• View in gallery

    The cumulative proportion surviving of Aedes aegypti mosquitoes Rexville-D strain after the first-instar larvae were exposed to different densovirus strains.

  • View in gallery

    The cumulative proportion surviving of Aedes aegypti mosquitoes from Chachoengsao Province after the first-instar larvae were exposed to different densovirus strains.

  • View in gallery

    The cumulative proportion surviving of Aedes aegypti mosquitoes from Bangkok Province after the first-instar larvae were exposed to different densovirus strains.

  • View in gallery

    Phylogenetic tree of densoviruses generated from heuristic search algorithm of PAUP 4.0b1 based on partial sequences of VP gene showing the relationship of AeDNV, AThDNV, AalDNV, and APeDNV with other densoviruses.

  • 1

    Somboon P, Prapanthadara LA, Suwonkerd W, 2003. Insecticide susceptibility tests of Anopheles minimus S.L., Aedes aegypti, Aedes albopictus, Culex quinquefasciatus in northern Thailand. Southeast Asian J Trop Med Public Health 30 :184–194.

    • Search Google Scholar
    • Export Citation
  • 2

    Lima JBP, Da-Cunha MP, Júnior RCDS, Galardo AKR, Soares SDS, Braga IA, Ramos RP, Valle D, 2003. Resistance of Aedes aegypti to organophosphates in several municipalities in the state of Rio de Janeiro and Espírito Santo, Brazil. Am J Trop Med Hyg 68 :329–333.

    • Search Google Scholar
    • Export Citation
  • 3

    Ponlawat A, Scott JG, Harrington LC, 2005. Insecticide susceptibility of Aedes aegypti and Aedes albopictus across Thailand. J Med Entomol 42 :821–825.

    • Search Google Scholar
    • Export Citation
  • 4

    Bergoin M, Tijssen P, 2000. Molecular biology of densovirinae. Contrib Microbiol 4 :12–32.

  • 5

    Bando H, Choi H, Ito Y, Kawase S, 1990. Terminal structure of a densovirus implies a hairpin transfer replication which is similar to the model for AAV. Virology 179 :57–6.

    • Search Google Scholar
    • Export Citation
  • 6

    Lebedeva PO, Zelenko AP, Kuznetsova MA, Gudzgorban AP, 1972. Studies on the demonstration of a viral infection in larvae of Aedes aegypti mosquitoes. Microbiol JUS 34 :70–73.

    • Search Google Scholar
    • Export Citation
  • 7

    Buchatsky LP, 1989. Densonucleosis of bloodsucking mosquitoes. Dis Auq Org 6 :145–150.

  • 8

    Ledermann JP, Suchman EL, Black WC 4th, Carlson JO, 2004. Infection and pathogenicity of the mosquito densoviruses AeDNV, HeDNV, and APeDNV in Aedes aegypti mosquitoes (Diptera: Culicidae). J Econ Entomol 97 :1828–1835.

    • Search Google Scholar
    • Export Citation
  • 9

    Jousset FX, Barreau C, Boublik Y, Cornet M, 1993. A parvo-like virus persistently infecting a C6/36 clone of Aedes albopictus mosquito cell line and pathogenic for Aedes aegypti larvae. Virus Res 29 :99–114.

    • Search Google Scholar
    • Export Citation
  • 10

    Barreau C, Jousset FX, Cornet M, 1994. An efficient and easy method of infection of mosquito larvae from virus-contaminated cells cultures. J Virol Methods 49 :153–156.

    • Search Google Scholar
    • Export Citation
  • 11

    Barreau C, Jousset FX, Bergoin M, 1996. Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes. J Invertebr Pathol 68 :299–309.

    • Search Google Scholar
    • Export Citation
  • 12

    Kittayapong P, Baisley KJ, O’Neill SL, 1999. A mosquito denso-virus infecting Aedes aegypti and Aedes albopictus from Thailand. Am J Trop Med Hyg 61 :612–617.

    • Search Google Scholar
    • Export Citation
  • 13

    Paterson A, Robinson E, Suchman EL, Afanasiev BN, Carlson JO, 2005. Mosquito densonucleosis viruses cause dramatically different infection phenotypes in the C6/36 Aedes albopictus cell line. Virology 337 :253–261.

    • Search Google Scholar
    • Export Citation
  • 14

    Afanasiev BN, Kozlov YV, Carlson JO, Beaty BJ, 1994. Denso-virus of Aedes aegypti as an expression vector in mosquito cells. Exp Parasitol 79 :322–339.

    • Search Google Scholar
    • Export Citation
  • 15

    Swofford DL, 1999. PAUP: Phylogenetic analysis using parsimony, version 4.0 betal. Centre for Agriculture and Bioscience International, Champaign, IL.

  • 16

    Becnel JJ, 2006. Transmission of viruses to mosquito larvae mediated by divalent cations. J Invertebr Pathol 68 :141–145.

  • 17

    Wigglesworth VB, 1938. The regulation of osmotic pressure and chloride concentration in the hemolymph of mosquito larvae. J Exp Biol 15 :235–247.

    • Search Google Scholar
    • Export Citation
  • 18

    Edwards HA, Harrison JB, 1983. An osmoregulatory syncytium and associated cells in a freshwater mosquito. Tissue Cell 15 :271–280.

  • 19

    Afanasiev BN, Ward TW, Beaty BJ, Carlson JO, 1999. Transduction of Aedes aegypti mosquitoes with vectors derived from Aedes densovirus. Virology 257 :62–72.

    • Search Google Scholar
    • Export Citation
  • 20

    Allen-Muira TM, Afanasiev BN, Olson KE, Beaty BJ, Carlson JO, 1999. Packaging of AeDNV-GFP transducing virus by expression of densoviral structural proteins from a sinbis virus expression system. Virology 257 :54–61.

    • Search Google Scholar
    • Export Citation
  • 21

    Ward TW, Jenkins MS, Afanasiev BN, Edwards M, Duda BA, Suchman E, Jacobs-Lorena M, Beaty BJ, Carlson JO, 2001. Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae. Insect Mol Biol 10 :397–405.

    • Search Google Scholar
    • Export Citation
  • 22

    Roekring S, Flegel TW, Malasit P, Kittayapong P, 2006. Challenging successive mosquito generations with a densonucleosis virus yields progressive survival improvement but persistent, innocuous infections. Dev Comp Immunol 30 :878–892.

    • Search Google Scholar
    • Export Citation
  • 23

    Boublik Y, Jousset FX, Bergoin M, 1994. Complete nucleotide sequence and genomic organization of the Aedes albopictus parvovirus (AaPV) pathogenic for Aedes aegypti larvae. Virology 200 :752–763.

    • Search Google Scholar
    • Export Citation
  • 24

    O’Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76 :2067–2074.

    • Search Google Scholar
    • Export Citation
  • 25

    Chen S, Cheng L, Zhang Q, Lin W, Lu X, Brannan J, Zhou ZH, Zhang J, 2004. Genetic, biochemical, and structural characterization of a new densovirus isolated from chronically infected Aedes albopictus C6/36 cell lines. Virology 318 :123–133.

    • Search Google Scholar
    • Export Citation
  • 26

    Becker N, Zgomba M, Petri D, Beck M, Ludwig M, 1995. Role of larval cadavers in recycling processes of Bacillus sphaericus. J Am Mosq Contr Assoc 11 :329–334.

    • Search Google Scholar
    • Export Citation
  • 27

    Suchman EL, Kononko A, Plake E, Doehling M, Kleker B, Black WC 4th, Buchatsky L, Carlson JO, 2006. Effects of AeDNV infection on Aedes aegypti lifespan and reproduction. Biol Control 39 :465–473.

    • Search Google Scholar
    • Export Citation
  • 28

    Barreau C, Jousset FX, Bergoin M, 1997. Venereal and vertical transmission of the Aedes albopictus parvovirus in Aedes aegypti mosquitoes. Am J Trop Med Hyg 57 :126–131.

    • Search Google Scholar
    • Export Citation
 
 
 
 

 

 
 

 

 

 

 

 

 

Evaluation of Mosquito Densoviruses for Controlling Aedes aegypti (Diptera: Culicidae): Variation in Efficiency due to Virus Strain and Geographic Origin of Mosquitoes

View More View Less
  • 1 Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Nakhonpathom, Thailand; Department of Biology, Faculty of Science, Mahidol University, Bangkok, Thailand; Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado

Four mosquito densovirus strains were assayed for mortality and infectivity against Aedes aegypti larvae from different geographic regions. The viral titers were quantified by real-time PCR using TaqMan technology. Firstinstar larvae were exposed to the same titer of each densovirus strain for 48 hours. All strains of densoviruses exhibited larvicidal activity and caused more than 80% mortality and infectivity in the three mosquito strains. AalDNV-exposed larvae had the highest mortality rate. The mean time to death of AalDNV-exposed larvae was shorter than other DNVs-exposed larvae. We can conclude that different densovirus strains exhibit some variations in their pathogenicity to different populations of Ae. aegypti mosquitoes. A few mosquitoes from Chachoengsao and Bangkok exposed to AeDNV and AThDNV survived to the adult stage to lay eggs and showed 22% to 50% vertical transmission in the F1 generation. Phylogenetic analysis of four densovirus strains indicated that mosquito densoviruses are separated into two distinct clades.

INTRODUCTION

Aedes aegypti (L.) (Diptera: Culicidae) is the most important vector of dengue virus, the etiologic agent of dengue fever (DF), dengue-hemorrhagic fever (DHF), and yellow fever virus. Both DF and DHF remain serious diseases throughout the tropical parts of the world. In Thailand, 44,971 DF/DHF cases and 21 deaths were reported in 2005 (Annual Epidemiological Surveillance Report 2005). This disease cannot be eradicated by drug therapy, and vaccines for the dengue viruses are still being developed. Therefore, the only way to prevent epidemics of dengue fever is to control the mosquito vectors, especially Ae. aegypti. These mosquitoes have been controlled and eradicated by using chemical insecticides with some success for many years. However, the application of insecticides can cause problems due to high toxicity to the environment and human health, widespread toxicity to non-target insects, and insecticide resistance in mosquitoes.1 Larval control in Thailand depends mainly on temephos. Many other places use Bti and methoprene much more extensively. However, use of the same larvicide for a long time may cause resistance in mosquito larvae.2,3 Therefore, it is necessary that alternative strategies also be investigated. The mosquito densoviruses are environmentally friendly and a potential alternative to chemical larvicides.

Densonucleosis viruses or densoviruses (DNVs) are invertebrate viruses belonging to the subfamily Densovirinae within the family Parvoviridae.4 The virions of the DNV have a diameter of 18 to 22 nm and these non-enveloped, icosahedral viruses package a linear, single-stranded DNA of about 4 kb with terminal hairpins that are required for virus replication.5 Several mosquito densoviruses have been described and were used in this work. One of the best-characterized mosquito-specific densovirus is the Aedes densovirus (AeDNV), which was isolated from an Ae. aegypti mosquito colony.6 This densovirus was shown to infect mosquitoes of the genera Aedes, Culex, and Culiseta and was found to efficiently kill larvae of Ae. aegypti.7,8 A second densovirus, the Aedes albopictus densonucleosis virus (AalDNV), was recovered from a persistently infected subclone of a C6/36 Ae. albopictus cell line9; this virus proved to be highly pathogenic for Ae. aegypti following oral infection.911 A third virus, the Thai strain densovirus (AThDNV) was isolated from laboratory colonies of Ae. albopictus (Skuse) and Ae. aegypti from Thailand and was pathogenic to Ae. albopictus and Ae. aegypti in laboratory experiments.12 The fourth densovirus discovered was an Aedes Peruvian densovirus (APeDNV), which was recovered from persistently infected C6/36 cells from a laboratory in Peru.8,13

Although these densoviruses have been shown to be more or less pathogenic to various laboratory strains of Ae. aegypti, there has been no direct comparison of these viruses in different strains of Ae. aegypti. To rationally choose the appropriate strain of densovirus to use as the biological control agent against mosquito vectors, it is necessary to evaluate their pathogenicity against various strains of Ae. aegypti mosquitoes. The purpose of this study was to determine the potential of different densovirus strains as biological control agents of Ae. aegypti mosquitoes from different geographic origins.

MATERIALS AND METHODS

Mosquito strains.

Ae. aegypti were collected from Chachoengsao Province in the eastern part of Thailand and also from Bangkok, the capital city located in the central part of Thailand in January 2005. The Rexville-D strain of Ae. aegypti, originally from Puerto Rico, was obtained from the Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado, USA. This strain has been colonized since 1991. Every colony of mosquitoes was examined by conventional PCR to ensure that the experimental mosquitoes were densovirus-free, which is described in the following section. Mosquito larvae were reared in 2-liter water trays and were fed on ground Sakura® fish food powder. Adult mosquitoes were fed on a 10% sugar solution and females were fed on hamsters for the maturation of their eggs.

Densovirus strains and cell lines.

Four densovirus strains were used in this study and were cultured individually in C6/36 cells. The AThDNV strain was isolated from a laboratory colony of Ae. aegypti and Ae. albopictus from eastern Thailand.12 AalDNV was recovered from the Ae. albopictus (C6/36) cell line originally provided by Dr. Robert Tesh, Department of Pathology, University of Texas Medical Branch, Galveston, Texas, USA. Infectious clones of AeDNV and APeDNV have been described previously.8,14 The Ae. albopictus cell line (C6/36) was obtained from the Department of Virology, Institute for Tropical Medicine, Nagasaki, Japan. C6/36 cells were maintained in Minimum Essential Medium (GIBCO™) supplemented with 10% heat-inactivated Fetal Bovine Serum (FBS, Gibco BRL) and 1% of antibiotics (Penicillin-Streptomycin, Gibco BRL).

Virus production.

AeDNV and APeDNV were produced by transfecting infectious clones, pUCA and pUCP,8,14 into C6/36 cells in 6-well plates by using Cellfectin® Reagent (Invitrogen) according to the manufacturers protocol. The cells ’ were incubated for 5 days. DNV-infected cells were then harvested by using cell scrapers and centrifuged for 10 min at 3,750 rpm. The supernatants were kept as AeDNV and APeDNV virus stocks.8 AThDNV was prepared from dead Ae. aegypti larvae that had been exposed to AThDNV. Approximately 10 to 15 dead larvae were homogenized in 2 mL of MEM media by grinding with pestle. The suspension was filtered through a 0.22-μm syringe filter (Millex-GS); then 2 mL of filtered supernatant was inoculated into C6/36 cells. After the cells were incubated for 5 days, the AThDNV-infected cells were scraped and centrifuged for 10 min at 3,750 rpm. The supernatant was kept as the AThDNV virus stock. AalDNV was neither produced by transfection nor prepared from dead infected larvae because we already had the virus stock. The virus stocks of AeDNV, AThDNV, AalDNV, and APeDNV were increased for mosquito exposure by inoculating 2 mL of each virus stock into C6/36 cells, which were 70% confluent in 75 cm2 culture flasks (Costar, Corning). The inoculated cells were incubated at 28°C in 5% CO2 incubator for 2 hrs and gently shaken every 15 min. After incubation for 2 hrs, the DNV-inoculated cells were washed with PBS and 15 mL of new MEM containing 10% FBS were added. Then all inoculated cells were allowed to incubate for 8 days post-inoculation.10,11 After the post-incubation time, cells were scraped in supernatant and were kept as virus stock in −80°C.

DNA extraction and PCR detection of densoviruses.

DNA was isolated from field-collected mosquitoes by using an InstaGene Matrix extraction kit (BIORAD, Hercules, CA) according to the manufacturer’s protocol. DNA extraction from infected cells was started by addition of the extraction buffer solution (10 mM Tris-HCl, pH7.5, 100 mM NaCl, 0.2% SDS) modified as previously described.5 The mixtures were extracted by Phenol: Chloroform: Isoamyl alcohol (25:24:1) (USB, Cleveland, OH) and the nucleic acids were precipitated from the aqueous phase by ethanol. Samples were re-suspended in 30 μL of dd H2O. The oligonucleotide primers used for densovirus detection in both field-collected mosquitoes and infected cells are shown in Table 1. The 1334–1481 primer set amplifies a region of NS1 gene from all 4 denso-virus strains (AeDNV, AThDNV, AalDNV, and APeDNV). PCR amplification was performed in 20-μL reactions containing 13.8 μL of dH2O, 2 μL of 10× buffer (Fermentas), 1.5 μL of 25 mM MgCl2, 0.5 μL dNTPs (10 mM each), 0.5 μL of 1334F and 1481R primers (20 μM each), 1 U of Taq DNA polymerase (Fermentas), and 1 μL of DNA template. PCR was performed under condition optimized for 1334F–1481R primers: 35 cycles of denaturation at 94°C for 30 sec, annealing at 55°C for 30 sec, and extension at 72°C for 30 sec. After PCR reaction was completed, 10 μL of each PCR product was electrophoresed in 1.5% agarose gel strained with ethidium bromide and examined using UV transillumination.

Quantitative real-time PCR.

After the virus production step, the concentration of the mosquito densoviruses, AeDNV, AThDNV, AalDNV, and APeDNV were determined by real-time PCR using a Taqman probe. A set of primers and a probe were designed within a conserved region of the viral NS1 gene (Table 1) and pUCA/KpnI was used as a standard. A standard curve was first constructed by making serial 10-fold dilutions of pUCA of known concentration and used for quantitative estimation of DNVs of unknown concentrations. Each sample was done in triplicate. The primers and probe were optimized based on the protocol provided by ABI Prism® Model 7000 Sequence Detection System. The QuantiTect™ Probe PCR kit (QIAGEN GmbH) was used according to manufacturer’s instructions. Each reaction contained 0.5 μM of each primer and 0.1 μM of probe, and 4 μL of DNA solution along with buffer, MgCl2, dNTPs, Taq DNA polymerase in 50 μL of reaction volume. The real-time PCR thermocycler program are as follows: stage 1: 50°C 2 min, stage 2: 95°C 10 min, stage 3: 95°C 30 sec, 55°C 30 sec, 60°C 30 sec, 45 replications (stage 3).

Efficacies of densoviruses against

Ae. aegypti strains. Mosquito eggs were allowed to hatch in tap water. Approximately 3 to 4 hrs after hatching, 30 first-instar larvae in 2 mL of dechlorinated tap water in each tube were exposed with 1.4 × 1011 geq/mL of a densovirus strain in a total volume of 5 mL and held without food for 48 hrs. Controls that received no virus were also exposed with C6/36 cell culture medium. Four replicates and the controls were set up for each densovirus in each mosquito colony. After 48 hrs, mosquito larvae were transferred to a bowl containing 100 mL of tap water. Fish food was added and the larvae were monitored until pupation. After pupation, male and female pupae were individually transferred into new small cups and were allowed to emerge into mosquito cages. Dead larvae, pupae, and adults were recorded and collected daily and kept at −80°C until DNA was extracted. The experiment was ended at 30 days post-infection.

Adult survival and vertical transmission.

The AeDNV- and AThDNV-exposed females that survived were allowed to mate in a cage with AeDNV- and AThDNV-exposed males. Females of the parent generation (F0) were fed on a hamster and were individually isolated for egg laying. After oviposition, females were stored individually at −80°C until DNA was extracted. The paper containing eggs was kept moist for 3 days and afterwards kept dry. The F1 eggs from each densovirus-positive female were hatched and reared separately in autoclaved cups. Dead male and female mosquitoes were checked individually for densovirus infection by PCR using the 1334–1481 primer set same as the method for PCR detection of densoviruses in field-collected mosquitoes and infected cells.

Cladistic analysis.

Partial sequences of the VP gene of 4 densovirus strains (301 bp) were used in this experiment to compare with other reference strains. The sequence from Genbank for AeDNV (M37899), AThDNV (AY160976), AalDNV (X74945), APeDNV (AY310877), C6/36 DNV (AY095351), and HeDNV (AY605055) were aligned using clustal algorithm of the program MegAlign (DNAstar, Laser-gene). Phylogenetic relationships were inferred by using PAUP 4.0 b1.15 A parsimony tree was constructed by a heuristic search using General Search Options. Confidence values for individual branches of the resulting tree were determined by bootstrap analysis with 1,000 replicates.

Statistical analysis.

Survival curves were generated by using Kaplan-Meier method, and differences between survival curves were analyzed by the log rank test. The number of eggs laid by DNV-exposed mosquitoes were compared among different densovirus strains, mosquito strains by χ2 test, and differences were considered as significance when P ≤ 0.05. The lethal time for 50% mortality (LT50) of DNVs-exposed mosquitoes were determined by probit analysis. The LT50 values were compared among densovirus strains by one-way ANOVA followed by LSD post hoc test. SPSS computer software version 11.0 (SPSS Inc., Chicago, IL) was used for data analysis.

RESULTS AND DISCUSSION

Biological control of pests offers a number of advantages over other pest-control strategies, particularly pesticides. It is safe to the applicator and the environment, and it may require fewer applications than are necessary with chemical pesticides. The pathogenicity of densoviruses has been reported against Aedes, Culex, and other mosquitoes.7,8,11 It is of interest to study the pathogenicity of different densovirus strains in Ae. aegypti from different locations to see if there are differences in pathogenicity and susceptibility. Figures 1 to 3 show the cumulative proportion surviving over 30 days for each of the 3 mosquito strains when exposed as newly hatched larvae to 1.4 × 1011 geq/mL of densoviruses for 48 hrs. For the Rexville-D and Chachoengsao strains, the survival of mosquitoes exposed to AalDNV was significantly different from those exposed to AeDNV, AThDNV, and APeDNV (log rank P < 0.05). For the Bangkok strain, the survival of mosquitoes exposed to AalDNV was significantly different from AThDNV and APeDNV (log rank P < 0.05). The lethal times for 50% mortality (LT50) are shown in Table 2. The LT50 values of DNV-exposed mosquitoes ranged between 3.1 ± 0.6 and 10.0 ± 0.9 days. The LT50 of AalDNV-exposed mosquitoes (3.1–6.9 days) was lower than other DNV-exposed mosquitoes (6.9–10 days) in all 3 mosquito strains. Statistical analysis showed that the LT50 of AalDNV-exposed mosquitoes from Chachoengsao (4.2 ± 0.4 days) and Rexville-D (3.1 ± 0.6 days) were significantly lower than other DNV-exposed mosquitoes (F = 10.49, df = 3,12, P = 0.02; F = 19.68, df = 3,12, P = 0.007, respectively). These results indicate that AalDNV can cause mortality of Ae. aegypti mosquitoes faster than the other mosquito densovirus strains. The present study shows a high degree of larval mortality caused by densoviruses, especially the AalDNV strain, within 10 days after exposure in all mosquito strains. This result is consistent with previous studies in which AalDNV (AaPV) caused 90% mortality in Ae. aegypti larvae reared in water containing ground-infected larvae.11 Table 3 shows the developmental stage at which death occurred for the same mosquitoes. The dead mosquitoes were tested for the presence of densovirus by PCR (Table 3), and between 80% and 100% were positive. This suggests that most of the mortality is due to viral infection. The strains were all killed by the viruses with the majority of death occurring as larvae. AalDNV was the only virus that killed most larvae during the first and second instar stages in all 3 mosquito strains. Larger numbers of AeDNV and APeDNV-infected larvae survived to the third instar and many AThDNV-infected larvae survived until the fourth instar and pupal stages.

Transmission of occluded mosquito viruses (baculoviruses and cypoviruses) to mosquito larvae requires divalent cations Mg2+ and Ca2+ during the early phases of the infection process suggesting that the role of these ions is probably related to crossing the peritrophic matrix or attachment and entry into midgut epithelial cells.16 Mosquito anal papillae were found to be the initial site of densovirus infection,19,20 and are known to be involved in the control of ion balance between the mosquito hemolymph and its surrounding environment.17,18 Ward and others21 found that sodium chloride concentrations above 0.05 M inhibited viral infection. This result indicated that ion concentration in the larval habitat can be important for densovirus infection. The tap water used in this experiment contained low concentration of Mg2+ (< 0.00041 M), Ca2+ (< 0.0075 M), and Cl (< 0.000044 M) (data from the Metropolitan Waterworks Authority of Thailand). There are no reports of divalent cations (Mg2+ and Ca2+) affecting mosquito densovirus transmission, and the low concentrations of Mg2+, Ca2+, and Cl contained in our tap water confirm their lack of effect on transmission of densovirus to mosquito larvae.

In this experiment, the Rexville-D mosquito strain exhibited 95% larval mortality when exposed to 1.4 × 1011 geq/mL of AeDNV at 48 hrs exposure time (Figure 1), which was higher than the mortality (51.2%) of the same mosquito strain when exposed to the viral dose of 1 × 1011 geq/mL of AeDNV at 24 hrs exposure time.8 This result indicated that the mortality of Ae. aegypti mosquitoes may not only depend on the dose of densoviruses but also on the exposure time. The mortality of Rexville-D exposed to APeDNV is high (90%) at 1.4 × 1011 geq/mL and 48 hrs exposure time compared with the much lower mortality seen with this virus at 24 hrs exposure time.8 Although AThDNV caused the lowest mortality rate in larvae of the two Thai mosquito strains (Chachoengsao and Bangkok), a high mortality rate was found in AThDNV-exposed Rexville-D larvae. Some natural populations of Ae. aegypti in Thailand have been reported to be infected by AThDNV.12 Therefore, the low pathogenicity of AThDNV in Thai mosquito strains in this experiment might be explained by tolerance of the mosquito to the virus. Previous studies showed that serial challenge of 5 generations with a stock densovirus (AThDNV) resulted in an increase in progressive survival from 15% to 58%.22 Although the mosquitoes used in this study are densovirus-free, the infection of AThDNV in previous generation of natural populations might affect the susceptibility of this mosquito to the virus. These results merit further study to discover the appropriate dose and exposure time to control the mosquito vectors or other factors that are related to the efficiency of virus infection to cause mosquito mortality.

Phylogenetic analysis of AeDNV, AThDNV, AalDNV, and APeDNV was conducted using the partial sequences of the VP gene. The phylogenetic tree (Figure 4) showed that AalDNV23 was closely related to APeDNV and HeDNV24 with 100% bootstrap support, whereas AeDNV from Ae. aegypti in Kiev, Ukraine and AThDNV isolated from Ae. aegypti and Ae. albopictus in Thailand and another strain isolated from the C6/36 cell line,25 C6/36 DNV, form another clade. Members of the clade containing AalDNV, APeDNV, and HeDNV have origins in Europe or the Americas whereas members of another clade containing AeDNV, AThDNV, and C6/36 DNV have origins in Asia. Previous study has shown that the infection of Ae. aegypti mosquitoes with the two densovirus strains (APeDNV and HeDNV), which originated from insect cells, had significantly less mortality than the infection with AeDNV, which originated from mosquitoes. This could be the result of long-term adaptation to cell culture.8 However, the results of this experiment showed that AalDNV that originated from the C6/36 cell line gave higher mortality in exposed larvae than AThDNV and AeDNV that originated from mosquitoes. Therefore, the origin of densovirus might not be only one factor in determining their pathogenicity to Ae. aegypti mosquitoes. Many factors, such as temperature, larval density, developmental stage, exposure time, and mosquito strain, may also be involved in determining the mortality of mosquitoes.11

Bacillus sphaericus is expected to provide a greater residual larvicidal activity because of the longer persistence of the spore in the environment and its recycling potential in the gut of larvae after death.26 Similar to Bacillus sphaericus, mosquito densoviruses are non-enveloped and relatively stable in the environment. Moreover, mosquito larvae are infected by mosquito densovirus present in the water where female mosquitoes lay their eggs. Infected larvae excrete virus into the water increasing the viral titer8,11 allowing for increase its persistence.

Vertical transmission of AeDNV, AalDNV, and AThDNV in Ae. aegypti mosquitoes had previously been reported.11,12,27 AThDNV had the highest rates of vertical transmission in this mosquito species and it was persistent over several generations.12 Results of this experiment showed that a few females from the two mosquito strains (Chachoengsao and Bangkok) exposed to AeDNV and AThDNV survived to the adult stage and these mosquitoes were tested for vertical transmission to the next generation. The numbers of eggs hatched per female of DNV-exposed and healthy females are shown in Table 4. The densovirus infection rates of surviving adults in the F1 generation are 40% to 57.9% except the AeDNV-exposed mosquito from Bangkok, which was 21.9%. The vertical transmission of AThDNV in this experiment is consistent with previous studies in which surviving adults that emerged from AThDNV-exposed larvae in the F1 generation are nearly 50% infected.13 In the present study, we also report the effect of fecundity on the emerged adults that were exposed to AThDNV and AeDNV as first instar larvae (Table 4). The number of eggs laid by AThDNV-exposed mosquitoes from Bangkok was significantly lower than the control (P < 0.05). The number of eggs laid by AeDNV-exposed mosquito was also less than the control, which is consistent with previous studies.7,27 We could not report the fecundity of AalDNV and APeDNV-exposed mosquito because none of them survive until egg laying. However, a previous study showed no significant difference in the number of eggs laid between infected and uninfected mosquitoes developed from the third instar larvae of Ae. aegypti exposed to AalDNV (AaPV).28 Therefore, the variation of fecundity results may be explained by different experimental factors such as the virus strain, the virus concentration, the stage of larvae to be infected with the virus, and the mosquito strain. DNV-infected larvae will either become moribund and die or become infected pupae and adults.8,12 Infected adults may have a decreased lifespan and reduced fecundity as measured by the number of eggs laid and egg viability.27,28 The virus is transmitted vertically, and offspring from infected mothers may go on to be infected adults. The ability to be transmitted vertically should allow for virus spread to new oviposition sites by infected females. Our results clearly demonstrate vertical transmission of DNVs in Ae. aegypti because both AeDNV and AThDNV could transmit to the next generation. It is possible that vertical transmission might be one of the mechanisms for a long-term maintenance of densovirus infection in mosquitoes in nature.

Table 1

Oligonucleotide primers and a probe used for real-time PCR detection of 4 densovirus strains

Primers or probeGeneNucleotide sequences (5′-3′)
1. DNV1334-ForwardNS1CAGGAGGAAACAGCACAAGA
2. DNV1481-ReverseNS1GTTTCGATACCGTAACGGATGC
3. DNV1390-ProbeNS1FAM-AGCGCAGGAAGTGCAGAAGCGACTATCAC-TAMRA
Table 2

Lethal time for 50% mortality (LT50) of Aedes aegypti mosquitoes after the first-instar larvae were exposed to different densovirus strains

LT50 ± SE (days)
Mosquito strainAe DNVAThDNVAalDNVAPeDNV
Rexville-D7.3 ± 0.37.3 ± 0.53.1 ± 0.67.9 ± 1.1
Chachoengsao6.9 ± 0.68.2 ± 0.84.2 ± 0.47.1 ± 1.0
Bangkok7.1 ± 0.810.0 ± 0.96.9 ± 0.47.3 ± 0.7
Table 3

Percent infection of dead individuals as determined by PCR of each developmental stage of Aedes aegypti after newly hatched larvae were exposed for 48 hrs with different densovirus strains

StageAe DNV N+/T % infectedAThDNV N+/T % infectedAal DNV N+/T % infectedAPeDNV N+/T % infected
nd = not determined (when the number of sample is less than 10); RD = Rexville-D, CS = Chachoengsao, BK = Bangkok; N+/T = number positive/number tested.
RD
L1L246/5288.522/2491.772/7210044/4695.7
L340/4888.324/2692.334/3410032/3688.9
L412/1485.734/42816/6nd20/20100
Pupae0/018/20902/2nd2/4nd
Adult0/00/02/2nd0/0nd
CS
L1L242/5280.830/3488.272/7210036/3894.7
L326/2610030/3488.224/2410052/52100
L415/207520/2483.316/1610018/18100
Pupae4/6nd6/10602/2nd2/2nd
Adult2/2nd4/4nd0/02/2nd
BK
L1L240/4883.318/1810060/6010034/3694.4
L334/428134/3694.434/428148/48100
L416/1888.920/201004/8nd14/14100
Pupae2/4nd24/241004/4nd8/8nd
Adult2/4nd6/6nd2/2nd0/0
Table 4

Transmission of densoviruses to offspring in Aedes aegypti mosquitoes

Mosquito and DNV strainsNo. egg laid F1Survived larvae F1 (%)Survived adults F1 (%)Infection of survived F1 (%)
CS = Chachoengsao, BK = Bangkok.
CS-AeDNV125724445.5
CS-AeDNV2447540.955.6
CS-AeDNV34881.366.743.8
BK-AeDNV4381.474.421.9
CS-AThDNV12975.96945
CS-AThDNV22391.382.657.9
BK-AThDNV11258.341.740
BK-AThDNV21668.856.344.4
CS-Control14793.689.40
CS-Control25090840
CS-Control3439390.70
BK-Control14891.791.70
BK-Control25394.492.50
BK-Control35989.888.10
Figure 1.
Figure 1.

The cumulative proportion surviving of Aedes aegypti mosquitoes Rexville-D strain after the first-instar larvae were exposed to different densovirus strains.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 5; 10.4269/ajtmh.2008.78.784

Figure 2.
Figure 2.

The cumulative proportion surviving of Aedes aegypti mosquitoes from Chachoengsao Province after the first-instar larvae were exposed to different densovirus strains.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 5; 10.4269/ajtmh.2008.78.784

Figure 3.
Figure 3.

The cumulative proportion surviving of Aedes aegypti mosquitoes from Bangkok Province after the first-instar larvae were exposed to different densovirus strains.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 5; 10.4269/ajtmh.2008.78.784

Figure 4.
Figure 4.

Phylogenetic tree of densoviruses generated from heuristic search algorithm of PAUP 4.0b1 based on partial sequences of VP gene showing the relationship of AeDNV, AThDNV, AalDNV, and APeDNV with other densoviruses.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 5; 10.4269/ajtmh.2008.78.784

*

Address correspondence to Pattamaporn Kittayapong, Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, Nakhonpathom 73170, Thailand. E-mail: grpkt@mahidol.ac.th

Authors’ addresses: Supanee Hirunkanokpun and Pattamaporn Kittayapong, Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, Nakhonpathom 73170, Thailand, Tel: +66-2-201-5922, Fax: +66-2-201-5923, E-mail: grpkt@mahidol.ac.th. Jonathan O. Carlson, Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, CO 80523, Tel: 970-491-7840, Fax: 970-491-1815, E-mail: jonathan.carlson@colostate.edu

Acknowledgments: The authors thank Ronald E. Morales-Vargas, Rabuesak Khumthong, John R. Milne, and Timothy W. Flegel for their useful comments.

Financial support: This work was supported by the Grant R01-AI 47139 from the National Institutes of Health, USA (Subaward Number G-4549-1 from the Colorado State University), the Thailand Research Fund (RGJ/PHD/0026/2546 and RDG4530034), and the Mahidol University Research Grant (SCBI-47-T-217).

REFERENCES

  • 1

    Somboon P, Prapanthadara LA, Suwonkerd W, 2003. Insecticide susceptibility tests of Anopheles minimus S.L., Aedes aegypti, Aedes albopictus, Culex quinquefasciatus in northern Thailand. Southeast Asian J Trop Med Public Health 30 :184–194.

    • Search Google Scholar
    • Export Citation
  • 2

    Lima JBP, Da-Cunha MP, Júnior RCDS, Galardo AKR, Soares SDS, Braga IA, Ramos RP, Valle D, 2003. Resistance of Aedes aegypti to organophosphates in several municipalities in the state of Rio de Janeiro and Espírito Santo, Brazil. Am J Trop Med Hyg 68 :329–333.

    • Search Google Scholar
    • Export Citation
  • 3

    Ponlawat A, Scott JG, Harrington LC, 2005. Insecticide susceptibility of Aedes aegypti and Aedes albopictus across Thailand. J Med Entomol 42 :821–825.

    • Search Google Scholar
    • Export Citation
  • 4

    Bergoin M, Tijssen P, 2000. Molecular biology of densovirinae. Contrib Microbiol 4 :12–32.

  • 5

    Bando H, Choi H, Ito Y, Kawase S, 1990. Terminal structure of a densovirus implies a hairpin transfer replication which is similar to the model for AAV. Virology 179 :57–6.

    • Search Google Scholar
    • Export Citation
  • 6

    Lebedeva PO, Zelenko AP, Kuznetsova MA, Gudzgorban AP, 1972. Studies on the demonstration of a viral infection in larvae of Aedes aegypti mosquitoes. Microbiol JUS 34 :70–73.

    • Search Google Scholar
    • Export Citation
  • 7

    Buchatsky LP, 1989. Densonucleosis of bloodsucking mosquitoes. Dis Auq Org 6 :145–150.

  • 8

    Ledermann JP, Suchman EL, Black WC 4th, Carlson JO, 2004. Infection and pathogenicity of the mosquito densoviruses AeDNV, HeDNV, and APeDNV in Aedes aegypti mosquitoes (Diptera: Culicidae). J Econ Entomol 97 :1828–1835.

    • Search Google Scholar
    • Export Citation
  • 9

    Jousset FX, Barreau C, Boublik Y, Cornet M, 1993. A parvo-like virus persistently infecting a C6/36 clone of Aedes albopictus mosquito cell line and pathogenic for Aedes aegypti larvae. Virus Res 29 :99–114.

    • Search Google Scholar
    • Export Citation
  • 10

    Barreau C, Jousset FX, Cornet M, 1994. An efficient and easy method of infection of mosquito larvae from virus-contaminated cells cultures. J Virol Methods 49 :153–156.

    • Search Google Scholar
    • Export Citation
  • 11

    Barreau C, Jousset FX, Bergoin M, 1996. Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes. J Invertebr Pathol 68 :299–309.

    • Search Google Scholar
    • Export Citation
  • 12

    Kittayapong P, Baisley KJ, O’Neill SL, 1999. A mosquito denso-virus infecting Aedes aegypti and Aedes albopictus from Thailand. Am J Trop Med Hyg 61 :612–617.

    • Search Google Scholar
    • Export Citation
  • 13

    Paterson A, Robinson E, Suchman EL, Afanasiev BN, Carlson JO, 2005. Mosquito densonucleosis viruses cause dramatically different infection phenotypes in the C6/36 Aedes albopictus cell line. Virology 337 :253–261.

    • Search Google Scholar
    • Export Citation
  • 14

    Afanasiev BN, Kozlov YV, Carlson JO, Beaty BJ, 1994. Denso-virus of Aedes aegypti as an expression vector in mosquito cells. Exp Parasitol 79 :322–339.

    • Search Google Scholar
    • Export Citation
  • 15

    Swofford DL, 1999. PAUP: Phylogenetic analysis using parsimony, version 4.0 betal. Centre for Agriculture and Bioscience International, Champaign, IL.

  • 16

    Becnel JJ, 2006. Transmission of viruses to mosquito larvae mediated by divalent cations. J Invertebr Pathol 68 :141–145.

  • 17

    Wigglesworth VB, 1938. The regulation of osmotic pressure and chloride concentration in the hemolymph of mosquito larvae. J Exp Biol 15 :235–247.

    • Search Google Scholar
    • Export Citation
  • 18

    Edwards HA, Harrison JB, 1983. An osmoregulatory syncytium and associated cells in a freshwater mosquito. Tissue Cell 15 :271–280.

  • 19

    Afanasiev BN, Ward TW, Beaty BJ, Carlson JO, 1999. Transduction of Aedes aegypti mosquitoes with vectors derived from Aedes densovirus. Virology 257 :62–72.

    • Search Google Scholar
    • Export Citation
  • 20

    Allen-Muira TM, Afanasiev BN, Olson KE, Beaty BJ, Carlson JO, 1999. Packaging of AeDNV-GFP transducing virus by expression of densoviral structural proteins from a sinbis virus expression system. Virology 257 :54–61.

    • Search Google Scholar
    • Export Citation
  • 21

    Ward TW, Jenkins MS, Afanasiev BN, Edwards M, Duda BA, Suchman E, Jacobs-Lorena M, Beaty BJ, Carlson JO, 2001. Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae. Insect Mol Biol 10 :397–405.

    • Search Google Scholar
    • Export Citation
  • 22

    Roekring S, Flegel TW, Malasit P, Kittayapong P, 2006. Challenging successive mosquito generations with a densonucleosis virus yields progressive survival improvement but persistent, innocuous infections. Dev Comp Immunol 30 :878–892.

    • Search Google Scholar
    • Export Citation
  • 23

    Boublik Y, Jousset FX, Bergoin M, 1994. Complete nucleotide sequence and genomic organization of the Aedes albopictus parvovirus (AaPV) pathogenic for Aedes aegypti larvae. Virology 200 :752–763.

    • Search Google Scholar
    • Export Citation
  • 24

    O’Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76 :2067–2074.

    • Search Google Scholar
    • Export Citation
  • 25

    Chen S, Cheng L, Zhang Q, Lin W, Lu X, Brannan J, Zhou ZH, Zhang J, 2004. Genetic, biochemical, and structural characterization of a new densovirus isolated from chronically infected Aedes albopictus C6/36 cell lines. Virology 318 :123–133.

    • Search Google Scholar
    • Export Citation
  • 26

    Becker N, Zgomba M, Petri D, Beck M, Ludwig M, 1995. Role of larval cadavers in recycling processes of Bacillus sphaericus. J Am Mosq Contr Assoc 11 :329–334.

    • Search Google Scholar
    • Export Citation
  • 27

    Suchman EL, Kononko A, Plake E, Doehling M, Kleker B, Black WC 4th, Buchatsky L, Carlson JO, 2006. Effects of AeDNV infection on Aedes aegypti lifespan and reproduction. Biol Control 39 :465–473.

    • Search Google Scholar
    • Export Citation
  • 28

    Barreau C, Jousset FX, Bergoin M, 1997. Venereal and vertical transmission of the Aedes albopictus parvovirus in Aedes aegypti mosquitoes. Am J Trop Med Hyg 57 :126–131.

    • Search Google Scholar
    • Export Citation

Author Notes

Reprint requests: Pattamaporn Kittayapong, Center of Excellence for Vectors and Vector-Borne Diseases, Faculty of Science, Mahidol University at Salaya, Phutthamonthon 4 Road, Nakhonpathom 73170, Thailand, Tel: +662-201-5922, Fax: +662-201-5923, E-mail: grpkt@mahidol.ac.th
Save