INTRODUCTION
In 2002, the WHO estimated that 1.4 million deaths among children younger than 5 years old were caused by diseases preventable by routine vaccination (http://www.who.int). Tetanus accounted for ~200,000 of these fatalities. Tetanus vaccination is standard in developed countries; it is inexpensive, highly protective, and proven to lower incidence of the disease.1 However, many people in parts of Africa and Southeast Asia are still at risk from this life-threatening preventable disease. 2,3
The causative agent of tetanus is the gram-positive, spore-forming, obligate anaerobic bacterium, Clostridium tetani.4 C. tetani spores are ubiquitous throughout nature and can be isolated in soil and feces from animals and humans.5 The spores are notoriously resilient and able to withstand many environmental factors, such as prolonged exposure to temperatures in excess of 100°C.
The common inoculation route of a C. tetani infection is a deep tissue wound that becomes contaminated with soil or fecal matter containing spores. The anaerobic conditions found within necrotic tissue provide the ideal environment for the bacteria to replicate. As the bacteria replicate in the wound, those that have the required genes produce and secrete two exotoxins: tetanolysin and tetanus neurotoxin. Tetanolysin is thought to optimize conditions within the wound, whereas tetanus neurotoxin is one of the most potent neurotoxins known.6 It is the effect of tetanus neurotoxin on the central nervous system that causes clinical tetanus. For extensive reviews of clinical tetanus, the action of the neurotoxin, and treatment, readers are directed to Cook and others7 and Farrar and others.8
Little clinical microbiologic research has been carried out on C. tetani in the last few decades, because of the disease being diagnosed symptomatically rather than microbiologically. Much of the research of C. tetani has focused on the toxins, 9,10 and despite the publication of the genome sequence in 2003, relatively little is known about the organism. 11 Antimicrobial susceptibility patterns of C. tetani have never been assessed. Antimicrobial treatment depends on an historical assumption on the efficiency of penicillin to clear the wound site of persistent C. tetani organisms.
We wished to assess culture techniques and antimicrobial sensitivity patterns of patients with clinically diagnosed tetanus. Therefore, we measured disease severity of patients, collected wound swabs from obvious entry sites, and attempted to isolate C. tetani and other contaminating bacteria. In this clinical microbiologic study, we measured the susceptibility patterns of the 45 C. tetani isolates to a range of common antimicrobial agents.
MATERIALS AND METHODS
Study design.
The study was performed at the Hospital for Tropical Diseases, Ho Chi Minh City, Viet Nam. The Hospital for Tropical Diseases is an ~500-bed infectious diseases hospital, which is a specialist referral hospital for the southern provinces of Viet Nam and the local community. Adults, children, and neonates with tetanus are referred to a designated ward purely for the management of tetanus. The ward admits > 200 patients annually.1 At the time of diagnosis, standard treatment was intramuscular injection of tetanus antitoxin at a concentration of 20,000 IU, intravenous penicillin (100,000–200,000 IU/kg/day for 7–10 days), and debridement of the wound. 12 All patients needed intensive care, and many patients needed a tracheotomy, mechanical ventilation, and additional antibiotics for nosocomial infections. This study was approved by the Scientific and Ethical Committee of the Hospital for Tropical Diseases.
Wound swabs were taken from 84 adults and children diagnosed with severe tetanus at the time of wound debridement over a 6-month period in 2007; most wounds were generally deep puncture tissue injuries. Additionally, some swabs were taken from both the pinnae (in ear-piercing wounds) and from the internal meatal cuff (in cases of otitis external or otitis media). Some basic clinical details of the patients from whom C. tetani was isolated are shown in Table 1. These data include the severity of the infection (according to Ablett’s classification of severity in tetanus, ranging from I [least severe] to IV [most severe]), treatment, outcome, site of infection, and the number of days of treatment before a positive isolation of the organism.
Microbiologic culture and characterization.
Microbiology culture and identification were adapted from methodology described in the Manual of Clinical Microbiology.13 Patient swabs were inoculated onto two pre-oxygen–reduced blood agar plates at the bedside. The media contained 10% sheep blood in a blood agar base (Unipath, Basingstoke, UK); this was incubated anaerobically for a minimum of 30 minutes before use. A plate was streaked for single colonies, and a metronidazole disc was placed on the first streaked inoculum line. The second pre-reduced blood plate was inoculated by spot method (the swab was placed on the plate and rubbed to form a small circle of inoculum). The plates were incubated anaerobically at 37°C. The swabs were also inoculated onto blood agar and MacConkey agar to identify contaminating aerobic bacteria. Finally, the swab was placed into a cooked meat broth; a sterile nail was heated until red hot, and dropped into the broth to reduce oxygen tension. All cultures were examined for growth at 24 and 48 hours after inoculation. To aid in the isolation of a pure culture of C. tetani and reduce contaminants, the broth was heated to 80°C for 10 minutes and reincubated at 37°C for a further 2 days. 13 C. tetani was identified by Gram film (Gram + Bacilli with terminal spores), sensitivity to metronidazole, colony morphology, and swarming phenotype. 13,14 Ultimately, confirmation was performed by polymerase chain reaction (PCR) for the tetanus neurotoxin gene TeTX (see below).
Antimicrobial sensitivity testing.
There are currently no guidelines for performing antimicrobial sensitivity testing on C. tetani ; therefore, we modified Clinical Laboratories Standards Institute (CLSI) methodology and media to ensure reproducibility. 15 Antimicrobial sensitivity testing was carried out on C. tetani isolates from a 1.0 McFarlane standard inoculum on Willkins Chalgren media with 7% sheep blood and 3% agar. All testing was performed on fresh isolates only, to avoid any discrepancies that may occur as a result of long-term storage. A high agar concentration ensured that C. tetani did not swarm on the media. Disc sensitivities were performed using penicillin (10 units), metronidazole (5 μg), chloramphenicol (30 μg), erythromycin (15 μg), trimethoprim/sulfamethoxazole (1.25/23.75 μg), and ofloxacin (5 μg; Unipath, Basingstoke, UK). Minimum inhibitory concentrations (MICs) were determined by the E-test method according to the manufacturer’s instructions (AB Biodisk, Solna, Sweden).
Colony PCR for the tetanus neurotoxin gene.
Presumptive isolates of C. tetani were purified and examined for the presence of the tetanus neurotoxin gene (TeTX) by PCR. DNA was extracted by removing a sample of the C. tetani grown on a blood agar plate with a toothpick and placing in 20 μL of sterile water. This was boiled for 10 minutes and centrifuged in a Microfuge to pellet the cell debris. DNA was amplified using the primers NF255 (gccggaaaggtatgaatttg) and NF256 (tagctgcaatgatcccaaca) (Sigma-Genosys, Cambridge, UK). Each primer (20 μmol/L) was added to buffer, dNTPs, Taq polymerase at recommended concentrations (Sigma, Dorset, UK), and made up to 50 μL with purified water. The PCR was cycled to 95°C for 5 minutes and then 30 cycles of 95°C for 1 minute, 52°C for 1 minute, and 72°C for 2 minutes, and was finally held at 75°C for 5 minutes. The PCR amplicons were examined on a 1% agarose gel containing ethidium bromide. Sterile water was used as the negative control, and an ATCC strain of C. tetani was used as the positive control.
RESULTS
Wound swabs were cultured and examined from 84 adults and children with clinically diagnosed tetanus over a 6-month period. Anaerobic plates were examined for the characteristic swarming colonies. If observed, colonies were subcultured, and a Gram-stained smear was prepared from the edge of the area of swarming. This preparation was observed using microscopy for the presence of the characteristic gram-positive bacilli with terminal spores.4 A Gram-stained smear of any culture positive cooked meat broth was also prepared. C. tetani was usually present in the broth in a culture of mixed organisms and was therefore checked by Gram film and subcultured onto pre-reduced blood agar plates and incubated anaerobically overnight at 37°C. The culture was again examined for the presence of distinctive swarming colonies. C. tetani was isolated from the wound swabs of 54% (45/84) of the tetanus patients. The isolated bacteria from the 45 positive cultures were examined on Gram film. Nineteen (42%) were seen on the direct Gram film, 25 (56%) were isolated from the inoculated pre-reduced blood agar plates, and all 45 (100%) additionally from the cooked meat broth.
We performed colony PCR on all isolated strains to additionally ensure that the infecting strains were C. tetani and were carrying the gene responsible for encoding the tetanus neurotoxin toxin. The tetanus neurotoxin gene (TeTX) has been used previously to molecularly diagnose clinical tetanus in a patient in Japan. 16 We wished to validate our isolation procedure and ensure that all our isolated strains correlated with the clinical diagnosis, because not all C. tetani strains harbor the 74-kbp (pE88) plasmid encoding the TeTX gene. 17 Therefore, not all strains are capable of expression of the tetanus neurotoxin toxin. PCR primers NF255 and NF256 target an 812-bp fragment at the 5′ end of the 3,940-bp gene. We successfully amplified a PCR amplicon of the appropriate size in all 45 of our clinically isolated strains (data not shown), confirming that all isolates were correctly identified as C. tetani, and all were capable of producing tetanus neurotoxin toxin.
The most common site of inoculation of the bacteria into the skin was the foot, often a deep puncture wound from treading on an infected object (Table 1). Of the 45 culture positive patients, 4 eventually died, despite treatment; all of these patients had symptoms synonymous with Grade IV clinical tetanus. The number of days of treatment with penicillin before isolation of C. tetani ranged from 0 to 16 days, with a mean treatment time of around 2 days before isolation of the bacteria. Other antimicrobial therapies used for treatment, other than penicillin, are also outlined in Table 1.
Despite attempting to isolate only C. tetani from patient’s wounds, additional infecting bacteria were cultured from some C. tetani–positive swabs. Because of the culturing conditions, we were unable to culture other obligate anaerobes that require longer than 48-hour incubation. Other infecting organisms are outlined in Table 1 and include facultative anaerobes that are commonly associated with puncture wounds from contaminated objects. Other isolated organisms included Staphylococcus aureus, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa.
Because antimicrobial susceptibility testing has not been performed previously on clinical isolates of C. tetani, interpretation of the results was challenging. Interpretation is compounded by the growth conditions; during anaerobic antimicrobial sensitivity tests, the increased CO2 produced in the anaerobic jar may disrupt the mechanism of antibiotics caused by the change in pH. The drop in pH may result in a decrease in potency of the agent. Antimicrobial testing is not routinely performed on anaerobic organisms except in specialist laboratories, and there is a lack of appropriate endpoints for MICs for C. tetani and other anaerobic bacteria. We correlated our results with the CLSI Guidelines for non-Enterobacteriaceae as per recommendations for breakpoints of anaerobic bacteria. 15 We tested all isolates for sensitivity to penicillin, metronidazole, chloramphenicol, erythromycin, trimethoprim/sulfamethoxazole, and ofloxacin. The results of the antimicrobial susceptibility testing are summarized in Table 2.
The results in Table 2 show that all organisms tested had similar sensitivity patterns. Because penicillin is the recommended antimicrobial agent for treatment, the sensitivity to this agent was of most interest. All strains were sensitive to penicillin; the highest MIC was 0.25 μg with a clearance zone of 29 mm (using a 10-μg disc). Similarly, all strains were sensitive to metronidazole, another agent commonly used in tetanus treatment. The highest MIC to metronidazole was 1.0 μg, with a zone of 26 mm (5-μg disc). All organisms were sensitive to all other agents with the exception of co-trimoxazole. These data show that, despite all organisms being sensitive to all agents that are commonly used to treat clinical tetanus, some patients have a prolonged infection; the highest number of days of treatment with penicillin with a positive culture was 16 days.
DISCUSSION
Isolation of a pure growth of C. tetani was found to be relatively straight forward using essential microbiology techniques and standard media with some modifications. Often the number of other less fastidious bacteria present in a dirty wound can overwhelm culturing C. tetani, because the number of colonies of this organism are usually small. Tetanus spores can remain dormant at the site of inoculation until optimum conditions allow them to sporulate and release tetanus neurotoxin toxin. Only a small number of C. tetani organisms are needed to produce enough neurotoxin to induce a clinical syndrome. C. tetani was often difficult to isolate because of an unobvious route of infection; many of our patients had no obvious entry site for the organism. For those patients with an obvious site of infection, the isolation rate was improved by using bedside inoculation of primary media, thus reducing the time from inoculation to anaerobic conditions of the inoculated plates. The use of a PCR assay for the TeTX gene allowed reliable confirmation of the organism and showed that all were capable of production of the tetanus neurotoxin toxin.
The main aim of this classic microbiologic study was to examine the antimicrobial susceptibility of current isolates of C. tetani to ensure that resistance has not emerged undetected and that poor response to treatment was not dependent on resistance of the organisms. To the authors’ knowledge, this is the first report detailing the antimicrobial susceptibilities and MICs of clinical C. tetani isolates. A suitable media for performing such susceptibility testing is a hurdle. The use of 3% agar Wilkins Chalgren plates greatly enhanced the interpretation of the antimicrobial tests, because of a lack of swarming. The addition of 7% sheep blood to the base media also permitted a rich uniform growth across the media surface.
Among 45 clinical isolates of C. tetani, there were none that were resistant to penicillin or metronidazole, but all were resistant to co-trimoxazole. Unlike other Clostridia, such as C. difficile, which inhabits the intestinal tract, C. tetani has not acquired resistance mechanisms to commonly deployed antimicrobial agents. 18 Our data showed that penicillin (with additional therapy) still remains a suitable choice for the treatment of tetanus, with metronidazole as an appropriate alternative. 19,20 However, evidence suggests that that ineffectiveness of penicillin to treat some tetanus patients is explained by the small amount of drug reaching the infected tissue in a large quantity if administered through the intravenous route. C. tetani is an obligate anaerobe; thus, vascularization of the site of infection must be extremely poor or the organism will not survive.
These findings suggest that intravenous penicillin does not clear the wound of C. tetani reliably; the use of a topical agent might be more beneficial. If the organism is not cleared from the wound, it is possible that continued toxin production can occur with continuing severe disease in patients. The penetration of penicillin into devitalized tissue is likely to be poor. Equine antitoxin, which has a half life of 2 days, is used in developing countries to reduce the severity of the disease in the first 2–3 days. 21 Clearly, adequate wound debridement is necessary to remove anaerobic areas in the wound where C. tetani thrives. The role of topical antiseptic agents to help clear the wound requires further study. These data emphasize the importance of adequate wound debridement in addition to the use of antitoxin and an appropriate antimicrobial agent for the treatment of clinical tetanus.
Clinical information of 45 C. tetani culture-positive patients
Summary of the antimicrobial susceptibilities of 45 clinical C. tetani strains
Address correspondence to Stephen Baker, Oxford University Clinical Research Unit, Hospital for Tropical Diseases, 190 Ben Ham Tu, Quan 5, Ho Chi Minh City, Viet Nam. E-mail: sbaker@oucru.org
Authors’ addresses: James I. Campbell, Jeremy J. Farrar, and Stephen Baker, Oxford University Clinical Research Unit, Hospital for Tropical Diseases, Ho Chi Minh City, Viet Nam and Centre for Tropical Medicine, Department of Clinical Medicine University of Oxford, Oxford, United Kingdom. Lam Thi Minh Yen, Huynh Thi Loan, To So Diep, Tran Thi Thu Nga, Nguyen Van Minh Hoang, Le Thanh Son, Nguyen van Vinh Chau, and Tran Tinh Hien, Hospital for Tropical Diseases, Ho Chi Minh City, Viet Nam. Christopher Parry, University of Liverpool, Liverpool, United Kingdom.
Acknowledgments: The authors wish to acknowledge the efforts of all the Medical and Nursing staff of the Tetanus Intensive Care Unit of the Hospital of Tropical Diseases. They also thank the laboratory staff of the Microbiology Department, in particular, Son Chau for production of media.
Financial support: This work was funded by the Wellcome Trust, London, UK.
REFERENCES
- 1↑
Thwaites CL, Yen LM, Nga NT, Parry J, Binh NT, Loan HT, Thuy TT, Bethell D, Parry CM, White NJ, Day NP, Farrar JJ, 2004. Impact of improved vaccination programme and intensive care facilities on incidence and outcome of tetanus in southern Vietnam, 1993–2002. Trans R Soc Trop Med Hyg 98 :671–677.
- 2↑
Dietz V, Milstien JB, van Loon F, Cochi S, Bennett J, 1996. Performance and potency of tetanus toxoid: implications for eliminating neonatal tetanus. Bull World Health Organ 74 :619–628.
- 3↑
Whitman C, Belgharbi L, Gasse F, Torel C, Mattei V, Zoffmann H, 1992. Progress towards the global elimination of neonatal tetanus. World Health Stat Q 45 :248–256.
- 5↑
Wilkins CA, Richter MB, Hobbs WB, Whitcomb M, Bergh N, Carstens J, 1988. Occurrence of Clostridium tetani in soil and horses. S Afr Med J 73 :718–720.
- 7↑
Cook TM, Protheroe RT, Handel JM, 2001. Tetanus: a review of the literature. Br J Anaesth 87 :477–487.
- 8↑
Farrar JJ, Yen LM, Cook T, Fairweather N, Binh N, Parry J, Parry CM, 2000. Tetanus. J Neurol Neurosurg Psychiatry 69 :292–301.
- 9↑
Fairweather NF, Lyness VA, 1986. The complete nucleotide sequence of tetanus toxin. Nucleic Acids Res 14 :7809–7812.
- 10↑
Fairweather NF, Lyness VA, Pickard DJ, Allen G, Thomson RO, 1986. Cloning, nucleotide sequencing, and expression of tetanus toxin fragment C in Escherichia coli. J Bacteriol 165 :21–27.
- 11↑
Bruggemann H, Baumer S, Fricke WF, Wiezer A, Liesegang H, Decker I, Herzberg C, Martinez-Arias R, Merkl R, Henne A, Gottschalk G, 2003. The genome sequence of Clostridium tetani, the causative agent of tetanus disease. Proc Natl Acad Sci USA 100 :1316–1321.
- 12↑
Campbell J, Farrar J, 2002. Antimicrobial Therapy and Vaccines. Volume I, Microbes. New York: Appletrees Productions.
- 13↑
Murray PR, Baron EJ, Pfaller MA, Tenover FC, Yolken RH, 1995. Manual of Clinical Microbiology, Sixth Edition. Washington, DC: ASM Press.
- 15↑
Clinical and Laboratory Standards Institute, 2007. Performance standards for antimicrobial susceptibility testing; 17th informational supplement. MS100-S17. CLSI, Wayne, PA.
- 16↑
Nagao K, Mori T, Sawada C, Sasakawa C, Kanezaki Y, 2007. Detection of the tetanus toxin gene by polymerase chain reaction: a case study. Jpn J Infect Dis 60 :149–150.
- 17↑
Bruggemann H, 2005. Genomics of clostridial pathogens: implication of extrachromosomal elements in pathogenicity. Curr Opin Microbiol 8 :601–605.
- 18↑
Sebaihia M, Wren BW, Mullany P, Fairweather NF, Minton N, Stabler R, Thomson NR, Roberts AP, Cerdeno-Tarraga AM, Wang H, Holden MT, Wright A, Churcher C, Quail MA, Baker S, Bason N, Brooks K, Chillingworth T, Cronin A, Davis P, Dowd L, Fraser A, Feltwell T, Hance Z, Holroyd S, Jagels K, Moule S, Mungall K, Price C, Rabbinowitsch E, Sharp S, Simmonds M, Stevens K, Unwin L, Whithead S, Dupuy B, Dougan G, Barrell B, Parkhill J, 2006. The multidrug-resistant human pathogen Clostridium difficile has a highly mobile, mosaic genome. Nat Genet 38 :779–786.
- 19↑
Ganesh Kumar AV, Kothari VM, Krishnan A, Karnad DR, 2004. Benzathine penicillin, metronidazole and benzyl penicillin in the treatment of tetanus: a randomized, controlled trial. Ann Trop Med Parasitol 98 :59–63.
- 21↑
Kabura L, Ilibagiza D, Menten J, Van den Ende J, 2006. Intrathecal vs. intramuscular administration of human antitetanus immunoglobulin or equine tetanus antitoxin in the treatment of tetanus: a meta-analysis. Trop Med Int Health 11 :1075–1081.