skin than one would expect on the basis of the relative frequencies of B. burgdorferi and B. miyamotoi in the blood (OR, 17.0 [4.0–149]; P < 10 −6). When stratified by trapping period, the ear tissue infection with B. burgdorferi was associated with mass of the captured mouse (OR, 1.3 [1.1–1.7]; P = 0.01) but not with sex (OR, 2.3 [0.52–12.0]) or pelage (OR, 1.1 [0.34–4.0]).

B. burgdorferi and B. miyamotoi also differed in their cell densities in infected skin (Table 1). There were ~40-fold more B. burgdorferi in infected tissue than was found for B. miyamotoi in an equivalent volume of skin. Similar to the infection in the blood, the B. burgdorferi counts in the skin were log-normal in distribution with a peak at ~1,000 cells/mg of tissue (Figure 1C). Extrapolating the values to a gram of skin tissue, which approximates a milliliter of blood, we estimated that there were ~640,000 B. burgdorferi/g of tissue. This compares with ~50 B. burgdorferi cells in a comparable volume of blood.

Borrelia infection in sympatric I. scapularis ticks.

At the Connecticut field site, we collected 689 questing nymphs the year after the P. leucopus trapping. These nymphs represented the generation that fed on P. leucopus or other hosts as larvae the previous year. By qPCR we identified B. burgdorferi in 244 (0.35) nymphs and B. miyamotoi in 38 (0.055) nymphs (Table 1). The median counts per tick were 6,130 for B. burgdorferi and 317 forB. miyamotoi, but the distributions of counts per infected tick differed between species. The counts of B. burgdorferi in individual ticks followed a log-normal distribution with an extended tail toward lower burdens (Figure 3). In contrast, the burdens of B. miyamotoi cells in infected ticks were bimodal in distribution. Of 38 nymphs infected with B. miyamotoi, 20 (0.53) had < 100 spirochetes, which compared with only 19 (0.08) of 244 nymphs with < 100 B. burgdorferi spirochetes (OR, 13.2 [5.5–31.2]; P < 0.0001). However, among ticks with ≥ 100 spirochetes, B. miyamotoi had higher mean numbers than did B. burgdorferi: 15,171 (9,616–23,993) versus 6,412 (5,521–7,447), respectively (Table 2).

We subsequently extended this analysis by determining infection prevalences and spirochete burdens in 7,205 questing I. scapularis nymphs collected during 2004–2007. Overall, 1,477 (0.21) of ticks had detectable B. burgdorferi, and 139 (0.019) ticks, ~10-fold lower, had B. miyamotoi. The results by site as defined by geographic coordinates are summarized in Table 2. Although each of the 46 sites in this survey had some ticks infected with B. burgdorferi, 13 (0.28) of the sites did not have detectable B. miyamotoi. This may be attributable to under-determination; at 9 of these 13 sites sample sizes of ticks were between 22 and 97. There were no collection sites at which B. miyamotoi was found but not B. burgdorferi. At 19 sites at which both species were present and at least 100 ticks were collected, there was no correlation between the prevalences of B. burgdorferi and B. miyamotoi (R2 = −0.04; P = 0.59).

Figure 4 shows the distributions of log-transformed counts of B. burgdorferi or B. miyamotoi per infected tick. The results of this broader study were similar to the findings at the Connecticut site, namely an extended tail to the left for an otherwise log-normal distribution for counts of B. burgdorferi and a bimodal distribution for B. miyamotoi. The mean counts per infected tick were 3,155 (2,825–3,516) for B. burgdorferi and 4,246 (2,360–7,621) for B. miyamotoi (Kruskal-Wallis, P = 0.002), and the medians were 4,898 and 12,735, respectively. With a cut-off point of 300 (log10 = 2.48) spirochetes for dividing B. miyamotoi counts into the two parts reflected by the histogram (Figure 4), the mean for the first, lower value distribution was 32 (22–47), whereas the mean for the second was 28,576 (19,815–41,115).

We next studied the extent to which infected I. scapularis housed or reared under laboratory conditions resembled those in natural environments. For this, we first examined DNA extracts from 1,146 ticks that were originally obtained as engorged larvae on captured mammals at the Connecticut field site in 2004. 29 After repletion, the ticks were maintained in the laboratory until they molted. Eight (0.007) of the nymphs were infected with B. miyamotoi. These were originally obtained from one Eastern chipmunk (Tamias striatus), one Eastern gray squirrel (Sciurus carolinensis), three raccoons (Procyon lotor), and three pine voles (Microtus pinetorum). The mean number of B. miyamotoi per infected nymph was 2141 (4,66–19,841).

We performed qPCR on DNA extracts from 19 nymphs and 47 larvae that were the progeny of an I. scapularis female infected with B. miyamotoi in a tick-rearing facility. 12 Larvae were fed on uninfected laboratory white-footed mice to repletion, allowed to molt, and were assayed as flat nymphs. By qPCR, 36 (0.77) larvae and 16 (0.84) nymphs were infected with B. miyamotoi (OR, 1.3 [0.28–8.6]; P = 0.99). Figure 5 shows the distributions of counts of B. miyamotoi in infected larvae and nymphs in the laboratory. There was a tendency for a bimodal distribution of the counts, but it was less pronounced than what was observed in field-collected ticks. The mean counts were 2,993 (1,637–5,472) for larvae and 5,167 (2,142–12,463) for nymphs (ANOVA, P = 0.32; Kruskal-Wallis, P = 0.27). The number of B. miyamotoi in nymphs that had been infected vertically rather than horizontally was within the 95% CI of what was observed in the field-collected nymphs (see above and Figure 4).

Co-infections.

At the Connecticut field site, 5 (0.009) of 556 mouse blood samples were infected with both Borrelia species. By Poisson regression analysis, the mice infected with B. burgdorferi were at no greater risk of infection with B. miyamotoi compared with non-infected mice (OR = 1.1 [CI 0.35–2.8]; P = 0.93). Nine mice that had B. burgdorferi either in the blood or skin also had B. miyamotoi in either the blood or skin, but this was not significantly more or less than expected, under the assumption of independent transmission of each species (OR, 0.96 [0.21–6.1]). The following year there were 5 (0.007) co-infections with B. burgdorferi and B. miyamotoi in 689 questing nymphs. This was less than the 13 predicted co-infections under random expectations (OR = 0.28 [CI 0.09–0.72]; P = 0.004). Among the 1,146 ticks recovered as engorged larvae from several species of mammals at this field site and allowed to molt, 226 (0.20) were infected with B. burgdorferi and 10 (0.9%) were infected with B. miyamotoi. No co-infections were observed when the expectation was 2 (Poisson, P = 0.13).

The study of the frequency of co-infections was expanded to samples from a broad survey of field sites across the northeastern, mid-Atlantic, and north-central United States. 16 Of the 7,205 nymphs, 1,477 (0.20) overall were infected with B. burgdorferi, 139 (0.019) were infected with B. miyamotoi, and 20 (0.003) were infected with both species. The OR for a co-infection was 0.65 (0.38–1.07; P = 0.08) by year of collection. There was no apparent effect of the collecting site location on co-infection frequency either at the level of state (OR = 1.01 [0.91–1.04]) or whether the site was east or west of 80° W longitude (OR = 1.15 [0.77–1.70]). In the ticks co-infected with B. miyamotoi and B. burgdorferi, the mean spirochete count of B. miyamotoi per tick was 21,974, a value more typical of the second peak of counts of this species in ticks (Figure 4).

We also examined the subset of five sites (numbers 4, 11, 12, 35, and 44 of Table 2), at which > 400 questing nymphs were collected. These sites each had sample sizes that were comparable to the 689 nymphs collected at the Connecticut site in 2002. Of the 2,579 ticks collected, 470 (0.18) were infected with B. burgdorferi, 45 (0.017) were infected with B. miyamotoi, and 6 (0.002) were co-infected. Stratified by site, co-infection was not more or less frequent than expected (OR = 0.70 [0.24–1.73]). Thus, in the expanded study of multiple locations, there was no evidence of either positive or negative associations between B. burgdorferi and B. miyamotoi infection of nymphs.

It was possible that we underestimated the number of co-infections, because the minority member in the mixture was not fully represented as the consequence of interference or other PCR artifact. In other words, when one species was in great excess with respect to another, the PCR assay for the less numerous species may have been falsely negative or underestimated its true count. To assess the magnitude of this putative effect, we took DNA extracts of several ticks with various counts of B. miyamotoi and to these added different amounts of B. burgdorferi DNA, so that the ratios of one species to the other varied over the range of ~1:1,000 to 1,000:1. Figure 6 shows the results for measurement of B. miyamotoi in the presence of different amounts of B. burgdorferi (A) and for B. burgdorferi in presence of B. miyamotoi (B). B. miyamotoi was undercounted when its numbers were ~100 or less and B. burgdorferi was in excess by 100- or 1,000-fold. There was less of an effect of B. miyamotoi on the B. burgdorferi in the same reaction. There was a false-negative reaction only when B. burgdorferi had a count of < 10 and B. miyamotoi was in 1,000-fold excess.

We next performed a permutation study with 100 replicates in which the results of the 7,205 tick extracts of the second part of the study were randomized with respect to qPCR results for B. miyamotoi and B. burgdorferi (Table S1 of Supplementary Materials can be found online at www.ajtmh.org). In each replicate, there would be a total of 1,477 positive results for B. burgdorferi and 139 positive results for B. miyamotoi, as before (Table 2), but these were no longer linked, and co-infections occurred under random expectations. We also counted the mixtures in this simulation in which either B. burgdorferi or B. miyamotoi would have been in 100-fold or greater excess. This provided an estimate of the number of co-infections that might have gone undetected.

After 100 replicates, there was a mean of 28.1 co-infections with a central 95% range of 20.0–37.0. The mean number of mixed infections in which B. miyamotoi was the minority partner by 100 or greater fold was 4.3 (1.0–7.0); the corresponding values for B. burgdorferi were 3.8 (1.0–7.5). If we assume that, in both these circumstances, co-infections went undetected, the expected mean number of co-infections from this simulation under random conditions was 20 (13–28), which was the experimental observation from the survey.

DISCUSSION

Ecologic specialization, or niche differentiation, is hypothesized to be a mechanism for species co-existence. 33 From that broad perspective, co-existence of B. burgdorferi and B. miyamotoi in the same arthropod and mammalian species presents an interesting case for study. To that end, we compared the population and transmission dynamics of B. miyamotoi and B. burgdorferi between a local population of I. scapularis vectors and P. leucopus reservoirs in a site in southern Connecticut. To explore the generality of trends, we extended the study to other areas across northeastern and north-central United States where host-seeking I. scapularis nymphs are common. 15,16

Before comparing infections by these two species in more detail, we first consider the following: (1) the possibility that a third (or fourth) Borrelia species was present at the study sites and in both the tick vector and vertebrate host, (2) the co-occurrence of two LB Borrelia species in Europe and how this differs from what we report here, and (3) the possible contributions of other vertebrate hosts to the maintenance of B. miyamotoi.

  1. In the extended area of B. burgdorferi transmission in North America, three other Borrelia species besides B. miyamotoi conceivably could co-occur with B. burgdorferi: B. andersonii, which comprise a natural cycle involving I. dentatus and rabbits, 34,35 B. bissettii, whose cycle in the central United States involves I. spinipalpis ticks and woodrats, 36 and “B. davisii,” which we found in the blood of P. leucopus at the Connecticut field site but not in any I. scapularis ticks at the same site. 14 Given the mismatches with the probes, B. andersonii and “B. davisii” would not have been detected by qPCR, but, at the same time, neither species would be expected to be found in I. scapularis in these locations. B. bissettii would be detected by the LB species group probe, but this species was identified only once, or 0.2%, out of 430 I. scapularis extracts that were positive for B. burgdorferi and further characterized by sequencing for the 11 state survey described here (J. Bunikis and A. G. Barbour, unpublished data). Given these findings and the circumstances of the study, we concluded that only B. burgdorferi and B. miyamotoi were to be expected in I. scapularis and P. leucopus.

  2. In Europe, co-occurrence of two or more Borrelia species of LB agents in the same ticks is well documented. 3739 However, there are important differences between that phenomenon from what we report here on the co-existence of B. burgdorferi and B. miyamotoi. For one, co-existing B. garinii and B. afzelii tend to differ in their ranges of preferred vertebrate hosts 40 and not so much in their behavior in their vertebrate hosts of choice. Namely, both B. garinii and B. afzelii, like B. burgdorferi, are characterized by a transient, low-density bacteremia followed by persistence in the skin. 4143 Furthermore, B. afzelii and B. garinii have similar burdens in I. ricinus ticks.30,32 Unlike the case of B. miyamotoi, vertical transmission, if it occurs at all, is inefficient. 17,19

  3. Under both experimental and natural conditions, B. burgdorferi infects many species of vertebrates, several of which serve as competent reservoirs. 44 In this respect B. burgdorferi is a “generalist” pathogen. 45 Less is known of the host range for B. miyamotoi. Most vectors for the RF group of species are nidicolous and, not surprisingly, relapsing fever agents are often specialists for the mammalian species that inhabit the burrows or nests infested with the ticks.2 On the other hand, B. miyamotoi uses a vector that seeks out hosts and successfully feeds on a variety of vertebrate species. Plausibly, there are other reservoirs for B. miyamotoi besides P. leucopus. In support of this suggestion was the report of Krampitz 46 in 1986 of a “European hard tick spirochete,” which, in retrospect, was probably B. miyamotoi. This uncultivable organism had two characteristics that were atypical for LB species: transovarial transmission and high peak densities in the blood of infected mammals. Stanek and others 47 described a Borrelia species from I. ricinus ticks with similar characteristics in laboratory animals and more recently confirmed this to be B. miyamotoi (G. Stanek, personal communication). The potential range for reservoir hosts for this species includes voles, gerbils, and rabbits, 46,47 in addition to mice. 12,14 There are also reports that B. miyamotoi infects large mammals, such as deer and cattle 48,49 (G. Hickling, personal communication). Although we cannot rule out an important role for another vertebrate species for maintenance of B. miyamotoi, this study focuses on the reservoir P. leucopus.

Infection of P. leucopus.

Mice were captured and re-captured at the Connecticut field site over the course of a transmission season. The study was carried out on mice on control grids from a vaccination study. 15 Re-captured mice would have received the control antigen and adjuvant 3–6 weeks previously. Prior vaccination was associated with increased frequency of B. burgdorferi but not B. miyamotoi in the blood. Co-variant with the higher frequency of B. burgdorferi infections were the generally larger sizes and greater ages of the vaccinated group when matched by day of capture to unvaccinated animals. The higher infection prevalence may be attributable to the greater cumulative likelihood of infection for older mice, as noted by Bunikis and others. 27 In any case, there was no evidence that prior vaccination affected the course of infection; among infected mice, burdens of B. burgdorferi were the same for vaccinated and non-vaccinated mice. Although we cannot rule out a confounding effect of control vaccination, we had not previously noted discernible effects of this control vaccination on B. burgdorferi infection of P. leucopus,15,22 and we think it unlikely that there was a differential effect of the vaccination with the negative control antigen on B. miyamotoi and B. burgdorferi dynamics.

Under these experimental conditions, the findings on infection prevalence and spirochete burdens in blood samples and ear biopsies indicated that B. burgdorferi produces a transient, low-density bacteremia and a more persistent, higher density infection of the skin. In contrast, B. miyamotoi was in higher densities in the blood among bacteremic animals, but in lesser amounts in the skin than B. burgdorferi. From the data on recaptured mice, the duration of bacteremia for B. miyamotoi seems to be similar to that B. burgdorferi. However, with its lower burdens in skin, the opportunity for horizontal transmission of B. miyamotoi may be restricted to the period of bacteremia. In contrast, for B. burgdorferi transmission P. leucopus remain infectious for larvae and nymphs long after spirochetes have been cleared from the blood. 41,50 A narrower window for transmission of B. miyamotoi by an infected mammal may be one explanation for the lower overall prevalence of this species in ticks.

Not with standing these differences, the seasonal dynamics of infection of the blood of reservoir mice with B. burgdorferi and B. miyamotoi correlated with the activity patterns of, respectively, nymphal and larval ticks at the Connecticut study site. The prevalence of B. burgdorferi infection of the blood of the mice waned with decreasing activity of the nymphs during the second half of the summer. Meanwhile, the increase in the prevalence of B. miyamotoi infection of the mice coincided with peak activity of larvae (Figure 2). This is consistent with transmission from larvae that had been vertically infected with B. miyamtoi, as discussed below.

The apparent seasonality of B. burgdorferi bacteremia conceivably could be attributable to an increasing proportion of non-susceptibles in the population of mice as they become immune. However, our previous study of the Connecticut field site indicated that P. leucopus have serial infections, as would be expected for a pathogen for which immunity is largely strain specific. 27 A given mouse may be protected against re-infection by the same strain, but it would remain at risk of infection by other strains throughout the year.

Infection of I. scapularis.

Borrelia miyamotoi infects I. scapularis ticks in the northeastern United States, 12,15,51 I. pacificus in California, 11 and I. ricinus in Sweden, 9,30 Germany, 52 and the Czech Republic. 53 At these diverse locations, the prevalence of infection in nymphs was usually 0.5–3% and seldom > 4%. In all these surveys, at least one LB species co-existed with B. miyamotoi in ticks at the collecting sites and usually in ratios of ~10:1 for infection prevalences. In the survey of host-seeking I. scapularis nymphs in 11 states, we observed similar results. Mean prevalences for 46 sites over the 4-year period of study were 0.19 for B. burgdorferi and 0.019 for B. miyamotoi overall. The failure to record B. miyamotoi at some locations is plausibly attributable to undersampling; at sites with detectable B. burgdorferi but not B. miyamotoi, the sample sizes of collected ticks were lower than the overall average.

The differential in prevalences between the two Borrelia species seems to be even greater in adult ticks. Prevalences of B. burgdorferi in adult I. scapularis are generally ~2-fold higher than in nymphs, which is attributable to the cumulative risk of infection with each feeding. 54,55 In contrast, prevalences of B. miyamotoi were about the same in adults and nymphs among I. pacificus populations in the far-western United States 11 and adult I. scapularis populations in the north-central United States (S. Hamer and J. Tsao, unpublished data).

Among infected nymphs, the distributions of counts of B. burgdorferi spirochetes in the nymphs were similar at the Connecticut field site and the collecting at other locations in the larger survey (Figures 3 and 4). The majority of infected questing nymphs had between 1,000 and 10,000 B. burgdorferi; the mean was 3,155 for the large survey. Using a qPCR procedure with primers for the recA gene of B. burgdorferi but without a probe, Wang and others 56 reported a mean of 1,964 spirochetes per tick among 91 infected nymphal I. scapularis from the northeastern United States. We had previously found a mean of 2,240 spirochetes per infected nymph using a reverse transcriptase-PCR assay for ribosomal RNA. 57 The PCR-derived values for B. burgdorferi burdens in I. scapularis were similar to previous findings using antigen detection; Brunet and others 58 observed that infected nymphs in Massachusetts had ~2,000 spirochetes, and Burkot and others 59 reported that infected adults from New York had ~5,000 spirochetes per tick.

B. miyamotoi was notable for the bimodal distribution of its counts in questing nymphs at both the Connecticut site (Figure 3) and other locations (Figure 4). This distribution was not observed for blood and tissue counts of B. miyamotoi. When we first observed this phenomenon in the ticks, we asked whether the peak with lower counts represented spirochete burdens in congenitally infected ticks. This may still be the explanation for ticks under natural conditions, but the subsequent study of laboratory-reared I. scapularis infected vertically with B. miyamotoi showed a log-normal distribution with only one discernible peak, and there was no difference between larvae and nymphs (Figure 5). Thus, the relationship between B. miyamotoi burdens in tick and the likelihood of transmission at its next feeding remains to be determined.

Co-infections.

Infections of a P. leucopus mouse with both B. miyamotoi and B. burgdorferi were not more or less common than expected on the basis of the frequencies of the individual species at the Connecticut site. At the Connecticut field site, co-infections of questing I. scapularis nymphs were less common than expected for that year, but this evidence of a negative association was not confirmed either in the study of ticks removed from mammals at the same field site or when a much larger sample of > 7,000 ticks from the 4-year, 11-state survey was examined and stratified by year and location. In the later analysis, the 95% CIs for the ORs were narrow enough to exclude strong or moderate interactions between the two Borrelia species.

In experiments in which the ratios of one species to the other in the multiplex qPCR were varied over a wide range, there was reduced detection of the minor population at extreme ratios. Thus, it is possible that we did not identify some co-infections when one species was in much lower numbers than the other in a given tick. However, when we assumed that co-infections with ratios of ≥ 100 between the species’ counts were under-determined, the multiple-replicate simulation under random expectations yielded a mean number for co-infections that was the same that we observed in the multi-state survey. Although we cannot rule out a weak association, either positive or negative, between B. miyamotoi and B. burgdorferi in ticks and/or vertebrates, the preponderance of evidence supports the conclusion that the infections are largely independent. Our thesis is that this independence is attributable to the different niches that B. miyamotoi and B. burgdorferi exploit.

Transovarial transmission of B. miyamotoi.

Scoles and others 12 reported that vertical transmission of B. miyamotoi in the laboratory was common and found filial infection prevalences among larvae of 0.06 to 0.73. In this study, which used a sensitive qPCR, filial infection frequency in larvae was 0.77. Transovarial transmission of B. burgdorferi in I. scapularis is either nonexistent or rare. 1719 The infection of unfed larvae is prima facie evidence for a different niche for B. miyamotoi from that of B. burgdorferi in ticks. This, along with the evidence of a different niche for the spirochetes in P. leucopus distinguishes B. miyamotoi from B. burgdorferi and serve to separate their fates.

When the distribution of B. miyamotoi spirochetes in the tissues of ticks is studied, we predict that this species’ cells will be more widely distributed in unfed ticks than is the case for B. burgdorferi, which is predominantly found in the midgut of flat nymphs. 60,61 Supporting evidence was the earlier observation by Lane and Burgdorfer 62 that transovarially transmitted spirochetes in I. pacificus were distributed throughout the larva’s tissues. These spirochetes were probably B. miyamotoi, because they were not bound by a monoclonal antibody that was specific for B. burgdorferi,63 and B. miyamotoi is now known to occur in these ticks. 11

Although many of the details of the life cycle of B. burgdorferi and related species remain to be characterized, the basic features of the natural history of this microorganism are understood.3 This is not the case for B. miyamotoi, which is representative of a newly described group of species that resemble relapsing fever species in some ways and Lyme borreliosis species in others. Like B. hermsii and most other relapsing fever species,2 B. miyamotoi enhances its fitness by the strategy of transovarial transmission. The association between bacteremia with B. miyamotoi and larval activity was evidence for this (Figure 2). However, with filial infection frequencies of < 0.80, vertical transmission alone will likely not suffice for maintenance in the environment for more than a few generations. 64 Horizontal amplification of B. miyamotoi occurs in vertebrates, as has been documented with P. leucopus in the laboratory 12 and under natural conditions by this study. However, the limited empiric findings to date suggest that this mode of transmission seems to be less efficient for B. miyamotoi than for B. burgdorferi. Better understanding of how B. miyamotoi is maintained enzootically calls for further clarification of the relative importance of vertical and horizontal transmission by this species.

Table 1

Prevalence and burdens of B. burgdorferi (Bb) and B. miyamotoi (Bm) in P. leucopus mice and I. scapularis nymphs at the Connecticut field site

Table 1
Table 2

Prevalences of B. burgdorferi and B. miyamotoi in I. scapularis nymphs by location

Table 2
Figure 1.
Figure 1.

Frequency histograms of quantitative PCR counts spirochetes of B. burgdorferi (A) and B. miyamotoi (B) in the blood and of B. burgdorferi (C) in the ear biopsy tissue of P. leucopus mice at Connecticut field site.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

Figure 2.
Figure 2.

Tick infestations and infections of the blood of P. leucopus by trapping period. A, Prevalence of I. scapularis larvae and nymph infestations. B, Prevalence of B. burgdorferi and B. miyamotoi bacteremia as detected by species-specific quantitative PCR. The number of captured mice for trapping periods 1, 2, 3, and 4 were 110, 170, 162, and 101, respectively. This figure appears in color at www.ajtmh.org.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

Figure 3.
Figure 3.

Frequency histograms of quantitative PCR counts of spirochetes of B. burgdorferi (A) or B. miyamotoi (B) in infected host-seeking I. scapularis nymphs at Connecticut field site.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

Figure 4.
Figure 4.

Frequency histograms of quantitative PCR counts of spirochetes of B. burgdorferi (A) or B. miyamotoi (B) in infected host-seeking I. scapularis nymphs at 46 sites in the northeastern and north-central United States.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

Figure 5.
Figure 5.

Frequency histograms of quantitative PCR counts of spirochetes of B. miyamotoi in infected larvae (A) and nymphs (B) of laboratory-reared I. scapularis.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

Figure 6.
Figure 6.

Standard curves of quantitative PCR of B. miyamotoi (A) and B. burgdorferi (B) DNA in mixtures at various ratios. To DNA extracts of I. scapularis, nymphs with different amounts of B. miyamotoi were added equal volume aliquots of B. burgdorferi DNA in different concentrations. The NH4OH method of extraction of DNA from ticks was used as described in the Materials and Methods section. This figure appears in color at www.ajtmh.org.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 81, 6; 10.4269/ajtmh.2009.09-0208

*

Address correspondence to Alan G. Barbour, University of California Irvine, 3012 Hewitt, Irvine, CA 92697-4028. E-mail: abarbour@uci.edu

Note: Supplemental Table appears online at www.ajtmh.org.

Authors’ addresses: Alan G. Barbour, University of California Irvine, 3012 Hewitt, Irvine, CA 92697-4028, Tel: 949-824-5626, Fax: 949-824-5490, E-mail: abarbour@uci.edu. Jonas Bunikis (University of California Irvine), Research Directorate General, Directorate F- Health; Unit 3-Infectious Diseases, Rue du Champs de Mars 21; CDMA 2/138, B-1050 Bruxelles, Belgium, Tel: 32-2-2962074, Fax: 32-2-2962074, E-mail: Jonas.BUNIKIS@ec.europa.eu. Bridgit Travinsky, University of California Irvine, 3012 Hewitt, Irvine, CA 92697-4028, Tel: 949-824-3737, Fax: 949-824-5490, E-mail: btravins@uci.edu. Anne Gatewood Hoen (Yale University), Children’s Hospital Informatics Program, Harvard-MIT Division of Health Sciences, Boston, MA 02215, Tel: 857-218-4027, Fax: 617-730-0267, E-mail: anne.gatewood@childrens.harvard.edu. Maria A. Diuk-Wasser, Department of Epidemiology and Public Health, Yale University School of Public Health, New Haven, CT 06520, Tel: 203-785-4434, Fax: 203-785-3604, E-mail: maria. diuk@yale.edu. Durland Fish, Department of Epidemiology and Public Health, Yale University School of Public Health, New Haven, CT 06520, Tel: 203-785-3525, Fax: 203-785-3604, E-mail: Durland.Fish@yale.edu. Jean I. Tsao, Departments of Fisheries and Wildlife and Large Animal Clinical Sciences, Michigan State University, East Lansing, MI 48824, Tel: 517-353-1737, Fax: 517-432-1699, E-mail: tsao@msu.edu.

Acknowledgments: The authors thank Klara Hanincova and Lindsay Rollend for providing DNA extracts of ticks, Hany Mattaous, Lily Shebani, and Paul Vu for technical assistance, and Sarah Hamer, Graham Hickling, Roberto Cortinas, Michelle Rowland, Uriel Kitron, and numerous field technicians for tick collections and identification.

Financial support: This work was supported by NIH Grants AI24424 and AI37248 (A.G.B.), CDC cooperative agreement CI 00171-01 (D.F.), USDA-ARS cooperative agreement # 58-0790-5-068 (D.F.), G. Harold and Leila Y. Mathers Charitable Foundation (D.F.), a Centers for Disease Control Fellowship Training Program in Vector-Borne Diseases (A.G.H.), and patent royalties donated for research (A.G.B.)

REFERENCES

  • 1

    Barbour AG, 2001. Borrelia: a diverse and ubiquitous genus of tick-borne pathogens. Scheld WM, Craig WA, Hughes JM, eds. Emerging Infections 5. Washington, DC: American Society for Microbiology Press, 153–174.

  • 2

    Barbour AG, 2005. Relapsing fever. Goodman JL, Dennis D, Sonenshine DE, eds. Tick-Borne Diseases of Humans. Washington, DC: ASM Press, 268–291.

  • 3

    Steere AC, Coburn J, Glickstein L, 2005. Lyme borreliosis. Goodman JL, Dennis D, Sonenshine DE, eds. Tick-Borne Diseases of Humans. Washington, DC: ASM Press, 176–206.

  • 4

    Rich SM, Armstrong PM, Smith RD, Telford SR 3rd, 2001. Lone star tick-infecting borreliae are most closely related to the agent of bovine borreliosis. J Clin Microbiol 39 :494–497.

    • Search Google Scholar
    • Export Citation
  • 5

    Barbour AG, Maupin GO, Teltow GJ, Carter CJ, Piesman J, 1996. Identification of an uncultivable Borrelia species in the hard tick Amblyomma americanum: possible agent of a Lyme disease-like illness. J Infect Dis 173 :403–409.

    • Search Google Scholar
    • Export Citation
  • 6

    Armstrong PM, Rich SM, Smith RD, Hartl DL, Spielman A, Telford SR 3rd, 1996. A new Borrelia infecting Lone Star ticks. Lancet 347 :67–68.

    • Search Google Scholar
    • Export Citation
  • 7

    Varela-Stokes AS, 2007. Transmission of bacterial agents from lone star ticks to white-tailed deer. J Med Entomol 44 :478–483.

  • 8

    Bunikis J, Tsao J, Garpmo U, Berglund J, Fish D, Barbour AG, 2004. Typing of Borrelia relapsing fever group strains. Emerg Infect Dis 10 :1661–1664.

    • Search Google Scholar
    • Export Citation
  • 9

    Fraenkel CJ, Garpmo U, Berglund J, 2002. Determination of novel Borrelia genospecies in Swedish Ixodes ricinus ticks. J Clin Microbiol 40 :3308–3312.

    • Search Google Scholar
    • Export Citation
  • 10

    Fukunaga M, Takahashi Y, Tsuruta Y, Matsushita O, Ralph D, McClelland M, Nakao M, 1995. Genetic and phenotypic analysis of Borrelia miyamotoi sp. nov., isolated from the ixodid tick Ixodes persulcatus, the vector for Lyme disease in Japan. Int J Syst Bacteriol 45 :804–810.

    • Search Google Scholar
    • Export Citation
  • 11

    Mun J, Eisen RJ, Eisen L, Lane RS, 2006. Detection of a Borrelia miyamotoi sensu lato relapsing-fever group spirochete from Ixodes pacificus in California. J Med Entomol 43 :120–123.

    • Search Google Scholar
    • Export Citation
  • 12

    Scoles GA, Papero M, Beati L, Fish D, 2001. A relapsing fever group spirochete transmitted by Ixodes scapularis ticks. Vector Borne Zoonotic Dis 1 :21–34.

    • Search Google Scholar
    • Export Citation
  • 13

    Varela AS, Luttrell MP, Howerth EW, Moore VA, Davidson WR, Stallknecht DE, Little SE, 2004. First culture isolation of Borrelia lonestari, putative agent of southern tick-associated rash illness. J Clin Microbiol 42 :1163–1169.

    • Search Google Scholar
    • Export Citation
  • 14

    Bunikis J, Barbour AG, 2005. Third Borrelia species in white-footed mice. Emerg Infect Dis 11 :1150–1151.

  • 15

    Tsao JI, Wootton JT, Bunikis J, Luna MG, Fish D, Barbour AG, 2004. An ecological approach to preventing human infection: vaccinating wild mouse reservoirs intervenes in the Lyme disease cycle. Proc Natl Acad Sci USA 101 :18159–18164.

    • Search Google Scholar
    • Export Citation
  • 16

    Gatewood AG, Liebman KA, Vourc’h G, Bunikis J, Hamer SA, Cortinas R, Melton F, Cislo P, Kitron U, Tsao J, Barbour AG, Fish D, Diuk-Wasser MA, 2009. Climate and tick seasonality predict Borrelia burgdorferi genotype distribution. Appl Environ Microbiol 75 :2476–2483.

    • Search Google Scholar
    • Export Citation
  • 17

    Zhioua E, Aeschlimann A, Gern L, 1994. Infection of field-collected Ixodes ricinus (Acari: Ixodidae) larvae with Borrelia burgdorferi in Switzerland. J Med Entomol 31 :763–766.

    • Search Google Scholar
    • Export Citation
  • 18

    Patrican LA, 1997. Absence of Lyme disease spirochetes in larval progeny of naturally infected Ixodes scapularis (Acari:Ixodidae) fed on dogs. J Med Entomol 34 :52–55.

    • Search Google Scholar
    • Export Citation
  • 19

    Nefedova VV, Korenberg EI, Gorelova NB, Kovalevskii YV, 2004. Studies on the transovarial transmission of Borrelia burgdorferi sensu lato in the taiga tick Ixodes persulcatus. Folia Parasitol (Praha) 51 :67–71.

    • Search Google Scholar
    • Export Citation
  • 20

    Schwan TG, Battisti JM, Porcella SF, Raffel SJ, Schrumpf ME, Fischer ER, Carroll JA, Stewart PE, Rosa P, Somerville GA, 2003. Glycerol-3-phosphate acquisition in spirochetes: distribution and biological activity of glycerophosphodiester phosphodiesterase (GlpQ) among Borrelia species. J Bacteriol 185 :1346–1356.

    • Search Google Scholar
    • Export Citation
  • 21

    Ramakrishnan U, 2001. Methods of controlling white-tailed deer. Front Plant Sci 53 :7.

  • 22

    Tsao J, Barbour AG, Luke CJ, Fikrig E, Fish D, 2001. OspA immunization decreases transmission of Borrelia burgdorferi spirochetes from infected Peromyscus leucopus mice to larval Ixodes scapularis ticks. Vector Borne Zoonotic Dis 1 :65–74.

    • Search Google Scholar
    • Export Citation
  • 23

    Sinsky RJ, Piesman J, 1989. Ear punch biopsy method for detection and isolation of Borrelia burgdorferi from rodents. J Clin Microbiol 27 :1723–1727.

    • Search Google Scholar
    • Export Citation
  • 24

    Pennington PM, Allred CD, West CS, Alvarez R, Barbour AG, 1997. Arthritis severity and spirochete burden are determined by serotype in the Borrelia turicatae-mouse model of Lyme disease. Infect Immun 65 :285–292.

    • Search Google Scholar
    • Export Citation
  • 25

    Falco RC, Fish D, 1992. A comparison of methods for sampling the deer tick, Ixodes dammini, in a Lyme disease endemic area. Exp Appl Acarol 14 :165–173.

    • Search Google Scholar
    • Export Citation
  • 26

    Diuk-Wasser MA, GatewoodAG, Cortinas MR,Yaremych-Hamer S, Tsao J, Kitron U, Hickling G, Brownstein JS, Walker E, Piesman J, Fish D, 2006. Spatiotemporal patterns of host-seeking Ixodes scapularis nymphs (Acari: Ixodidae) in the United States. J Med Entomol 43 :166–176.

    • Search Google Scholar
    • Export Citation
  • 27

    Bunikis J, Tsao J, Luke CJ, Luna MG, Fish D, Barbour AG, 2004. Borrelia burgdorferi infection in a natural population of Peromyscus leucopus mice: a longitudinal study in an area where Lyme borreliosis is highly endemic. J Infect Dis 189 :1515–1523.

    • Search Google Scholar
    • Export Citation
  • 28

    Beati L, Keirans JE, 2001. Analysis of the systematic relationships among ticks of the genera Rhipicephalus and Boophilus (Acari: Ixodidae) based on mitochondrial 12S ribosomal DNA gene sequences and morphological characters. J Parasitol 87 :32–48.

    • Search Google Scholar
    • Export Citation
  • 29

    Hanincova K, Kurtenbach K, Diuk-Wasser M, Brei B, Fish D, 2006. Epidemic spread of Lyme borreliosis, northeastern United States. Emerg Infect Dis 12 :604–611.

    • Search Google Scholar
    • Export Citation
  • 30

    Comstedt P, Bergstrom S, Olsen B, Garpmo U, Marjavaara L, Mejlon H, Barbour AG, Bunikis J, 2006. Migratory passerine birds as reservoirs of Lyme borreliosis in Europe. Emerg Infect Dis 12 :1087–1095.

    • Search Google Scholar
    • Export Citation
  • 31

    Barbour AG, 1984. Isolation and cultivation of Lyme disease spirochetes. Yale J Biol Med 57 :521–525.

  • 32

    Bunikis J, Garpmo U, Tsao J, Berglund J, Fish D, Barbour AG, 2004. Sequence typing reveals extensive strain diversity of the Lyme borreliosis agents Borrelia burgdorferi in North America and Borrelia afzelii in Europe. Microbiology 150 :1741–1755.

    • Search Google Scholar
    • Export Citation
  • 33

    Hutchinson G, 1959. Homage to Santa Rosalia or why are there so many kinds of animals? Am Nat 93 :145–159.

  • 34

    Anderson JF, Flavell RA, Magnarelli LA, Barthold SW, Kantor FS, Wallich R, Persing DH, Mathiesen D, Fikrig E, 1996. Novel Borrelia burgdorferi isolates from Ixodes scapularis and Ixodes dentatus ticks feeding on humans. J Clin Microbiol 34 :524–529.

    • Search Google Scholar
    • Export Citation
  • 35

    Goethert HK, Telford SR 3rd, 2003. Enzootic transmission of Babesia divergens among cottontail rabbits on Nantucket Island, Massachusetts. Am J Trop Med Hyg 69 :455–460.

    • Search Google Scholar
    • Export Citation
  • 36

    Schneider BS, Zeidner NS, Burkot TR, Maupin GO, Piesman J, 2000. Borrelia isolates in Northern Colorado identified as Borrelia bissettii. J Clin Microbiol 38 :3103–3105.

    • Search Google Scholar
    • Export Citation
  • 37

    Rijpkema S, Golubic D, Molkenboer M, Verbeek-De Kruif N, Schellekens J, 1996. Identification of four genomic groups of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected in a Lyme borreliosis endemic region of northern Croatia. Exp Appl Acarol 20 :23–30.

    • Search Google Scholar
    • Export Citation
  • 38

    Kurtenbach K, De Michelis S, Sewell HS, Etti S, Schafer SM, Hails R, Collares-Pereira M, Santos-Reis M, Hanincova K, Labuda M, Bormane A, Donaghy M, 2001. Distinct combinations of Borrelia burgdorferi sensu lato genospecies found in individual questing ticks from Europe. Appl Environ Microbiol 67 :4926–4929.

    • Search Google Scholar
    • Export Citation
  • 39

    Vennestrom J, Egholm H, Jensen PM, 2008. Occurrence of multiple infections with different Borrelia burgdorferi genospecies in Danish Ixodes ricinus nymphs. Parasitol Int 57 :32–37.

    • Search Google Scholar
    • Export Citation
  • 40

    Kurtenbach K, Hanincova K, Tsao JI, Margos G, Fish D, Ogden NH, 2006. Fundamental processes in the evolutionary ecology of Lyme borreliosis. Nat Rev Microbiol 4 :660–669.

    • Search Google Scholar
    • Export Citation
  • 41

    Donahue JG, Piesman J, Spielman A, 1987. Reservoir competence of white-footed mice for Lyme disease spirochetes. Am J Trop Med Hyg 36 :92–96.

    • Search Google Scholar
    • Export Citation
  • 42

    Richter D, Klug B, Spielman A, Matuschka FR, 2004. Adaptation of diverse lyme disease spirochetes in a natural rodent reservoir host. Infect Immun 72 :2442–2444.

    • Search Google Scholar
    • Export Citation
  • 43

    Hanincova K, Ogden NH, Diuk-Wasser M, Pappas CJ, Iyer R, Fish D, Schwartz I, Kurtenbach K, 2008. Fitness variation of Borrelia burgdorferi sensu stricto strains in mice. Appl Environ Microbiol 74 :153–157.

    • Search Google Scholar
    • Export Citation
  • 44

    Piesman J, Gern L, 2004. Lyme borreliosis in Europe and North America. Parasitology 129 (Suppl):S191–S220.

  • 45

    Woolhouse ME, Taylor LH, Haydon DT, 2001. Population biology of multihost pathogens. Science 292 :1109–1112.

  • 46

    Krampitz HE, 1986. In vivo isolation and maintenance of some wild strains of European hard tick spirochetes in mammalian and arthropod hosts. A parasitologist’s view. Zentralbl Bakteriol Mikrobiol Hyg [A] 263 :21–28.

    • Search Google Scholar
    • Export Citation
  • 47

    Stanek G, Burger I, Hirschl A, Wewalka G, Radda A, 1986. Borrelia transfer by ticks during their life cycle. Studies on laboratory animals. Zentralbl Bakteriol Mikrobiol Hyg [A] 263 :29–33.

    • Search Google Scholar
    • Export Citation
  • 48

    Richter D, Matuschka FR, 2006. Modulatory effect of cattle on risk for Lyme disease. Emerg Infect Dis 12 :1919–1923.

  • 49

    Wodecka B, 2007. [Significance of red deer (Cervus elaphus) in the ecology of Borrelia burgdorferi sensu lato]. Wiad Parazytol 53 :231–237.

    • Search Google Scholar
    • Export Citation
  • 50

    Burgdorfer W, Gage KL, 1987. Susceptibility of the hispid cotton rat (Sigmodon hispidus) to the Lyme disease spirochete (Borrelia burgdorferi). Am J Trop Med Hyg 37 :624–628.

    • Search Google Scholar
    • Export Citation
  • 51

    Ullmann AJ, Gabitzsch ES, Schulze TL, Zeidner NS, Piesman J, 2005. Three multiplex assays for detection of Borrelia burgdorferi sensu lato and Borrelia miyamotoi sensu lato in field-collected Ixodes nymphs in North America. J Med Entomol 42 :1057–1062.

    • Search Google Scholar
    • Export Citation
  • 52

    Richter D, Schlee DB, Matuschka FR, 2003. Relapsing fever-like spirochetes infecting European vector tick of Lyme disease agent. Emerg Infect Dis 9 :697–701.

    • Search Google Scholar
    • Export Citation
  • 53

    Hulinska D, Votypka J, Kriz B, Holinkova N, Novakova J, Hulinsky V, 2007. Phenotypic and genotypic analysis of Borrelia spp. isolated from Ixodes ricinus ticks by using electrophoretic chips and real-time polymerase chain reaction. Folia Microbiol (Praha) 52 :315–324.

    • Search Google Scholar
    • Export Citation
  • 54

    Anderson JF, Magnarelli LA, Burgdorfer W, Barbour AG, 1983. Spirochetes in Ixodes dammini and mammals from Connecticut. Am J Trop Med Hyg 32 :818–824.

    • Search Google Scholar
    • Export Citation
  • 55

    Walker ED, Smith TW, DeWitt J, Beaudo DC, McLean RG, 1994. Prevalence of Borrelia burgdorferi in host-seeking ticks (Acari: Ixodidae) from a Lyme disease endemic area in northern Michigan. J Med Entomol 31 :524–528.

    • Search Google Scholar
    • Export Citation
  • 56

    Wang G, Liveris D, Brei B, Wu H, Falco RC, Fish D, Schwartz I, 2003. Real-time PCR for simultaneous detection and quantification of Borrelia burgdorferi in field-collected Ixodes scapularis ticks from the Northeastern United States. Appl Environ Microbiol 69 :4561–4565.

    • Search Google Scholar
    • Export Citation
  • 57

    Ornstein K, Barbour AG, 2006. A reverse transcriptase-polymerase chain reaction assay of Borrelia burgdorferi 16S rRNA for highly sensitive quantification of pathogen load in a vector. Vector Borne Zoonotic Dis 6 :103–112.

    • Search Google Scholar
    • Export Citation
  • 58

    Brunet LR, Spielman A, Telford SR 3rd, 1995. Short report: density of Lyme disease spirochetes within deer ticks collected from zoonotic sites. Am J Trop Med Hyg 53 :300–302.

    • Search Google Scholar
    • Export Citation
  • 59

    Burkot TR, Patrican L, Piesman J, 1994. Field trial of an outer surface protein A (OspA) antigen-capture enzyme-linked immunosorbent assay (ELISA) to detect Borrelia burgdorferi in Ixodes scapularis. Am J Trop Med Hyg 50 :354–358.

    • Search Google Scholar
    • Export Citation
  • 60

    Burgdorfer W, Barbour AG, Hayes SF, Benach JL, Grunwaldt E, Davis JP, 1982. Lyme disease—a tick-borne spirochetosis? Science 216 :1317–1319.

    • Search Google Scholar
    • Export Citation
  • 61

    De Silva AM, Fikrig E, 1995. Growth and migration of Borrelia burgdorferi in Ixodes ticks during blood feeding. Am J Trop Med Hyg 53 :397–404.

    • Search Google Scholar
    • Export Citation
  • 62

    Lane RS, Burgdorfer W, 1987. Transovarial and transstadial passage of Borrelia burgdorferi in the western black-legged tick, Ixodes pacificus (Acari: Ixodidae). Am J Trop Med Hyg 37 :188–192.

    • Search Google Scholar
    • Export Citation
  • 63

    Burgdorfer W, Lane RS, Barbour AG, Gresbrink RA, Anderson JR, 1985. The western black-legged tick, Ixodes pacificus: a vector of Borrelia burgdorferi. Am J Trop Med Hyg 34 :925–930.

    • Search Google Scholar
    • Export Citation
  • 64

    Fine PE, 1975. Vectors and vertical transmission: an epidemiologic perspective. Ann N Y Acad Sci 266 :173–194.

Author Notes

Reprint requests: Alan Barbour, University of California Irvine, 3012 Hewitt, Irvine, CA 92697-4028.
Save