• View in gallery

    Number of confirmed DENV-2 cases in each month during the two consecutive outbreaks in Kaohsiung in 2001 and 2002. The dengue fever (DF) and dengue hemorrhagic fever (DHF) cases studied in each month during the two outbreaks are indicated by arrows.

  • View in gallery

    Maximum likelihood (ML) tree depicting the phylogenetic relationship of 31 DENV-2 of the Kaohsiung outbreaks in 2001 and 2002 based on the E gene (1407 nucleotides in length). A total of 85 E sequences, including 16 from the Kaohsiung outbreaks (only one of the identical sequences was included), 23 from countries where there were cases imported to Taiwan during this period, 31 from the 5 known genotypes of DENV-2, 4 of the sylvatic DENV-2, and E sequence of DENV-1, DENV-3, and DENV-4 as outgroups, were analyzed by the ML method. The 2001 and 2002 Kaohsiung clusters are highlighted by lines, and the 5 genotypes and sylvatic DENV-2 by brackets. Similar trees were generated by the NJ method (not shown) with the bootstrap P values (1,000 bootstrap samples) shown beside the branches in percentage, which correspond to P < 0.01 by the ML method.

  • View in gallery

    Maximum likelihood (ML) tree depicting the phylogenetic relationship of 17 DENV-2 of the Kaohsiung outbreaks in 2001 and 2002 based on the coding region of full-genome (10176 nucleotides in length). A total of 45 full-genome sequences, including 17 from the Kaohsiung outbreaks and 28 from the 5 known genotypes of DENV-2, were analyzed by the ML method. The evolutionary distances were calculated using the Felsenstein 84 model with empirical transition/transversion ratio and base frequencies including gamma distribution parameter. The 2001 and 2002 Kaohsiung clusters are highlighted by lines, and the 5 genotypes by brackets. A similar tree was generated by the neighboring-joining (NJ) method (not shown), with the bootstrap P values (1,000 bootstrap samples) shown beside the branches in percentage. Bootstrap values of 100 correspond to P < 0.01 by the ML method.

  • View in gallery

    Comparison of the consistent nucleotide changes between the early and late viruses reported in this and previous studies.27 The consistent nucleotide changes between the early viruses and the late viruses, which were linked to outbreak with more severe cases in the Santiago outbreak in 1997 and in the Kaohsiung outbreaks in 2001–2002, were shown. Parentheses after nucleotides indicate amino acids. The number of genome position was based on the DENV-2 strain, NGC.33

  • 1

    Lindenbach BD, Rice CM, 2001. Flaviviridae: The viruses and their replication. Knipe DM, Howley PM, eds. Fields Virology. Fourth edition. Philadelphia, PA: Lippincott Raven, 991–1041.

  • 2

    Gubler DJ, 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol 10 :100–103.

    • Search Google Scholar
    • Export Citation
  • 3

    Guzman MG, Kouri G, 2002. Dengue: an update. Lancet Infect Dis 2 :33–42.

  • 4

    World Health Organization, 1997. Dengue Hemorrhagic Fever, Diagnosis, Treatment and Control. Second edition. Geneva: World Health Organization.

  • 5

    Green S, Rothman A, 2006. Immunopathological mechanisms in dengue and dengue hemorrhagic fever. Curr Opin Infect Dis 19 :429–436.

  • 6

    Halstead SB, 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239 :476–481.

  • 7

    Halstead SB, O’Rourke EJ, 1977. Antibody-enhanced dengue virus infection in primate leukocytes. Nature 265 :739–741.

  • 8

    Morens DM, Venkateshan CN, Halstead SB, 1987. Dengue 4 virus monoclonal antibodies identify epitopes that mediate immune enhancement of dengue 2 viruses. J Gen Virol 68 :91–98.

    • Search Google Scholar
    • Export Citation
  • 9

    Burke DS, Nisalak A, Johnson DE, Scott RM, 1988. A prospective study of dengue infections in Bangkok. Am J Trop Med Hyg 38 :172–180.

  • 10

    Guzman MG, Kouri GP, Bravo J, Soler M, Vazquez S, Morier L, 1990. Dengue hemorrhagic fever in Cuba, 1981: a retrospective seroepidemiologic study. Am J Trop Med Hyg 42 :179–184.

    • Search Google Scholar
    • Export Citation
  • 11

    Sangkawibha N, Rojanasuphot S, Ahandrik S, Viriyapongse S, Jatanasen S, Salitul V, Phanthumachinda B, Halstead SB, 1984. Risk factors for dengue shock syndrome: a prospective epidemiologic in Rayong, Thailand. I. The 1980 outbreak. Am J Epidemiol 120 :653–669.

    • Search Google Scholar
    • Export Citation
  • 12

    Gubler DJ, Reed D, Rosen L, Hitchcock JC, 1978. Epidemiologic, clinical and virologic observations on dengue in the kingdom of Tonga. Am J Trop Med Hyg 27 :581–589.

    • Search Google Scholar
    • Export Citation
  • 13

    Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM, 2003. Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 9 :880–889.

    • Search Google Scholar
    • Export Citation
  • 14

    Rico-Hesse R, Harrison LM, Salas RA, Tovar D, Nisalak A, Ramos C, Boshell J, de Mesa MT, Nogueira RM, da Rosa AT, 1997. Origins of dengue type 2 viruses associated with increased pathogenicity in the Americas. Virology 230 :244–251.

    • Search Google Scholar
    • Export Citation
  • 15

    Watts D, Porter K, Putvatana R, Vasquez R, Calampa C, Hayes C, Halstead SB, 1999. Failure of secondary dengue 2 genotype I infection to cause dengue hemorrhagic fever. Lancet 354 :1431–1434.

    • Search Google Scholar
    • Export Citation
  • 16

    Gubler DJ, Suharyano W, Lubis I, Eram S, Gunarso S, 1981. Epidemic dengue 3 in central Java, associated with low viremia in man. Am J Trop Med Hyg 27 :1049–1099.

    • Search Google Scholar
    • Export Citation
  • 17

    Gubler DJ, Rosen L, 1977. Quantitative aspects of replication of dengue viruses in Aedes albopictus (Diptera: Culicidae) after oral and parental infection. J Med Entomol 13 :469–472.

    • Search Google Scholar
    • Export Citation
  • 18

    Rosen L, 1977. The emperor’s new clothes revisited, or reflections on the pathogenesis of dengue hemorrhagic fever. Am J Trop Med Hyg 26 :337–343.

    • Search Google Scholar
    • Export Citation
  • 19

    Leitmeyer KC, Vaughn DW, Watts DM, Salas R, de Chacon IV, Ramos C, Rico-Hesse R, 1999. Dengue virus structural differences that correlate with pathogenesis. J Virol 73 :4738–4747.

    • Search Google Scholar
    • Export Citation
  • 20

    Cologna R, Armstrong PM, Rico-Hesse R, 2005. Selection for virulent dengue viruses occurs in human and mosquitoes. J Virol 79 :853–859.

  • 21

    Pryor MJ, Carr JM, Hocking H, Davidson AD, Li P, Wright PJ, 2001. Replication of dengue virus type 2 in human monocyte-derived macrophages: comparisons of isolates and recombinant viruses with substitutions at amino acid 390 in the envelope glycoprotein. Am J Trop Med Hyg 65 :427–434.

    • Search Google Scholar
    • Export Citation
  • 22

    Mangada MN, Igarashi A, 1998. Molecular and in vitro analysis of eight dengue type 2 viruses isolated from patients exhibiting different disease severities. Virology 244 :458–466.

    • Search Google Scholar
    • Export Citation
  • 23

    Guzman MG, Kouri G, Halstead SB, 2000. Do escape mutants explain rapid increases in dengue case-fatality rates within epidemics? Lancet 355 :1902–1903.

    • Search Google Scholar
    • Export Citation
  • 24

    Guzman MG, Kouri G, Valdes L, Bravo J, Vazquez S, Halstead SB, 2002. Enhanced severity of secondary dengue-2 infection: death rates in 1981 and 1997 Cuban outbreaks. Rev Panam Salud Publica 11 :223–227.

    • Search Google Scholar
    • Export Citation
  • 25

    Chao DY, Lin TH, Hwang KP, Huang JH, Liu CC, King CC, 2004. 1998 dengue hemorrhagic fever epidemic in Taiwan. Emerg Infect Dis 10 :552–554.

    • Search Google Scholar
    • Export Citation
  • 26

    Wu MH, Hwang KP, Tsai JJ, Wu TS, Huang YC, King CC, 2005. Epidemiology of dengue fever/dengue hemorrhagic fever in Taiwan, 2001–2003. Taiwan J Pub Health 24 :452–459.

    • Search Google Scholar
    • Export Citation
  • 27

    Rodriguez-Roche R, Alvarez M, Gritsun T, Halstead S, Kouri G, Gould EA, Guzman MG, 2005. Virus evolution during a severe dengue epidemic in Cuba, 1997. Virology 334 :154–159.

    • Search Google Scholar
    • Export Citation
  • 28

    Wang WK, Chen HL, Yang CF, Hsieh SC, Juan CC, Chang SM, Yu CC, Lin LH, Huang JH, King CC, 2006. Slower rates of clearance of viral load and virus-containing immune complexes in patients with dengue hemorrhagic fever. Clin Infect Dis 43 :1023–1030.

    • Search Google Scholar
    • Export Citation
  • 29

    Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV, 1992. Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 30 :545–551.

    • Search Google Scholar
    • Export Citation
  • 30

    Shu PY, Chen LK, Chang SF, Yueh YY, Chow L, Chien LJ, Lin TH, Huang JH, 2003. Comparison of capture immunoglobulin M (IgM) and IgG enzyme-linked immunosorbent assay (ELISA) and nonstructural protein NS1 serotype-specific IgG ELISA for differentiation of primary and secondary dengue virus infections. Clin Vaccine Immunol 10 :622–630.

    • Search Google Scholar
    • Export Citation
  • 31

    Wang WK, Lin SR, Lee CM, King CC, Chang SC, 2002. Dengue-3 virus in plasma is a population of closely related genomes: quasispecies. J Virol 76 :4662–4665.

    • Search Google Scholar
    • Export Citation
  • 32

    Kwok S, Higuchi R, 1989. Avoiding false positive with PCR. Nature 339 :237–238.

  • 33

    Irie K, Mohan PM, Sasaguri Y, Putnak R, Padmanabhan R, 1989. Sequence analysis of cloned dengue virus type 2 genome (New Guinea-C strain). Gene 75 :197–211.

    • Search Google Scholar
    • Export Citation
  • 34

    Centers for Disease Control Taiwan, 2004. Cases of dengue hemorrhagic fever and dengue shock syndrome in Taiwan. Epidemiol Bull 20 :46–47.

    • Search Google Scholar
    • Export Citation
  • 35

    Salda LTD, Parquet MDC, Matias RR, Natividad FF, Kobayashi N, Morita K, 2005. Molecular epidemiology of dengue 2 viruses in the Philippines: genotype shift and local evolution. Am J Trop Med Hyg 73 :796–802.

    • Search Google Scholar
    • Export Citation
  • 36

    Twiddy SS, Farrar JJ, Chau NV, Wills B, Gould EA, Gritsun T, Lloyd G, Holmes EC, 2002. Phylogenetic relationships and differential selection pressures among genotypes of dengue-2 virus. Virology 298 :53–72.

    • Search Google Scholar
    • Export Citation
  • 37

    Wang E, Ni H, Xu R, Barrett ADT, Watowich SJ, Gubler DJ, Weaver SC, 2000. Evolutionary relationships of endemic/epidemic and sylvatic dengue viruses. J Virol 74 :3227–3234.

    • Search Google Scholar
    • Export Citation
  • 38

    Zhang C, Mammen MP Jr, Chinnawirotpisan P, Klungthong C, Rodpradit P, Nisalak A, Vaughn DW, Nimmannitya S, Kalayanarooj S, Holmes EC, 2006. Structure and age of genetic diversity of dengue virus type 2 in Thailand. J Gen Virol 87 :873–883.

    • Search Google Scholar
    • Export Citation
  • 39

    Felsenstein J, 2005. PHYLIP (Phylogeny Inference Package) version 3.6. Program distributed by the author. Department of Genome Sciences, University of Washington, Seattle.

  • 40

    Huelsenbeck JP, Ronquist F, 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17 :754–755.

  • 41

    Ronquist F, Huelsenbeck JP, 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19 :1572–1574.

  • 42

    Schmidt HA, Strimmer K, Vingron M, von Haeseler A, 2002. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18 :502–504.

    • Search Google Scholar
    • Export Citation
  • 43

    Nylander JAA, 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

  • 44

    Kosakovsky Pond SL, Frost SDW, 2005. Datamonkey: rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 21 :2531–2533.

    • Search Google Scholar
    • Export Citation
  • 45

    Kumar S, Tamura K, Jakobsen IB, Nei M, 2001. MEGA2: molecular evolutionary genetic analysis software. Bioinformatics 17 :1244–1245.

  • 46

    Klungthong C, Zhang C, Mammen MP, Ubol S, Holmes EC, 2004. The molecular epidemiology of dengue virus serotype 4 in Bangkok, Thailand. Virology 329 :168–179.

    • Search Google Scholar
    • Export Citation
  • 47

    Thu HM, Lowry K, Jiang L, Hlaing T, Holmes EC, Aaskov J, 2005. Lineage extinction and replacement in dengue type 1 virus populations are due to stochastic events rather than to natural selection. Virology 336 :163–172.

    • Search Google Scholar
    • Export Citation
  • 48

    Lee IK, Liu JW, Yang KD, 2005. Clinical characteristics and risk factors for concurrent bacteremia in adults with dengue hemorrhagic fever. Am J Trop Med Hyg 72 :221–226.

    • Search Google Scholar
    • Export Citation
  • 49

    Modis Y, Ogata S, Clements D, Harrison SC, 2004. Structure of the dengue virus envelope protein after membrane fusion. Nature 427 :313–319.

    • Search Google Scholar
    • Export Citation
  • 50

    Innis BL, Thirawuth V, Hemachudha C, 1989. Identification of continuous epitopes of the envelope glycoprotein of dengue type 2 virus. Am J Trop Med Hyg 40 :676–687.

    • Search Google Scholar
    • Export Citation
  • 51

    Roehrig JT, Johnson AJ, Hunt AR, Bolin RA, Chu MC, 1990. Antibodies to dengue 2 virus E-glycoprotein synthetic peptides identify abtigenic conformation. Virology 177 :668–675.

    • Search Google Scholar
    • Export Citation
  • 52

    Roehrig JT, Risi PA, Brubaker JR, Hunt AR, Beaty BJ, Trent DW, Mathews JH, 1994. T-helper cell epitopes on the E-glycoprotein of dengue 2 Jamaica virus. Virology 198 :31–38.

    • Search Google Scholar
    • Export Citation
  • 53

    Holmes EC, 2003. Patterns of intra- and interhost nonsynonymous variation reveal strong purifying selection in dengue virus. J Virol 77 :11296–11298.

    • Search Google Scholar
    • Export Citation
  • 54

    Holmes EC, Twiddy SS, 2003. The origin, emergence and evolutionary genetics of dengue virus. Infect Genet Evol 3 :19–28.

  • 55

    Sittisombut N, Sistayanarain A, Cardosa MJ, Salminen M, Damrongdachakul S, Kalayanarooj S, Rojanasupot S, Supawadee J, Maneekarn N, 1997. Possible occurrence of a genetic bottle neck in dengue serotype 2 viruses between the 1980 and 1987 epidemic seasons in Bangkok, Thailand. Am J Trop Med Hyg 57 :100–108.

    • Search Google Scholar
    • Export Citation
  • 56

    Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG, 2002. Extinction and rapid evolution of strains of dengue 3 virus during an interepidemic period. Virology 301 :148–156.

    • Search Google Scholar
    • Export Citation
  • 57

    Bennett SN, Holmes EC, Chirivella M, Rodriguez DM, Beltran M, Vordam V, Gubler DJ, McMillan WO, 2003. Selection-driven evolution of emergent dengue virus. Mol Biol Evol 20 :1650–1658.

    • Search Google Scholar
    • Export Citation

 

 

 

 

Evolution of Dengue Virus Type 2 during Two Consecutive Outbreaks with an Increase in Severity in Southern Taiwan in 2001–2002

View More View Less
  • 1 Institute of Microbiology, College of Medicine, National Taiwan University;Institute of Epidemiology, College of Public Health, National Taiwan University, Taipei, Taiwan; Department of Medical Research, Mackay Memorial Hospital, Taipei-Tamshui, Taiwan; Institute of Microbiology, College of Medicine, National Taiwan University, Taipei, Taiwan

To investigate viral determinants and evolution linked to outbreak with increased severity, we examined dengue virus type 2 (DENV-2) sequences from plasma of 31 patients (14 dengue fever, 17 dengue hemorrhagic fever, DHF) continuously during the 2001 and 2002 outbreaks in southern Taiwan, in which both the total cases and proportion of DHF cases increased. Analysis of envelope (E) and full-genome sequences between viruses of the two outbreaks revealed 5 nucleotide changes in E, NS1, NS4A, and NS5 genes. None was identical to those reported in the DENV-2 outbreak in Cuba in 1997, suggesting viral determinants linked to severe outbreak are genotype dependent. Compared with previous reports of lineage turnover years apart, our findings that the 2002 viruses descended from a minor variant of the 2001 viruses in less than 6 months was novel, and may represent a mechanism of evolution of DENV from one outbreak to another.

INTRODUCTION

Dengue virus (DENV) belongs to the genus Flavivirus of the family Flaviviridae. It contains a positive-sense single-stranded RNA genome of ~10.6 kb in length. Flanked by the 5′ and 3′ non-translated regions (NTRs), there are three structural genes, the capsid (C), precursor membrane (PrM), and envelope (E), at the proximal 5′ one-fourth of the genome, and seven non-structural genes, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5, at the distal 3′ of the genome.1 Over the past 20 years, dengue outbreaks caused by the four serotypes (DENV-1, DENV-2, DENV-3, and DENV-4) remain a major public health problem in the tropical and subtropical areas. It has been estimated that ~100 million DENV infections occur annually worldwide.2,3

Although most DENV infections are asymptomatic or cause a relatively mild disease, dengue fever (DF), some infections may result in severe and potentially life-threatening disease, dengue hemorrhagic fever–dengue shock syndrome (DHF/DSS).24 Along with the risk factors that were reported to contribute to DHF/DSS, two major factors, the viral strain and the immune status of the host, have been identified.2,3,5 The immune hypothesis states that cross-reactive, non-neutralizing antibodies from previous infection may enhance DENV replication in mononuclear phagocytic cells during secondary infection.6 This was supported by the antibody-dependent enhancement phenomenon in vitro and by several independent cohort studies.711 On the other hand, different DENV strains have been reported to link to outbreaks with very mild or very severe diseases.1216 Moreover, different DENV strains were found to have different abilities to replicate in mosquitoes.17 Thus, the viral hypothesis contends that severe dengue disease is the result of more virulent strains of DENV that have evolved to replicate faster and to a higher level and cause more DHF/DSS.18 Because frequent sampling and sequencing of DENV between outbreaks were lacking, how DENV evolved from one outbreak to another remained unclear.

Previously, several studies have attempted to identify the molecular determinants of DENV associated with patients with severe disease at the full-genome level. One compared the sequences of DENV-2 causing DF only, the American (Am) genotype, and those causing both DHF and DF, the Southeast Asian (SEA) genotype, and reported structural differences in the 5′ and 3′NTRs as well as 55 amino acid differences in the coding region between these two genotypes.19 Moreover, SEA genotype was shown to have selective advantages over the Am genotype in human cells and mosquitoes.20 Because the viruses analyzed were from outbreaks in different countries over 10 years apart, it was difficult to identify specific residues responsible for the virulence of the SEA genotype, with the exception of an asparagine residue at position 390 of E protein of the SEA genotype. This residue was reported to contribute to high replication of the SEA genotype in macrophages.21 Another study focused on eight DENV-2 isolates from a single outbreak and reported no consistent sequence difference between viruses from DF and DHF patients.22 As the viruses have been passaged in tissue culture, the possibility that sequence changes introduced by in vitro selection might mask the differences of viral sequences in vivo cannot be completely ruled out.

It was recently reported that the proportion of severe cases (DHF) to total cases increased toward the end of an outbreak in more than three occasions.2327 In 2001 and 2002, there were two consecutive DENV-2 outbreaks in Kaohsiung city and county, a metropolitan area in southern Taiwan (Figure 1). The first one was from September 2001 to December 2001 with a total of 194 DF and 13 DHF cases confirmed.26 With few sporadic cases reported during the winter and spring, the second one started in June 2002 and ended in early December of that year, which was the largest dengue outbreak in Taiwan after the World War II with a total of 5,039 DF and 422 DHF cases confirmed.26 Because the number of total cases increased from 207 in the 2001 outbreak to 5,461 in the 2002 outbreak and the proportion of DHF to total cases increased from 6.3% to 7.7%, we carried out a comprehensive study to examine viral sequences associated with patients with severe disease and to investigate how viruses evolve from a smaller outbreak with relatively fewer severe cases to a larger outbreak with more severe cases. Toward such aims, we examined full-genome and E sequences directly from plasma of DF and DHF patients sequentially, 2 to 3 patients per month, during these two outbreaks.

MATERIALS AND METHODS

Study participants.

During the consecutive DENV-2 outbreaks in Kaohsiung in 2001 and 2002, patients who were diagnosed with DF and DHF according to the World Health Organization (WHO) clinical definitions and admitted to two hospitals in the Kaohsiung area (the Yuan General Hospital and the Huei-Te Hospital) were included in this study.4,28 One to two patients from each group (DF and DHF) every month, with a total of 31 cases, were randomly selected for viral sequencing analysis (Table 1). With informed consent, acute blood samples were collected and plasma was prepared within 6 hours of collection and stored at −80°C until used.28 All patients were confirmed to be DENV-2 cases by a nested reverse transcription–polymerase chain reaction (RT-PCR) assay.28,29 Primary or secondary infection was determined by a previously described NS1–specific IgM and IgG capture enzyme-linked immunosorbent assay (ELISA).28,30 A Japanese encephalitis virus (JEV)-NS1 IgM ELISA was used to exclude JEV infection.30

Isolation of viral RNA, RT, PCR, and sequencing.

Dengue viral RNA was isolated directly from plasma using the QIAamp viral RNA mini kit (Qiagen, Hilden, Germany). The RNA eluate was subjected to RT using the cDNA synthesis kit and the superscript II RT (Life Technologies, Rockville, MD) as described previously.31 An aliquot of complementary DNA (cDNA) was subjected to the first round PCR using the superTaq polymerase (HT Biotechnology, Cambridge, England) and the outer primer pairs, which cover 8 overlapping segments of the DENV-2 genome (supplementary Table 2; Table can be found online at www.ajtmh.org.). The PCR was performed in a separate room from that used for RNA isolation, and precautions for PCR were followed to avoid contamination.32 The PCR product was purified by GFX PCR purification kit (Amersham Biosciences, Buckinghamshire, UK) and subjected to sequencing with the primers (not shown), BigDye terminator sequencing kit and ABI 373 automated sequencer (Applied Biosystems, Foster City, CA).31

Sequence analysis.

Two data sets were analyzed. The first one contained 85 E sequences, including 16 E sequences of 1407 nucleotides in length (genome position 1007 to 2414)33 derived from plasma of 31 patients (only one of the identical sequences was included) during the two outbreaks (Table 1), 23 available E sequences from countries, where there were cases imported to Taiwan during this period, including Philippines (00St68, 00U18, 01RBD1, 01St428, 01St322, 02Sa32), Thailand (ThD2K006200, ThD2K014400, ThD2007700, ThD2K01001, ThD2018500, ThD2K005701, ThD2001401, ThD2098100), Vietnam (CTD28, CTD44), Indonesia (TB161, BA051, 01-04-1HuNIID), Singapore (Singapore), Nepal (D2Hu-Nepal-Narita114), and Ecuador (CDC398301, CDC398302); 4 to 7 E sequences from each of the 5 genotypes of DENV-2, including Asian genotype 1 (Malaysia-87a, Malaysia-87b, D87-881, ThNH5293, GD08-98), Asian genotype 2 (Taiwan-87, Philippines-83, Sri Lanka-69, Sri Lanka-68, China-43, CTD113, CTD204), American/Asian genotype (Mart-98, Brazil-90, Malaysia-86, D80-038, Iard4341, Iard6045, Iard5207), Cosmopolitan genotype (SL206, Burkina Faso-83, Torres, Indonesia-76, Cook1, CAMR2, D2Hu-SriLanka-N11D23), and American genotype (Trinidad-53, India-57, Ven2, Tonga-74, Puerto Rico-69); 4 E sequences from the sylvatic viruses (Mal70-P8-1407, Sen70-DAKHD10674, Guinea81-PM33974, IC80-DAKAr578), and E sequences of DENV-1 (A88, BR, R72-1244b, CH323Laos), DENV-3 (H87, 1340, 260698, MK315) and DENV-4 (814669, S44750, P75-514).3437 The second one contained 45 sequences of the entire coding region (10176 nucleotides), including 17 full-genome sequences derived from plasma of 17 patients (Table 1) and 28 full-genome sequences from the 5 genotypes of DENV-2, as described previously.36,38

Phylogenetic analysis was performed by the maximum likelihood (ML) and neighbor-joining (NJ) methods in the Phylip software package (version 3.66, University of Washington, Seattle, WA),39 and the Bayesian analysis in the MrBayes (version 3.1).40,41 Empirical transition/transversion ratio and gamma distribution parameter alpha were estimated by the TREE-PUZZEL software (version 5.2) to calculate the evolutionary distances.42 The robustness of the NJ tree was statistically evaluated by bootstrap analysis with 1,000 bootstrap samples. Because the ML method is already a statistical method (with a statistical evaluation of the branch length), no bootstrapping was done. In the Bayesian analysis, nucleotide substitution model was estimated by MrModeltest (version 2.2).43 MrBayes implements GTR + G model of nucleotide substitution model (from MrModeltest 2.2), a total of 2 × 106 generations were performed with trees sampled every 100 generations. At the completion of the run, the “average standard deviation of split frequencies” (a metric in MrBayes to determine convergence of the simulation) was 0.005889 (under 0.01), well below the recommended maximum of 0.1.40,41 Nucleotides frequencies were estimated from the data sets, and a “burn-in” of 10,000 trees was used to estimate the consensus topologies. Potential scale reduction factor for branch lengths (PMSF) approximate to 1. All other settings used in MrBayes were the defaults for the software. Details of the analysis are available upon request.

For the 17 full-genome sequences, the single likelihood ancestor counting (SLAC), fixed effects likelihood (FEL), and random effects likelihood (REL) methods in the Datamonkey facility were used to determine the overall and codon–specific selection pressure, revealed by the ratio of the non-synonymous nucleotide substitutions per site (dN) to the synonymous nucleotide substitutions per site (dS), dN/dS, for the entire coding region, as described previously.38,44 As a result of the limitations of the small data set analyzed, the mode of nucleotide substitution and the method used to infer phylogenetic tree were summarized in the supplementary Table 3 (Table can be found online at www.ajtmh.org). Details are available upon request. Pairwise comparison of the E sequences was also performed using the program MEGA 3.1 to determine the proportion of difference (p-distance).45

RESULTS

Sequence analysis of E gene.

Because the E protein is known to be the major determinant of tropism and the major target of neutralizing antibodies, we first examined the entire E sequences derived directly from plasma of 8 patients (3 DHF, 5 DF) during the 2001 outbreak and of 23 patients (11 DHF, 12 DF) during the 2002 outbreak (Table 1) (Figure 1). The E sequences of the 2001 viruses were very similar to those of the 2002 viruses with a mean p-distance of 0.27% (range: 0.14–0.52%). There was no consistent nucleotide or amino acid change between E sequences of viruses from DHF patients and those from DF patients when comparing patients of either outbreak or two outbreaks together (supplementary Table 1).

To investigate the origin of the DENV-2 of the 2001–2002 outbreaks in Kaohsiung, the 31 E sequences studied and 27 available E sequences from countries, where there were cases imported to Taiwan during this period including Philippines, Thailand, Indonesia, Vietnam, Singapore, Nepal, and Ecuador, and 4 to 7 E sequences from each of the 5 genotypes of DENV-2 were aligned and subjected to phylogenetic analysis.3436 As shown by the ML tree in Figure 2, the Kaohsiung viruses belonged to the cosmopolitan genotype and formed two clusters corresponding to the year of outbreak, the 2001 and 2002 clusters. Similar trees were generated by the NJ method and the Bayesian analysis (data not shown).3941 Interestingly, two isolates from The Philippines during this period, 00U18 (in 2000) and 01RBD1 (in 2001), were closely related to the 2001 cluster of the Kaohsiung viruses, with a mean p-distance of 0.29% (range: 0.21–0.46%) and 0.41% (range: 0.36–0.46%), respectively. This finding suggests that the Kaohsiung viruses of the 2001 and 2002 outbreaks probably originate from the Philippines. Further analysis revealed that three unique E sequences, A at genome position 1088, T at genome positions 1509 and 205733 were shared by the Philippines isolates (00U18 and 01RBD1) and the 2001 viruses, but not by other 50 DENV-2 of the 5 genotypes supporting this interpretation (data not shown).

Sequence analysis of full genome.

To further investigate viral sequences linked to DHF patients in other regions of the genome, 17 full-genome sequences from 5 patients (2 DHF, 3 DF) during the 2001 outbreak and 12 patients (5 DHF, 7 DF) during the 2002 outbreak were completed and analyzed. Compared with the sequence of the earliest 2001 virus studied, 904-DHF01, several nucleotide substitutions were found in different regions of the genome (Table 2). Of the 234 nucleotide substitutions observed, 62 (26.5%) were in the structural genes and 172 (73.5%) were in the non-structural genes, which was proportional to the relative size of structural and non-structural genes. Most (184, 78.6%) of the nucleotide substitutions were silent. No consistent nucleotide or amino acid change was found between viruses from DHF patients and those from DF patients, when comparing patients of either outbreak or two outbreaks together (Table 2).

Sequence changes between viruses of two consecutive outbreaks.

Comparison of the 17 full-genome sequences revealed 5 consistent nucleotide differences between the 2001 and the 2002 viruses (Table 2). Of the five, three were in the non-structural genes, including one each in NS1, NS4A, and NS5, and two were in the structural gene, the E gene. Most (four) of the nucleotide substitutions were silent substitutions except one non-silent substitution in the E gene (genome position 106633), resulting in amino acid change from threonine to isoleucine at residue 46 of E protein (Table 2).

A closer examination of the full-genome sequences of the 2001 and 2002 viruses revealed that 4 nucleotide substitutions (A at genome position 1220, T at position 8342, C at position 8374, and A at position 877433), which were conserved by all the 2002 viruses, were present in one of the five (20%) 2001 viruses, 915-DF01, suggesting that the 2002 viruses might evolve from a minor variant of the 2001 viruses (Table 2). Phylogenetic analysis of full-genome sequences, including the 2001 and 2002 viruses and viruses of the 5 genotypes of DENV-2, revealed that among the 2001 viruses, 915-DF01 was the one most closely related to the 2002 viruses, further supporting this interpretation (Figure 3).

We next examined the overall and codon–specific selection pressure in the entire coding region of 17-full genomes using the SLAC, FEL, and REL methods in the Datamonkey facility.44 Consistent with the previous reports, the ratio of dN to dS, dN/dS, was lower than one for the entire coding region (0.108), suggesting no evidence of positive selection.38,46,47 Moreover, there was no positively selected site in the entire coding region by the SLAC and FEL methods, except that 15 positively selected sites at C, PrM, E, NS2A, NS3, NS4B, and NS5 genes were found by the REL method (supplementary Table 3). One negatively selected site at codon 366 of NS5 was consistently found by all three methods. There were 16 negatively selected sites at E and the 7 non-structural genes found by the FEL method.

DISCUSSION

The pathogenesis of DHF/DSS has been one of the major issues in dengue research.2,3,5,6,18 One fundamental question is whether the viral strains found in DHF patients differ from those in DF patients. To address this and to avoid potential mutations introduced by passages of viruses in vitro, we examined full-genome DENV sequences directly from plasma of 17 patients (10 DF, 7 DHF) during the 2001 and 2002 outbreaks in Kaohsiung. No consistent nucleotide or amino acid difference was found between viruses from DHF patients and those from DF patients, when comparing patients of either outbreak or two outbreaks together. Because the immune status of the host, primary or secondary infection was known to be an important risk factor for DHF /DSS, we excluded one case with primary infection and four cases with unknown status and re-analyzed the 12 full-genome sequences from 6 DF and 6 DHF patients with secondary infection (Table 1). Among these, there was no consistent nucleotide or amino acid difference between viruses from DF and DHF patients (Table 2), suggesting that host factors, such as age, nutritional status, and underlying diseases probably play an important role in determining disease severity in the same outbreak. A recent report of this outbreak that underlying diseases, including diabetes and hypertension, were associated with a complicated clinical course in DHF patients supported this interpretation.48

It was reported from a recent study of the DENV-2 outbreak in Cuba in 1997 that the proportion of DHF cases increased during the peak of the outbreak, from 5.2% in May to 7.4% in June and 11.9% in July.23,24 Analysis of 6 full-genome sequences identified 5 consistent nucleotide changes in NS1, NS2A, and NS5 genes between the early viruses in January-February, when the number of cases was small, and the late viruses in June–July, when there was an increase in the number of total and DHF cases.27 Similarly, a gradual increase in the proportion of DHF cases was also observed during the peak of the 2002 outbreak in Kaohsiung, from 5.7% in July–August to 7.8% in September–October and 10.2% in November–December.26 Based on the analysis of 17 full-genome sequences, there was no consistent nucleotide change between viruses of the three periods (July–August, September–October, and November–December) of the 2002 outbreak (Table 2), suggesting that the observation of increase in disease severity could not be attributed to changes in viral sequences during the peak of outbreak. Interestingly, 5 consistent nucleotide changes in the E, NS1, NS4A, and NS5 genes were found between the early viruses (2001) and the late viruses (2002). Because the DENV-2 of the Cuba outbreak in 1997 were the American/Asian genotype and those of the Kaohsiung outbreaks in 2001–2002 were the cosmopolitan genotype, the observations of no identical change associated with the late viruses, as summarized in Figure 4, suggest that viral determinants of the presumably more virulent late viruses were different, depending on the genotype or strain.

One of the 5 consistent nucleotide substitutions between the 2001 and 2002 viruses was non-silent, resulting in threonine to isoleucine change at residue 46 of E protein. Based on the crystallographic structure of dengue E protein, residue 46 was in the D0 strand of domain I, which was located on the surface.49 This residue has been reported to be in one of the antigenic domains defined by peptide ELISA on human sera.50 Peptide containing this residue can elicit neutralizing antibody and has also been identified as one of the T-helper cell epitopes in animals.51,52 It is possible that substitution of threonine to isoleucine at this position may affect the binding of neutralizing antibody or recognition by T-cells. Interestingly, this residue was identified as a positively selected site by the REL method (supplementary Table 3). Three of the 4 silent nucleotide substitutions (codon 376 of E, codon 261 of NS1, and codon 539 of NS5) were found to be negative sites by the FEL method. In addition, the 5 nucleotide substitutions may affect overall RNA secondary structure and codon usage, resulting in differences in the efficiency of RNA replication. Whether and how each of the 5 nucleotide substitutions or their particular combinations contributes to a higher level of replication in monocytes or dendritic cells remain to be investigated experimentally in the context of infectious clone. Of note, the viral sequences analyzed were the consensus sequences that dominated the DENV viral load in the collected serum from each patient.31 Thus, it is possible that certain phenotypic differences were attributed to mutations present at a low frequency in the quasispecies and could not be delineated by the 5 consistent nucleotide substitutions observed.

Because the 2002 viruses showed a high degree of similarity to the 2001 viruses (mean p-distance of E gene: 99.73%) and there was no evidence of re-introduction of new DENV-2 to Kaohsiung in 2002, the 2002 viruses appeared to evolve from the 2001 viruses.34 By examining viral sequences continuously at different time points during these two outbreaks, the first such approach for DENV to our knowledge, we demonstrated that the 2002 viruses descended from a minor variant of the 2001 viruses (Figure 3). In agreement with the notion that evolution of DENV is generally subject to a strong purifying selection, analysis of the dN/dS ratio for the entire coding region of the Kaohsiung viruses revealed no evidence of positive selection overall.36,38,53,54 The 2002 viruses most likely resulted from a genetic bottleneck during the interepidemic period between January and May 2002, in which the temperature was decreased and only sporadic cases were reported.34 This finding resonates with the observations in other studies that lineage extinction and replacement of DENV were attributed to stochastic events during the interepidemic period.47,55,56 Compared with a recent report of lineage turnover, in which the dominant clade at a given year descended from a minor variant 4 or 5 years ago, our findings that the 2002 viruses descended from a minor variant of the 2001 viruses during a short interepidemic period, less than 6 months, was surprising.57 More importantly, these findings provided evidence supporting the notion that epidemic strains of DENV evolve via drift from existing minor variants in the population. This may represent a mechanism of evolution of DENV from one outbreak to another, which was not appreciated previously.

Table 1

Information of the patients and sequences analyzed in this study

Patient IDDiseasePrimary or secondary infection*Sampling dateVirusSequence completed†Genbank accession number
* Primary (P) or secondary (S) infection was determined as described previously;28 NT, not tested because convalescent serum not available.
† Envelope (E) or full-genome (FG) sequences were completed.
904DHFS10/31/2001904-DHF01FGDQ645540
1008DHFNT11/28/20011008-DHF01EDQ645558
1024DHFNT12/07/20011024-DHF01FGDQ645544
912DFP10/31/2001912-DF01EDQ645557
915DFNT11/03/2001915-DF01FGDQ645541
950DFS11/12/2001950-DF01FGDQ645542
1018DFNT12/03/20011018-DF01FGDQ645543
1019DFNT12/03/20011019-DF01EDQ645559
1202DHFS06/22/20021202-DHF02EDQ645561
1439DHFNT07/18/20021439-DHF02EDQ645563
1464DHFS07/20/20021464-DHF02FGDQ645548
1945DHFS08/18/20021945-DHF02FGDQ645549
2038DHFNT08/28/20022038-DHF02EDQ645565
2208DHFS09/13/20022208-DHF02FGDQ645552
2237DHFS09/14/20022237-DHF002EDQ645566
2533DHFS10/21/20022533-DHF02EDQ645568
2559DHFS10/23/20022559-DHF02FGDQ645553
2659DHFS11/01/20022659-DHF02FGDQ645555
2691DHFNT11/06/20022691-DHF02EDQ645570
1183DFS06/17/20021183-DF02FGDQ645545
1185DFNT06/17/20021185-DF02EDQ645560
1222DFS06/24/20021222-DF02FGDQ645546
1409DFS07/16/20021409-DF02EDQ645562
1421DFNT07/16/20021421-DF02FGDQ645547
1852DFS08/12/20021852-DF02EDQ645564
1949DFS08/19/20021949-DF02FGDQ645550
2191DFS09/12/20022191-DF02FGDQ645551
2350DFNT09/27/20022350-DF02EDQ645567
2535DFP10/21/20022535-DF02EDQ645569
2587DFP10/26/20022587-DF02FGDQ645554
2784DFS11/18/20022784-DF02FGDQ645556
Table 2

Differences in full-genome sequences of DENV-2 of the 2001–2002 outbreaks

Table 2
Supplementary Table 1

Differences in E sequences of DENV2 between DF and DHF patients of the 2001 and 2002 outbreaks

Genome position*Virus†Amino acid position and change‡
904-DHF011008-DHF011024-DHF01912-DF01915-DF01950-DF011018-DF011019-DF011202-DHF021439-DHF021464-DHF021945-DHF022038-DHF022208-DHF022237-DHF022533-DHF022559-DHF022659-DHF022691-DHF021183-DF021185-DF021222-DF021409-DF021421-DF021852-DF021949-DF022191-DF022350-DF022535-DF022587-DF022784-DF02
* The number of genome position was based on the DENV2 strain, NGC.33
† The viruses were named according to patient ID, disease (DF or DHF) and year (01 or 02).
‡ Parentheses after amino acids indicate the nucleotides.
1066CTTTTTTTTTTTTTTTTTTTTT46 T (C) → I (T)
1076AC49 E (A) → D (C)
1220TAAAAAAAAAAAAAAAAAAAAAAAAA97 V no change
1248TC107 L no change
1256AG109 G no change
1424AG165 T no change
1991CT354 V no change
1994CT355 N no change
2008AG360 E (A) → G (G)
2057TCCCCCCCCCCCCCCCCCCCCCCC376 S no change
2060CT377 Y no change
2081GA384 P no change
2203TC425 L (T) → P (C)
2216CT429 F no change
2336TC469 N no change
2339AG470 S no change
2340CA471 R (C) → S (A)
Supplementary Table 2

Oligonucleotide primers used for amplification of DENV-2 genome

SegmentPrimer*Sequence (5 ′→3′)Genome position†Length
* Primers were named according to the positions of amino acid or nucleotide with A denoting forward primers and B reverse primers.
† The number of genome position was based on the DENV-2 strain, NGC.33
‡ The primer pairs used in the first round polymerase chain reaction (PCR).
§ ¶ || The primer pairs used in the second round PCR for the amplification of segments 3, 5, and 7 in some samples. The PCR conditions for most segments were 95°C for 5 min, followed by 30 cycles of 95°C for 1 min, 56°C for 1 min, and 72°C for 2.5 min, and then 72°C for 5 min except for segments 1 and 8, in which annealing was 58°C for 1 min and elongation 72°C for 1 min.
1d2-17ACCCAGACAGATTCTTTGAGGG17–37769 bp
d2-M27BTTTCCAGGCCCCTTCTGATGACATCCC-3′759–785
2d2-PrM60AGAICCIGAIGACITIGACTGTTGGTGC609–6351909 bp
d2-E+34BGGAACTTGTATTGTTCTGTCC2497–2517
3d2-2270A‡§GR(A/G)GCTGCY(C/T)TCCAGTGGGG2263–22802232 bp
d2-4512B‡¶ACAGGTACCATGCTGCTGC4476–4494
d2-2714A¶GGAATCATGCAGGTAGG2697–2713
d2-4137B§GCCAGCTCCTTTTCTTG4115–4131
4d2-4119AARCAAGAAAAGGAGCTGGCC4113–41321682 bp
d2-5812BCGTCTGGGGTCTATAACCC5776–5794
5d2-5423A‡§CAACTCGAGTGGAGATGGG5416–54342035 bp
d2-7457B‡¶CTCCCTGGATTTCCTTCCC7432–7450
d2-5708A¶AGACTAGAACCAATGATTGGG5701–5721
d2-5876B§GAGTGGGTCACTGGCAT5853–5869
6d2-7240AGCGGGCATCATGAAAAACCC7233–72521644 bp
d2-8885BTTCCTTGTCAACCAGCTCCC8857–8876
7d2-8585A‡§ACAGATGGCAATGACAGACAC8579–85991785 bp
d2-10370B‡||TAACGTCCTTGGACGGGG10346–10363
d2-8786A¶AATGCAGCCTTAGGTGCC8778–8795
d2-8987B§GCTCTGCTGCCTTTTGC8964–8980
d2-9254A||AGAAACTAGCCGAGGCC9247–9263
d2-9833B¶CCCAAACAGGCCGTCTC9810–9826
8d2-10204ATACACAGATTACATGCCATCC10197–10214501 bp
d2-10704BCACCATTCCATTTTCTGGCG10678–10697
Supplementary Table 3

The methods and mode of nucleotide substitution used

Nucleotide substitutionCodon model
Method*Model†Log likelihoodLog likelihoodMean dN/dSPositively selected siteNegatively selected site
* SLAC, FEL, and REL methods in the Datamonkey facility were used to determine the overall and codon-specific selection pressure in the entire coding region.
† General reversible model (REV) was used as recommended by Datamonkey facility.
dN/dS, the ratio of the non-synonymous nucleotide substitutions per site (dN) to the synonymous nucleotide substitutions per site (dS).
§ One negatively selected site at codon 366 of NS5 was consistently found by all three methods. Other 16 negatively selected sites found by the FEL method were codons 190, 355, and 376 of E, codons 189 and 261 of NS1, codon 125 of NS2A, codon 25 of NS2B, codons 122 and 533 of NS3, codon 74 of NS4A, codons 25 and 29 of NS4B, codons 260, 534, 539, and 838 of NS5.
¶ The 15 positively selected sites found by the REL method were codon 95 of C, codon 114 of PrM, codons 46, 360, and 425 of E, codon 31 of NS2A, codon 558 of NS3, codon 212 of NS4B, and codons 271, 357, 585, 631, 687, 691, and 811 of NS5.
SLACREV−14607.1−14277.50.1080
FELREV017§
RELREV15¶
Figure 1.
Figure 1.

Number of confirmed DENV-2 cases in each month during the two consecutive outbreaks in Kaohsiung in 2001 and 2002. The dengue fever (DF) and dengue hemorrhagic fever (DHF) cases studied in each month during the two outbreaks are indicated by arrows.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 79, 4; 10.4269/ajtmh.2008.79.495

Figure 2.
Figure 2.

Maximum likelihood (ML) tree depicting the phylogenetic relationship of 31 DENV-2 of the Kaohsiung outbreaks in 2001 and 2002 based on the E gene (1407 nucleotides in length). A total of 85 E sequences, including 16 from the Kaohsiung outbreaks (only one of the identical sequences was included), 23 from countries where there were cases imported to Taiwan during this period, 31 from the 5 known genotypes of DENV-2, 4 of the sylvatic DENV-2, and E sequence of DENV-1, DENV-3, and DENV-4 as outgroups, were analyzed by the ML method. The 2001 and 2002 Kaohsiung clusters are highlighted by lines, and the 5 genotypes and sylvatic DENV-2 by brackets. Similar trees were generated by the NJ method (not shown) with the bootstrap P values (1,000 bootstrap samples) shown beside the branches in percentage, which correspond to P < 0.01 by the ML method.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 79, 4; 10.4269/ajtmh.2008.79.495

Figure 3.
Figure 3.

Maximum likelihood (ML) tree depicting the phylogenetic relationship of 17 DENV-2 of the Kaohsiung outbreaks in 2001 and 2002 based on the coding region of full-genome (10176 nucleotides in length). A total of 45 full-genome sequences, including 17 from the Kaohsiung outbreaks and 28 from the 5 known genotypes of DENV-2, were analyzed by the ML method. The evolutionary distances were calculated using the Felsenstein 84 model with empirical transition/transversion ratio and base frequencies including gamma distribution parameter. The 2001 and 2002 Kaohsiung clusters are highlighted by lines, and the 5 genotypes by brackets. A similar tree was generated by the neighboring-joining (NJ) method (not shown), with the bootstrap P values (1,000 bootstrap samples) shown beside the branches in percentage. Bootstrap values of 100 correspond to P < 0.01 by the ML method.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 79, 4; 10.4269/ajtmh.2008.79.495

Figure 4.
Figure 4.

Comparison of the consistent nucleotide changes between the early and late viruses reported in this and previous studies.27 The consistent nucleotide changes between the early viruses and the late viruses, which were linked to outbreak with more severe cases in the Santiago outbreak in 1997 and in the Kaohsiung outbreaks in 2001–2002, were shown. Parentheses after nucleotides indicate amino acids. The number of genome position was based on the DENV-2 strain, NGC.33

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 79, 4; 10.4269/ajtmh.2008.79.495

*

Address correspondence to Wei-Kung Wang, Institute of Microbiology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Rd, Taipei, Taiwan. E-mail: wwang60@yahoo.com

Authors’ addresses: Hui-Ling Chen, Su-Ru Lin, Szu-Chia Hsieh, and Wei-Kung Wang, Institute of Microbiology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Rd, Taipei, Taiwan, Tel: 8862-2312-3456 ext. 8286, Fax: 8862-2391-5293, E-mail: wwang60@yahoo.com. Hsin-Fu Liu, Department of Medical Research, Mackay Memorial Hospital, 45 Min-Sheng Rd, c-Tamshui, Taiwan, Tel: 8862-2809-4661 ext. 2073. Chwan-Chuen King, Institute of Epidemiology, College of Public Health, National Taiwan University, No. 17, Hsu-Chou Rd, Taipei, Taiwan, Tel: 8862-2341-4347.

Note: The sequences have been submitted to Genbank (Table 1). Supplemental Tables 1–3 appear online at www.ajtmh.org.

Acknowledgments: We thank Dr. Chung-Chou Juan and Shu-Mei Chang at the Yuan’s General Hospital, Dr. Cheng-Ching Yu and Li-Hui Lin at the Hui-Te Hospital in the Kaohsiung area for kindly providing clinical samples, Dr. Jyh-Hsiung Huang at the Center for Disease Control, Department of Health Taiwan for the information on primary and secondary infection, Mien-Huei Wu, Chao-Fu Yang, Mei-Ying Liao, I-Jung Liu, and Hsien-Ping Hu for technical assistance.

Financial support: This work was supported by the National Science Council (NSC95-2320-B-002-084-MY3), Taiwan.

REFERENCES

  • 1

    Lindenbach BD, Rice CM, 2001. Flaviviridae: The viruses and their replication. Knipe DM, Howley PM, eds. Fields Virology. Fourth edition. Philadelphia, PA: Lippincott Raven, 991–1041.

  • 2

    Gubler DJ, 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol 10 :100–103.

    • Search Google Scholar
    • Export Citation
  • 3

    Guzman MG, Kouri G, 2002. Dengue: an update. Lancet Infect Dis 2 :33–42.

  • 4

    World Health Organization, 1997. Dengue Hemorrhagic Fever, Diagnosis, Treatment and Control. Second edition. Geneva: World Health Organization.

  • 5

    Green S, Rothman A, 2006. Immunopathological mechanisms in dengue and dengue hemorrhagic fever. Curr Opin Infect Dis 19 :429–436.

  • 6

    Halstead SB, 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239 :476–481.

  • 7

    Halstead SB, O’Rourke EJ, 1977. Antibody-enhanced dengue virus infection in primate leukocytes. Nature 265 :739–741.

  • 8

    Morens DM, Venkateshan CN, Halstead SB, 1987. Dengue 4 virus monoclonal antibodies identify epitopes that mediate immune enhancement of dengue 2 viruses. J Gen Virol 68 :91–98.

    • Search Google Scholar
    • Export Citation
  • 9

    Burke DS, Nisalak A, Johnson DE, Scott RM, 1988. A prospective study of dengue infections in Bangkok. Am J Trop Med Hyg 38 :172–180.

  • 10

    Guzman MG, Kouri GP, Bravo J, Soler M, Vazquez S, Morier L, 1990. Dengue hemorrhagic fever in Cuba, 1981: a retrospective seroepidemiologic study. Am J Trop Med Hyg 42 :179–184.

    • Search Google Scholar
    • Export Citation
  • 11

    Sangkawibha N, Rojanasuphot S, Ahandrik S, Viriyapongse S, Jatanasen S, Salitul V, Phanthumachinda B, Halstead SB, 1984. Risk factors for dengue shock syndrome: a prospective epidemiologic in Rayong, Thailand. I. The 1980 outbreak. Am J Epidemiol 120 :653–669.

    • Search Google Scholar
    • Export Citation
  • 12

    Gubler DJ, Reed D, Rosen L, Hitchcock JC, 1978. Epidemiologic, clinical and virologic observations on dengue in the kingdom of Tonga. Am J Trop Med Hyg 27 :581–589.

    • Search Google Scholar
    • Export Citation
  • 13

    Messer WB, Gubler DJ, Harris E, Sivananthan K, de Silva AM, 2003. Emergence and global spread of a dengue serotype 3, subtype III virus. Emerg Infect Dis 9 :880–889.

    • Search Google Scholar
    • Export Citation
  • 14

    Rico-Hesse R, Harrison LM, Salas RA, Tovar D, Nisalak A, Ramos C, Boshell J, de Mesa MT, Nogueira RM, da Rosa AT, 1997. Origins of dengue type 2 viruses associated with increased pathogenicity in the Americas. Virology 230 :244–251.

    • Search Google Scholar
    • Export Citation
  • 15

    Watts D, Porter K, Putvatana R, Vasquez R, Calampa C, Hayes C, Halstead SB, 1999. Failure of secondary dengue 2 genotype I infection to cause dengue hemorrhagic fever. Lancet 354 :1431–1434.

    • Search Google Scholar
    • Export Citation
  • 16

    Gubler DJ, Suharyano W, Lubis I, Eram S, Gunarso S, 1981. Epidemic dengue 3 in central Java, associated with low viremia in man. Am J Trop Med Hyg 27 :1049–1099.

    • Search Google Scholar
    • Export Citation
  • 17

    Gubler DJ, Rosen L, 1977. Quantitative aspects of replication of dengue viruses in Aedes albopictus (Diptera: Culicidae) after oral and parental infection. J Med Entomol 13 :469–472.

    • Search Google Scholar
    • Export Citation
  • 18

    Rosen L, 1977. The emperor’s new clothes revisited, or reflections on the pathogenesis of dengue hemorrhagic fever. Am J Trop Med Hyg 26 :337–343.

    • Search Google Scholar
    • Export Citation
  • 19

    Leitmeyer KC, Vaughn DW, Watts DM, Salas R, de Chacon IV, Ramos C, Rico-Hesse R, 1999. Dengue virus structural differences that correlate with pathogenesis. J Virol 73 :4738–4747.

    • Search Google Scholar
    • Export Citation
  • 20

    Cologna R, Armstrong PM, Rico-Hesse R, 2005. Selection for virulent dengue viruses occurs in human and mosquitoes. J Virol 79 :853–859.

  • 21

    Pryor MJ, Carr JM, Hocking H, Davidson AD, Li P, Wright PJ, 2001. Replication of dengue virus type 2 in human monocyte-derived macrophages: comparisons of isolates and recombinant viruses with substitutions at amino acid 390 in the envelope glycoprotein. Am J Trop Med Hyg 65 :427–434.

    • Search Google Scholar
    • Export Citation
  • 22

    Mangada MN, Igarashi A, 1998. Molecular and in vitro analysis of eight dengue type 2 viruses isolated from patients exhibiting different disease severities. Virology 244 :458–466.

    • Search Google Scholar
    • Export Citation
  • 23

    Guzman MG, Kouri G, Halstead SB, 2000. Do escape mutants explain rapid increases in dengue case-fatality rates within epidemics? Lancet 355 :1902–1903.

    • Search Google Scholar
    • Export Citation
  • 24

    Guzman MG, Kouri G, Valdes L, Bravo J, Vazquez S, Halstead SB, 2002. Enhanced severity of secondary dengue-2 infection: death rates in 1981 and 1997 Cuban outbreaks. Rev Panam Salud Publica 11 :223–227.

    • Search Google Scholar
    • Export Citation
  • 25

    Chao DY, Lin TH, Hwang KP, Huang JH, Liu CC, King CC, 2004. 1998 dengue hemorrhagic fever epidemic in Taiwan. Emerg Infect Dis 10 :552–554.

    • Search Google Scholar
    • Export Citation
  • 26

    Wu MH, Hwang KP, Tsai JJ, Wu TS, Huang YC, King CC, 2005. Epidemiology of dengue fever/dengue hemorrhagic fever in Taiwan, 2001–2003. Taiwan J Pub Health 24 :452–459.

    • Search Google Scholar
    • Export Citation
  • 27

    Rodriguez-Roche R, Alvarez M, Gritsun T, Halstead S, Kouri G, Gould EA, Guzman MG, 2005. Virus evolution during a severe dengue epidemic in Cuba, 1997. Virology 334 :154–159.

    • Search Google Scholar
    • Export Citation
  • 28

    Wang WK, Chen HL, Yang CF, Hsieh SC, Juan CC, Chang SM, Yu CC, Lin LH, Huang JH, King CC, 2006. Slower rates of clearance of viral load and virus-containing immune complexes in patients with dengue hemorrhagic fever. Clin Infect Dis 43 :1023–1030.

    • Search Google Scholar
    • Export Citation
  • 29

    Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV, 1992. Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 30 :545–551.

    • Search Google Scholar
    • Export Citation
  • 30

    Shu PY, Chen LK, Chang SF, Yueh YY, Chow L, Chien LJ, Lin TH, Huang JH, 2003. Comparison of capture immunoglobulin M (IgM) and IgG enzyme-linked immunosorbent assay (ELISA) and nonstructural protein NS1 serotype-specific IgG ELISA for differentiation of primary and secondary dengue virus infections. Clin Vaccine Immunol 10 :622–630.

    • Search Google Scholar
    • Export Citation
  • 31

    Wang WK, Lin SR, Lee CM, King CC, Chang SC, 2002. Dengue-3 virus in plasma is a population of closely related genomes: quasispecies. J Virol 76 :4662–4665.

    • Search Google Scholar
    • Export Citation
  • 32

    Kwok S, Higuchi R, 1989. Avoiding false positive with PCR. Nature 339 :237–238.

  • 33

    Irie K, Mohan PM, Sasaguri Y, Putnak R, Padmanabhan R, 1989. Sequence analysis of cloned dengue virus type 2 genome (New Guinea-C strain). Gene 75 :197–211.

    • Search Google Scholar
    • Export Citation
  • 34

    Centers for Disease Control Taiwan, 2004. Cases of dengue hemorrhagic fever and dengue shock syndrome in Taiwan. Epidemiol Bull 20 :46–47.

    • Search Google Scholar
    • Export Citation
  • 35

    Salda LTD, Parquet MDC, Matias RR, Natividad FF, Kobayashi N, Morita K, 2005. Molecular epidemiology of dengue 2 viruses in the Philippines: genotype shift and local evolution. Am J Trop Med Hyg 73 :796–802.

    • Search Google Scholar
    • Export Citation
  • 36

    Twiddy SS, Farrar JJ, Chau NV, Wills B, Gould EA, Gritsun T, Lloyd G, Holmes EC, 2002. Phylogenetic relationships and differential selection pressures among genotypes of dengue-2 virus. Virology 298 :53–72.

    • Search Google Scholar
    • Export Citation
  • 37

    Wang E, Ni H, Xu R, Barrett ADT, Watowich SJ, Gubler DJ, Weaver SC, 2000. Evolutionary relationships of endemic/epidemic and sylvatic dengue viruses. J Virol 74 :3227–3234.

    • Search Google Scholar
    • Export Citation
  • 38

    Zhang C, Mammen MP Jr, Chinnawirotpisan P, Klungthong C, Rodpradit P, Nisalak A, Vaughn DW, Nimmannitya S, Kalayanarooj S, Holmes EC, 2006. Structure and age of genetic diversity of dengue virus type 2 in Thailand. J Gen Virol 87 :873–883.

    • Search Google Scholar
    • Export Citation
  • 39

    Felsenstein J, 2005. PHYLIP (Phylogeny Inference Package) version 3.6. Program distributed by the author. Department of Genome Sciences, University of Washington, Seattle.

  • 40

    Huelsenbeck JP, Ronquist F, 2001. MRBAYES: Bayesian inference of phylogeny. Bioinformatics 17 :754–755.

  • 41

    Ronquist F, Huelsenbeck JP, 2003. MRBAYES 3: Bayesian phylogenetic inference under mixed models. Bioinformatics 19 :1572–1574.

  • 42

    Schmidt HA, Strimmer K, Vingron M, von Haeseler A, 2002. TREE-PUZZLE: maximum likelihood phylogenetic analysis using quartets and parallel computing. Bioinformatics 18 :502–504.

    • Search Google Scholar
    • Export Citation
  • 43

    Nylander JAA, 2004. MrModeltest v2. Program distributed by the author. Evolutionary Biology Centre, Uppsala University.

  • 44

    Kosakovsky Pond SL, Frost SDW, 2005. Datamonkey: rapid detection of selective pressure on individual sites of codon alignments. Bioinformatics 21 :2531–2533.

    • Search Google Scholar
    • Export Citation
  • 45

    Kumar S, Tamura K, Jakobsen IB, Nei M, 2001. MEGA2: molecular evolutionary genetic analysis software. Bioinformatics 17 :1244–1245.

  • 46

    Klungthong C, Zhang C, Mammen MP, Ubol S, Holmes EC, 2004. The molecular epidemiology of dengue virus serotype 4 in Bangkok, Thailand. Virology 329 :168–179.

    • Search Google Scholar
    • Export Citation
  • 47

    Thu HM, Lowry K, Jiang L, Hlaing T, Holmes EC, Aaskov J, 2005. Lineage extinction and replacement in dengue type 1 virus populations are due to stochastic events rather than to natural selection. Virology 336 :163–172.

    • Search Google Scholar
    • Export Citation
  • 48

    Lee IK, Liu JW, Yang KD, 2005. Clinical characteristics and risk factors for concurrent bacteremia in adults with dengue hemorrhagic fever. Am J Trop Med Hyg 72 :221–226.

    • Search Google Scholar
    • Export Citation
  • 49

    Modis Y, Ogata S, Clements D, Harrison SC, 2004. Structure of the dengue virus envelope protein after membrane fusion. Nature 427 :313–319.

    • Search Google Scholar
    • Export Citation
  • 50

    Innis BL, Thirawuth V, Hemachudha C, 1989. Identification of continuous epitopes of the envelope glycoprotein of dengue type 2 virus. Am J Trop Med Hyg 40 :676–687.

    • Search Google Scholar
    • Export Citation
  • 51

    Roehrig JT, Johnson AJ, Hunt AR, Bolin RA, Chu MC, 1990. Antibodies to dengue 2 virus E-glycoprotein synthetic peptides identify abtigenic conformation. Virology 177 :668–675.

    • Search Google Scholar
    • Export Citation
  • 52

    Roehrig JT, Risi PA, Brubaker JR, Hunt AR, Beaty BJ, Trent DW, Mathews JH, 1994. T-helper cell epitopes on the E-glycoprotein of dengue 2 Jamaica virus. Virology 198 :31–38.

    • Search Google Scholar
    • Export Citation
  • 53

    Holmes EC, 2003. Patterns of intra- and interhost nonsynonymous variation reveal strong purifying selection in dengue virus. J Virol 77 :11296–11298.

    • Search Google Scholar
    • Export Citation
  • 54

    Holmes EC, Twiddy SS, 2003. The origin, emergence and evolutionary genetics of dengue virus. Infect Genet Evol 3 :19–28.

  • 55

    Sittisombut N, Sistayanarain A, Cardosa MJ, Salminen M, Damrongdachakul S, Kalayanarooj S, Rojanasupot S, Supawadee J, Maneekarn N, 1997. Possible occurrence of a genetic bottle neck in dengue serotype 2 viruses between the 1980 and 1987 epidemic seasons in Bangkok, Thailand. Am J Trop Med Hyg 57 :100–108.

    • Search Google Scholar
    • Export Citation
  • 56

    Wittke V, Robb TE, Thu HM, Nisalak A, Nimmannitya S, Kalayanrooj S, Vaughn DW, Endy TP, Holmes EC, Aaskov JG, 2002. Extinction and rapid evolution of strains of dengue 3 virus during an interepidemic period. Virology 301 :148–156.

    • Search Google Scholar
    • Export Citation
  • 57

    Bennett SN, Holmes EC, Chirivella M, Rodriguez DM, Beltran M, Vordam V, Gubler DJ, McMillan WO, 2003. Selection-driven evolution of emergent dengue virus. Mol Biol Evol 20 :1650–1658.

    • Search Google Scholar
    • Export Citation

Author Notes

Reprint requests: Wei-Kung Wang, Institute of Microbiology, College of Medicine, National Taiwan University, No. 1, Sec. 1, Jen-Ai Rd, Taipei, Taiwan, Tel: 8862-2312-3456 ext. 8286, Fax: 8862-2391-5293, E-mail: wwang60@yahoo.com.
Save