• 1

    Eckert J, Schantz PM, Gasser RB, Torgerson PR, Bessonov AS, Movsessian SO, Thakur A, Grimm F, Nikogossian MA, 2001. Geographic distribution and prevalence. Eckert J, Gemmell MA, Meslin FX, Pawlowski ZS, eds. WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. Paris: World Organisation for Animal Health, 100–141.

  • 2

    Pawlowski ZS, Eckert J, Vuitton DA, Ammann RW, Kern P, Craig PS, Dar KF, De Rossa F, Filice C, Gottstein B, Grimm F, Macpherson CNL, Sato N, Todorov T, Uchino J, von Sinner W, Wen H, 2001. Echinococcosis in humans: clinical aspects, diagnosis and treatment. Eckert J, Gemmell MA, Meslin FX, Pawlowski ZS, eds. WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. Paris: World Organisation for Animal Health, 47–61.

  • 3

    Rausch RL, 1995. Life cycle patterns and geographic distribution of Echinococcus multilocularis. Thompson RCA, Lymbery AJ, eds. Echinococcus and Hydatid Diseases. Wallingford, UK: CAB International, 104–114.

  • 4

    Schantz PM, Chai J, Craig PS, Eckert J, Jenkins D, Macpherson CNL, Thakur A, 1995. Epidemiology and control of hydatid disease. Thompson RCA, Lymbery AJ, eds. Echinococcus and Hydatid Diseases. Wallingford, UK: CAB International, 286–291.

  • 5

    Wilson JF, Rausch RL, Wilson FR, 1995. Alveolar hydatid disease. Review of the surgical experience in 42 cases of active disease among Alaskan Eskimos. Ann Surg 221 :315–323.

    • Search Google Scholar
    • Export Citation
  • 6

    James E, Boyd W, 1937. Echinococcus alveolaris (with the report of a case). Can Med Assoc J 36 :354–356.

  • 7

    Gamble WG, Segal M, Schantz PM, Rausch RL, 1977. Alveolar hydatid disease in Minnesota. First human case acquired in the contiguous United States. JAMA 241 :904–907.

    • Search Google Scholar
    • Export Citation
  • 8

    Schantz PM, 1979. Alveolar hydatid disease in Minnesota. J Am Vet Med Assoc 175 :3, 8.

  • 9

    Haag KL, Zaha A, Araujo AM, Gottstein B, 1997. Reduced genetic variability within coding and non-coding regions of the Echinococcus multilocularis genome. Parasitology 115 :521–529.

    • Search Google Scholar
    • Export Citation
  • 10

    Bart JM, Knapp J, Gottstein B, El-Garch F, Giraudoux P, Glowatzki ML, Berthoud H, Maillard S, Piarroux R, 2006. EmsB, a tandem repeated multi-loci microsatellite, new tool to investigate the genetic diversity of Echinococcus multilocularis. Infect Genet Evol 6 :390–400.

    • Search Google Scholar
    • Export Citation
  • 11

    Yamasaki H, Nakaya K, Nakao M, Sako Y, Ito A, 2007. Significance of molecular diagnosis using histopathological specimens in cestode zoonoses. Trop Med Health 35 :307–321.

    • Search Google Scholar
    • Export Citation
  • 12

    Yamasaki H, Nakaya K, Nakao M, Sako Y, Ito A, 2007. Mitochondrial DNA diagnosis for cestode zoonoses: application to formalin-fixed paraffin-embedded tissue specimens. Southeast Asian J Trop Med Public Health 38 (Suppl 1):166–174.

    • Search Google Scholar
    • Export Citation
  • 13

    Bretagne S, Assouline B, Vidaud D, Houin R, Vidaud M, 1996. Echinococcus multilocularis: microsatellite polymorphism in U1 snRNA genes. Exp Parasitol 82 :324–328.

    • Search Google Scholar
    • Export Citation
  • 14

    Rinder H, Rausch RL, Takahashi K, Kopp H, Thomschke A, Loscher T, 1997. Limited range of genetic variation in Echinococcus multilocularis. J Parasitol 83 :1045–1050.

    • Search Google Scholar
    • Export Citation
  • 15

    Kritsky DC, Leiby PD, 1978. Studies on sylvatic echinococcosis. V. Factors influencing prevalence of Echinococcus multilocularis Leuckart 1863, in red foxes from North Dakota, 1965–1972. J Parasitol 64 :625–634.

    • Search Google Scholar
    • Export Citation
  • 16

    Storandt ST, Kazacos KR, 1993. Echinococcus multilocularis identified in Indiana, Ohio, and east-central Illinois. J Parasitol 79 :301–305.

    • Search Google Scholar
    • Export Citation
  • 17

    Storandt ST, Virchow DR, Dryden MW, Hygnstrom SE, Kazacos KR, 2002. Distribution and prevalence of Echinococcus multilocularis in wild predators in Nebraska, Kansas, and Wyoming. J Parasitol 88 :420–422.

    • Search Google Scholar
    • Export Citation
  • 18

    Ito A, Romig T, Takahashi K, 2003. Perspective on control options for Echinococcus multilocularis with particular reference to Japan. Parasitology 127 :S159–S172.

    • Search Google Scholar
    • Export Citation
  • 19

    Hofer S, Gloor S, Müller U, Matghis A, Hegglin D, Deplazes P, 2000. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zürich, Switzerland. Parasitology 120 :135–142.

    • Search Google Scholar
    • Export Citation
  • 20

    Yimam AE, Nonaka N, Oku Y, Kamiya M, 2002. Prevalence and intensity of Echinococcus multilocularis in red foxes (Vulpes vulpes schrencki) and raccoon dogs (Nyctereutes procyonoides albus) in Otaru City, Hokkaido, Japan. Jpn J Vet Res 49 :287–296.

    • Search Google Scholar
    • Export Citation
  • 21

    Vuitton DA, Zhou H, Bresson-Hadni S, Wang Q, Piarroux M, Raoul F, Giraudoux P, 2003. Epidemiology of alveolar echinococcosis with particular reference to China and Europe. Parasitology 127 :S87–107.

    • Search Google Scholar
    • Export Citation
  • 22

    Bartel MH, Seesee FM, Worley DE, 1992. Comparison of Montana and Alaska isolates of Echinococcus multilocularis in gerbils with observation on the cyst growth, hook characteristics, and host response. J Parasitol 78 :529–532.

    • Search Google Scholar
    • Export Citation
  • 23

    Gottstein B, Bettens F, 1994. Association between HLA-DR13 and susceptibility to alveolar echinococcosis. J Infect Dis 169 :1416–1417.

  • 24

    Eiermann TH, Bettens F, Tiberghien P, Schmitz K, Beurton I, Bresson-Hadni S, Ammann RW, Goldmann SF, Vuitton DA, Gottstein B, Kern P, 1998. HLA and alveolar echinococcosis. Tissue Antigens 52 :124–129.

    • Search Google Scholar
    • Export Citation
  • 25

    Godot V, Harraga S, Beurton I, Tiberghien P, Sarciron E, Gottstein B, Vuitton DA, 2000. Persistence/susceptibility to Echinococcus multilocularis infection and cytokine profile in humans. II. Influence of the HLA B8, DR3, DQ2 haplotype. Clin Exp Immunol 121 :491–498.

    • Search Google Scholar
    • Export Citation
  • 26

    Zhang S, Penfornis A, Harraga S, Chabod J, Beurton I, Bresson-Hadni S, Tiberghien P, Kern P, Vuitton DA, 2003. Polymorphisms of the TAP1 and TAP2 genes in human alveolar echinococcosis. Eur J Immunogenet 30 :133–139.

    • Search Google Scholar
    • Export Citation
  • 27

    Harraga S, Godot V, Bresson-Hadni S, Mantion G, Vuitton DA, 2003. Profile of cytokine production within the periparasitic granuloma in human alveolar echinococcosis. Acta Trop 85 :231–236.

    • Search Google Scholar
    • Export Citation
  • 28

    Vuitton DA, Zhang SL, Yang Y, Godot V, Beurton I, Mantion G, Bresson-Hadni S, 2006. Survival strategy of Echinococcus multilocularis in the human host. Parasitol Int 55 (Suppl):S51–S55.

    • Search Google Scholar
    • Export Citation
  • 29

    Nakao M, McManus DP, Schantz PM, Craig PS, Ito A, 2007. A molecular phylogeny of the genus Echinococcus inferred from complete mitochondrial genomes. Parasitology 134 :713–722.

    • Search Google Scholar
    • Export Citation
  • 30

    Ito A, Nakao M, Sako Y, 2007. Echinococcosis: serological detection of patients and molecular identification of parasites. Future Microbiol 2 :439–449.

    • Search Google Scholar
    • Export Citation
 
 
 

 

 

 

 

 

 

Genetic Analysis of Echinococcus multilocularis Originating from a Patient with Alveolar Echinococcosis Occurring in Minnesota in 1977

View More View Less
  • 1 Department of Parasitology and Animal Laboratory for Medical Research, Asahikawa Medical College, Asahikawa, Japan; Division of Parasitic Diseases, National Center for Zoonotic, Vectorborne and Enteric Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia

To date, only a single proven case of autochthonous human alveolar echinococcosis has been recorded in Minnesota in 1977. At that time, echinococcal lesions removed from the patient were experimentally inoculated into voles, and the parasite materials obtained from the voles were preserved as histopathologic specimens for 30 years. In this study, retrospective genetic analysis of larval Echinococcus multilocularis originating in the human case was performed using the histopathologic specimens. DNA was extracted from the hematoxylin and eosin–stained specimens, and mitochondrial cytochrome c oxidase subunit 1 gene (cox1) was amplified by polymerase chain reaction. Subsequently, 20 small fragments (100~216 bp) covering almost the entire sequences (97%) of the cox1 were successfully amplified, and the nucleotide sequence analysis showed that the E. multilocularis isolate from Minnesota was almost identical to an isolate from South Dakota rather than isolates from contiguous Alaska.

Alveolar echinococcosis (AE) in humans is a potentially lethal parasitic disease caused by the larval stage (metacestode) of the fox tapeworm, Echinococcus multilocularis and occurs in most of the northern hemisphere, including central Europe, most of northern and central Eurasia, and parts of North America.1 The metacestode proliferates like a tumor in various organs, mainly liver, and develops into multivesiculated lesions. Clinical symptoms such as jaundice, epigastric pain, fatigue, and/or hepatomegaly may appear after an asymptomatic period of 5–15 years, and treatment may be difficult despite a variety of surgical and chemotherapeutic approaches.2

In North America, E. multilocularis is distributed in two distinct geographic regions: the northern tundra zone (western Alaska, Arctic islands such as St. Lawrence Island, and Canadian Arctic Archipelago), and northern central America, including three provinces of Canada and 13 contiguous states of the United States.1,3,4 In Alaska, the tapeworm infections are perpetuated in a sylvatic cycle with carnivores, mainly arctic foxes (Alopex lagopus), red foxes (Vulpes vulpes) as definitive hosts, and small rodents such as voles (Microtus oeconomus) and brown lemming (Lemmus trimucronatus) as intermediate hosts.3 Domestic dogs can also harbor the tapeworm. In central North America, red foxes, grey foxes (Urocyon cinereoargenteus), and coyotes (Canis latrans) as definitive hosts and red-backed voles (Clethrionomys rutilus), meadow voles (Microtus pennsylvanicus), bushy-tailed woodrat (Neotoma cinerea), and deer mouse (Peromyscus maniculatus) as intermediate hosts are involved in the completion of the parasitic cycle.4

Regarding human AE in North America, 73 cases were reported between 1951 and 1993: 71 were in Alaskan Eskimos,5 and 2 cases were from Winnipeg, Manitoba, Canada in 19376 and Minnesota in 1977.7,8 Regarding genotypes of E. multilocularis isolated from humans, there is no information about genotypes of E. multilocularis from the United States, although a few isolates from Canada have been genetically examined.9,10

In this study, to examine the genotype of E. multilocularis originating from the AE patient reported in Minnesota in 1977,7 mitochondrial DNA analysis was performed using archival specimens prepared at that time. The case was autochthonous to Minnesota, and the patient was a 56-year-old woman. The patient complained of epigastric discomfort and malaise and was first suspected to have a malignancy. However, the clinical, serologic, and pathologic findings led to the diagnosis of AE. In addition, the identification of E. multilocularis was confirmed by metacestodes developed in red-backed voles (C. rutilus) inoculated intraperitoneally with tissue from the hepatic lesions of the patient. The parasite materials obtained from the voles were processed for histopathology and were preserved as hematoxylin and eosin (HE)-stained specimens for the past 30 years.

Template DNAs for polymerase chain reaction (PCR) were prepared by the method described previously11: the HE-stained sections were rinsed in xylene after removal of coverslips, washed in absolute ethanol, and air dried. At first, 10 μL of 0.05 N NaOH solution was placed onto some sections, and the sections were scalped, collected into Eppendorf tubes, and heated at 95°C for 1 hour. As an alternative method, a DNA Isolator PS kit (Wako Pure Chemicals, Osaka, Japan) was used for DNA extraction from the remaining sections. The PCR amplification of the cytochrome c oxidase subunit 1 gene (cox1) was performed in a 50-μL reaction mixture as reported previously.12 Primer pairs used are shown in Table 1. F17 was used in combination with both R17 and R18. F20 was used with R18. The reaction was performed for 35 cycles of denaturation (94°C, 30 seconds), annealing (58°C, 30 seconds), and extension (72°C, 90 seconds) with a thermal cycler (GeneAmp 9700; PE Applied Biosystems, Foster City, CA). Direct DNA sequencing for the PCR amplicons was performed using a BigDye Terminator v. 3.1 Cycle Sequencing ready reaction kit (Applied Biosystems). Resultant sequence ladders were read with an ABI PRISM 310 or 3100 Genetic Analyzer (Applied Biosystems).

Because the E. multilocularis specimens used were fixed in formalin, and very limited amounts of the sections were available, only 20 small fragments (100~216 bp) were amplified (data not shown). Unfortunately, amplification of two regions using F1/R1 and F3/R3 primer pairs was not successful because of the lack of DNA sample and positions 1–23 and 175–207 were not determined. The total number of nucleotide sites determined from the 20 cox1 fragments was 1,552. Of these sites, 11 were substituted compared with known cox1 sequences of E. multilocularis isolates (Table 2). The nucleotide sequences between two isolates from Minnesota and South Dakota were the same except for a nucleotide at position 688: C for Minnesota and T for South Dakota (Table 2). There were nine transitional substitutions between isolates from Minnesota and Alaska. Higher sequence homologies were shown with E. multilocularis from South Dakota (99.9%) compared with E. multilocularis from contiguous Alaska and from Japan (99.4%), indicating that E. multilocularis isolates from Minnesota and South Dakota belong to the same genotypic group.

There are some reports on genotypes of E. multilocularis isolates from Alaska and contiguous Canada and the United States; however, the number of E. multilocularis genotypes is variable (1–4) depending on the target genes and number of specimens examined.9,10,13,14 The Minnesota isolate reported here seems to be identical to the genotype from Montana and Canada based on geographic locations.

Despite the widespread occurrence and high prevalence of E. multilocularis infections in definitive hosts in North America,4,1517 human cases seem to be few compared with the number of AE patients reported from Japan18 and Europe,1921 where the prevalence of the E. multilocularis infection in definitive hosts is also high. In the extensive Arctic and sub-Arctic regions of Canada where E. multilocularis is endemic in definitive host animals,4 cases of human AE have never been reported. To date only two cases of AE were diagnosed in the contiguous north-central region of Canada and the United States.6,7 The reasons are not fully understood; however, human behavioral factors21 and life cycles of the parasite involving synanthropic or sylvatic transmission4,18 may be hypothesized. Genetic variations9,10,13,14 and biological attributes22 among E. multilocularis isolates and immunogenetic factors in humans2328 might play some roles in infectivity of E. multilocularis to humans. Because there are limited data on genotypes/haplotypes of E. multilocularis from North America except for Alaska, the data reported here may also provide useful information in considering the phylogeography of E. multilocularis.29,30

Table 1.

PCR primer pairs used in this study

Primers*Nucleotide sequences for cox1Positions
* Forward (F) and reverse (R) primers having the same number were basically used as primer pairs.
† Designed based on AB353729. Other primers from AB018440.
F1ATTTAGGGGCTGGTTGGTCATCTTAT45–68 for trnW
R1AACCAACAAAACCAGACCATA100–80
F2ATGAGAGTGGTGTGATTAGGTAG1–23
R2ATTATACCATGATTAGTCACCAAAAA200–175
F3TTAAGTTTTAGTTTGTTGATT100–120
R3†AATATAGGCATCAAAAAAAAAAA230–208
F4TGACTAATCATGGTATAATAATGATC182–207
R4GGCAAATTCAAATCAGACAAACCACC293–268
F5GTTTGGTAATTATTTATTGCCTTTG240–264
R5TGCAAAGAAAACATCAAAAAATCAA455–431
F6TGCCACGTTTGAATGCTTTGAGTGCG290–315
R6ACAATGGAGGATAAAAAGTCCAACCA400–375
F7TCTTCTTCATATTTTTCTAGGAGTAG400–425
R7AGGCAACGTCACTAACAATAAAATA600–576
F8CTAGAGTTTTTAGTTCTATAAATTT470–494
R8CAAAAGCATAGTAATAGCAGCAGCC630–606
F9GTACTTTGTATAGTGTTTTTATGACT500–525
R9CCAAAAAACCAAAACATATGCTGAA716–692
F10CGTTAGGTGGTGGTGATCCTATTCTA665–690
R10ACTCCCTAAACACACTATAGAAAACA855–830
F11ATGTTTTGGTTTTTTGGTCATCCGGA700–725
R11AAACAACAAACCATAAAACCCAAAC825–801
F12CGTTTGGGTTTTATGGTTTGTTGTTT800–825
R12TATTTACACTAGAATTAAGCAACAT1,000–976
F13GACTGGTATAAAGGTGTTTACTTGGT945–970
R13CACCACCAAACGTAAACAACACTAT1,060–1,036
F14AAGAGTGATCCTATTTTGTGGTGGGT1,000–1,025
R14CAACGGTCACCATCAAATAAACATAA1200–1175
F15TGTTATGTCGTTAGGTTCTTATATAA1,140–1,165
R15AATATTAGAAATTATACACTGACAT1,260–1,236
F16ATTACTGGTTTGAGGTTGAATAAGT1,201–1,225
R16CACCCACTAAACGCAGATATAAAAG1,400–1,376
F17ATTGGGTTAAAATGGTTTGTACTGT1,346–1,370
R17AGACCTCTTTCTTACTTACCATAGA1,450–1,426
R18CACCATAAGTATAATCAACACTATA1,555–1,531
F19TCTTTTATATCTGCGTTTAGTGGGTG1,375–1,400
R19TACAGGACTCATTAAATAATCCACTA1,500–1,475
F20GAAAGAGGTGTTGGGTTCATATAAA1,440–1,464
F21AGCTTGTCATAATGATTATTTTTGTT1,500–1,525
R21CTAACCAACAGCAAATACATAATTAC1,608–1,583
F22GATTATACTTATGGTGTATATTATAT1,540–1,565
R22ATCATAAACTTTAACTAACTAACC24–1 for trnT
Table 2.

Base-substituted sites in cytochrome c oxidase subunit 1 genes among six E. multilocularis isolates

Base-substituted sites
E. multilocularis isolates fromAccession numbers2895856887357608008221,3141,3291,3511,573
* The isolates from South Dakota and Alaska were derived from fox and vole, respectively (Nakao and others, unpublished data).
† This case was diagnosed at autopsy in a remote area from Hokkaido, Japan.11
‡ Data not available.
MinnesotaAB353729CACGGTGGAAG
South Dakota*AB374425CATGGTGGAAG
Alaska*Same as AB018440TGCTACGTGGA
Hokkaido, JapanAB018440TGCTACGTGGA
Fukui, Japan†AB385610TGCTACGTGGA
Slovak RepublicDQ013305ACA

*

Address correspondence to Hiroshi Yamasaki, Department of Parasitology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjukuku, Tokyo 162-8640, Japan. E-mail: hyamasak@nih.go.jp

Authors’ addresses: Hiroshi Yamasaki, Department of Parasitology, National Institute of Infectious Diseases, Toyama 1-23-1, Shinjukuku, Tokyo 162-8640, Japan, Tel: 81-3-5285-1111. ext. 2200, Fax: 81-3-5285-1173, E-mail: hyamasak@nih.go.jp. Minoru Nakao, Department of Parasitology, Asahikawa Medical College, Midorigaoka Higashi 2-1-1-1, Asahikawa 078-8510, Japan, Tel: 81-166-68-2423, Fax: 81-166-68-2429, E-mail: nakao@asahikawa-med.ac.jp. Kazuhiro Nakaya, Animal Laboratory for Medical Research, Asahikawa Medical College, Midorigaoka Higashi 2-1-1-1, Asahikawa 078-8510, Japan, Tel: 81-166-68-2683, Fax: 81-166-68-2679, E-mail: nky48@asahikawa-med.ac.jp. Peter M. Schantz, Division of Parasitic Diseases, National Center for Zoonotic, Vectorborne and Enteric Diseases, Centers for Disease Control and Prevention, 4700 Buford Highway, Atlanta, GA 30341, Tel: 1-770-488-7767, Fax: 1-770-488-7761, E-mail: pms1@cdc.gov. Akira Ito, Department of Parasitology, Asahikawa Medical College, Midorigaoka Higashi 2-1-1-1, Asahikawa 078-8510, Japan, Tel: 81-166-68-2420, Fax: 81-166-68-2429, E-mail: akiraito@asahikawa-med.ac.jp.

Financial support: This work was supported in part by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (14256001; 17256002) and Infection Matrix Special Fund from the Ministry of Education, Japan, to AI. The nucleotide sequence data reported in this paper are available in the DDBJ/GenBank/EMBL databases under accession numbers AB353729 and AB374425.

REFERENCES

  • 1

    Eckert J, Schantz PM, Gasser RB, Torgerson PR, Bessonov AS, Movsessian SO, Thakur A, Grimm F, Nikogossian MA, 2001. Geographic distribution and prevalence. Eckert J, Gemmell MA, Meslin FX, Pawlowski ZS, eds. WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. Paris: World Organisation for Animal Health, 100–141.

  • 2

    Pawlowski ZS, Eckert J, Vuitton DA, Ammann RW, Kern P, Craig PS, Dar KF, De Rossa F, Filice C, Gottstein B, Grimm F, Macpherson CNL, Sato N, Todorov T, Uchino J, von Sinner W, Wen H, 2001. Echinococcosis in humans: clinical aspects, diagnosis and treatment. Eckert J, Gemmell MA, Meslin FX, Pawlowski ZS, eds. WHO/OIE Manual on Echinococcosis in Humans and Animals: a Public Health Problem of Global Concern. Paris: World Organisation for Animal Health, 47–61.

  • 3

    Rausch RL, 1995. Life cycle patterns and geographic distribution of Echinococcus multilocularis. Thompson RCA, Lymbery AJ, eds. Echinococcus and Hydatid Diseases. Wallingford, UK: CAB International, 104–114.

  • 4

    Schantz PM, Chai J, Craig PS, Eckert J, Jenkins D, Macpherson CNL, Thakur A, 1995. Epidemiology and control of hydatid disease. Thompson RCA, Lymbery AJ, eds. Echinococcus and Hydatid Diseases. Wallingford, UK: CAB International, 286–291.

  • 5

    Wilson JF, Rausch RL, Wilson FR, 1995. Alveolar hydatid disease. Review of the surgical experience in 42 cases of active disease among Alaskan Eskimos. Ann Surg 221 :315–323.

    • Search Google Scholar
    • Export Citation
  • 6

    James E, Boyd W, 1937. Echinococcus alveolaris (with the report of a case). Can Med Assoc J 36 :354–356.

  • 7

    Gamble WG, Segal M, Schantz PM, Rausch RL, 1977. Alveolar hydatid disease in Minnesota. First human case acquired in the contiguous United States. JAMA 241 :904–907.

    • Search Google Scholar
    • Export Citation
  • 8

    Schantz PM, 1979. Alveolar hydatid disease in Minnesota. J Am Vet Med Assoc 175 :3, 8.

  • 9

    Haag KL, Zaha A, Araujo AM, Gottstein B, 1997. Reduced genetic variability within coding and non-coding regions of the Echinococcus multilocularis genome. Parasitology 115 :521–529.

    • Search Google Scholar
    • Export Citation
  • 10

    Bart JM, Knapp J, Gottstein B, El-Garch F, Giraudoux P, Glowatzki ML, Berthoud H, Maillard S, Piarroux R, 2006. EmsB, a tandem repeated multi-loci microsatellite, new tool to investigate the genetic diversity of Echinococcus multilocularis. Infect Genet Evol 6 :390–400.

    • Search Google Scholar
    • Export Citation
  • 11

    Yamasaki H, Nakaya K, Nakao M, Sako Y, Ito A, 2007. Significance of molecular diagnosis using histopathological specimens in cestode zoonoses. Trop Med Health 35 :307–321.

    • Search Google Scholar
    • Export Citation
  • 12

    Yamasaki H, Nakaya K, Nakao M, Sako Y, Ito A, 2007. Mitochondrial DNA diagnosis for cestode zoonoses: application to formalin-fixed paraffin-embedded tissue specimens. Southeast Asian J Trop Med Public Health 38 (Suppl 1):166–174.

    • Search Google Scholar
    • Export Citation
  • 13

    Bretagne S, Assouline B, Vidaud D, Houin R, Vidaud M, 1996. Echinococcus multilocularis: microsatellite polymorphism in U1 snRNA genes. Exp Parasitol 82 :324–328.

    • Search Google Scholar
    • Export Citation
  • 14

    Rinder H, Rausch RL, Takahashi K, Kopp H, Thomschke A, Loscher T, 1997. Limited range of genetic variation in Echinococcus multilocularis. J Parasitol 83 :1045–1050.

    • Search Google Scholar
    • Export Citation
  • 15

    Kritsky DC, Leiby PD, 1978. Studies on sylvatic echinococcosis. V. Factors influencing prevalence of Echinococcus multilocularis Leuckart 1863, in red foxes from North Dakota, 1965–1972. J Parasitol 64 :625–634.

    • Search Google Scholar
    • Export Citation
  • 16

    Storandt ST, Kazacos KR, 1993. Echinococcus multilocularis identified in Indiana, Ohio, and east-central Illinois. J Parasitol 79 :301–305.

    • Search Google Scholar
    • Export Citation
  • 17

    Storandt ST, Virchow DR, Dryden MW, Hygnstrom SE, Kazacos KR, 2002. Distribution and prevalence of Echinococcus multilocularis in wild predators in Nebraska, Kansas, and Wyoming. J Parasitol 88 :420–422.

    • Search Google Scholar
    • Export Citation
  • 18

    Ito A, Romig T, Takahashi K, 2003. Perspective on control options for Echinococcus multilocularis with particular reference to Japan. Parasitology 127 :S159–S172.

    • Search Google Scholar
    • Export Citation
  • 19

    Hofer S, Gloor S, Müller U, Matghis A, Hegglin D, Deplazes P, 2000. High prevalence of Echinococcus multilocularis in urban red foxes (Vulpes vulpes) and voles (Arvicola terrestris) in the city of Zürich, Switzerland. Parasitology 120 :135–142.

    • Search Google Scholar
    • Export Citation
  • 20

    Yimam AE, Nonaka N, Oku Y, Kamiya M, 2002. Prevalence and intensity of Echinococcus multilocularis in red foxes (Vulpes vulpes schrencki) and raccoon dogs (Nyctereutes procyonoides albus) in Otaru City, Hokkaido, Japan. Jpn J Vet Res 49 :287–296.

    • Search Google Scholar
    • Export Citation
  • 21

    Vuitton DA, Zhou H, Bresson-Hadni S, Wang Q, Piarroux M, Raoul F, Giraudoux P, 2003. Epidemiology of alveolar echinococcosis with particular reference to China and Europe. Parasitology 127 :S87–107.

    • Search Google Scholar
    • Export Citation
  • 22

    Bartel MH, Seesee FM, Worley DE, 1992. Comparison of Montana and Alaska isolates of Echinococcus multilocularis in gerbils with observation on the cyst growth, hook characteristics, and host response. J Parasitol 78 :529–532.

    • Search Google Scholar
    • Export Citation
  • 23

    Gottstein B, Bettens F, 1994. Association between HLA-DR13 and susceptibility to alveolar echinococcosis. J Infect Dis 169 :1416–1417.

  • 24

    Eiermann TH, Bettens F, Tiberghien P, Schmitz K, Beurton I, Bresson-Hadni S, Ammann RW, Goldmann SF, Vuitton DA, Gottstein B, Kern P, 1998. HLA and alveolar echinococcosis. Tissue Antigens 52 :124–129.

    • Search Google Scholar
    • Export Citation
  • 25

    Godot V, Harraga S, Beurton I, Tiberghien P, Sarciron E, Gottstein B, Vuitton DA, 2000. Persistence/susceptibility to Echinococcus multilocularis infection and cytokine profile in humans. II. Influence of the HLA B8, DR3, DQ2 haplotype. Clin Exp Immunol 121 :491–498.

    • Search Google Scholar
    • Export Citation
  • 26

    Zhang S, Penfornis A, Harraga S, Chabod J, Beurton I, Bresson-Hadni S, Tiberghien P, Kern P, Vuitton DA, 2003. Polymorphisms of the TAP1 and TAP2 genes in human alveolar echinococcosis. Eur J Immunogenet 30 :133–139.

    • Search Google Scholar
    • Export Citation
  • 27

    Harraga S, Godot V, Bresson-Hadni S, Mantion G, Vuitton DA, 2003. Profile of cytokine production within the periparasitic granuloma in human alveolar echinococcosis. Acta Trop 85 :231–236.

    • Search Google Scholar
    • Export Citation
  • 28

    Vuitton DA, Zhang SL, Yang Y, Godot V, Beurton I, Mantion G, Bresson-Hadni S, 2006. Survival strategy of Echinococcus multilocularis in the human host. Parasitol Int 55 (Suppl):S51–S55.

    • Search Google Scholar
    • Export Citation
  • 29

    Nakao M, McManus DP, Schantz PM, Craig PS, Ito A, 2007. A molecular phylogeny of the genus Echinococcus inferred from complete mitochondrial genomes. Parasitology 134 :713–722.

    • Search Google Scholar
    • Export Citation
  • 30

    Ito A, Nakao M, Sako Y, 2007. Echinococcosis: serological detection of patients and molecular identification of parasites. Future Microbiol 2 :439–449.

    • Search Google Scholar
    • Export Citation
Save