• View in gallery

    Pictures of the different agarose gels of the PCR products. M, molecular marker (50-bp DNA ladder); PC, positive control (C. difficile from ATCC); NC, negative control (C. jejuni DNA). The numbers represent different samples negative or positive for the gene considered and do not refer to the same samples on different gels. A and B, PCR products of the tpi gene indicating the presence of C. difficile. C, PCR products of tcdA gene. D, tcdB gene PCR products. E, two samples (1 and 2) negative for binary toxin gene (cdtB), the positive and negative controls, and three positive samples (3, 4, and 5) positive for cdtB. F, control bands for cdtA (a) and cdtB (b) and other negative control organisms. G, tcdC gene PCR products from stool samples. H, positive control, negative control, and two samples positive for the tcdC genes. Sample 12 shows a shorter band, indicating the possibility of the deletion of the negative regulator gene shown in other studies to increase toxin production by the concerned strains.

  • 1

    Cleary RK, 1998. Clostridium difficile-associated diarrhea and colitis: clinical manifestations, diagnosis, and treatment. Dis Colon Rectum 41 :1435–1449.

    • Search Google Scholar
    • Export Citation
  • 2

    Wilcox MH, 1996. Cleaning up Clostridium difficile infection. Lancet 348 :767–768.

  • 3

    Surawicz CM, McFarland LV, 1999. Pseudomembranous colitis: causes and cures. Digestion 60 :91–100.

  • 4

    Karlström O, Fryklund B, Tullus K, Burman LG, 1998. A prospective nationwide study of Clostridium difficile-associated diarrhea in Sweden. The Swedish C. difficile Study Group. Clin Infect Dis 26 :141–145.

    • Search Google Scholar
    • Export Citation
  • 5

    Kuijper EJ, Coignard B, Tull P, the ESCMID Study Group for Clostridium difficile (ESGCD)*, EU Member States and the European Centre for Disease Prevention and Control (ECDC), 2006. Emergence of Clostridium difficile-associated disease in North America and Europe. Clin Microbiol Infect 6 :2–18.

    • Search Google Scholar
    • Export Citation
  • 6

    Reichardt C, Chaberny IF, Kola A, Mattner F, Vonberg RP, Gastmeier P, 2007. Dramatic increase of diarrhea associated with Clostridium difficile in Germany: has the new strain PCR-ribotype 027 reached us? Dtsch Med Wochenschr 132 :223–228.

    • Search Google Scholar
    • Export Citation
  • 7

    Lyerly DM, Lockwood DE, Richardson SH, Wilkins TD, 1982. Biological activities of toxins A and B of Clostridium difficile. Infect Immun 35 :1147–1150.

    • Search Google Scholar
    • Export Citation
  • 8

    Borriello SP, 1998. Pathogenesis of Clostridium difficile infection. J Antimicrob Chemother 41 :13–19.

  • 9

    Riegler M, Sedivy R, Pothoulakis C, Hamilton G, Zacherl J, Bischof G, Cosentini E, Feil W, Schiessel R, LaMont JT, Wenzl E, 1995. Clostridium difficile toxin B is more potent than toxin A in damaging human colonic epithelium in vitro. J Clin Invest 95 :2004–2011.

    • Search Google Scholar
    • Export Citation
  • 10

    Barbut F, Decre D, Lalande V, Burghoffer B, Noussair L, Gigandon A, Espinasse F, Raskine L, Robert J, Mangeol A, Branger C, Petit JC, 2005. Clinical features of Clostridium difficile-associated diarrhea due to binary toxin (actin-specific ADP-ribosyltransferase)-producing strains. J Med Microbiol 54 :181–185.

    • Search Google Scholar
    • Export Citation
  • 11

    Johnson S, Kent SA, O’Leary KJ, Merrigan MM, Sambol SP, Peterson LR, Gerding DN, 2001. Fatal pseudomembranous colitis associated with a variant Clostridium difficile strain not detected by toxin A immunoassay. Ann Intern Med 135 :434–438.

    • Search Google Scholar
    • Export Citation
  • 12

    Moncrief JS, Zheng L, Neville LM, Lyerly DM, 2000. Genetic characterization of toxin A-negative, toxin B-positive Clostridium difficile isolates by PCR. J Clin Microbiol 38 :3072–3075.

    • Search Google Scholar
    • Export Citation
  • 13

    Spigaglia P, Mastrantonio P, 2002. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 40 :3470–3475.

    • Search Google Scholar
    • Export Citation
  • 14

    Geric B, Carman RJ, Rupnik M, Genheimer CW, Sambol SP, Lyerly DM, Gerding DN, Johnson S, 2006. Binary toxin-producing, large clostridial toxin-negative Clostridium difficile strains are enterotoxic but do not cause disease in hamsters. J Infect Dis 193 :1143–1150.

    • Search Google Scholar
    • Export Citation
  • 15

    Poilane I, Karjalainen T, Barc MC, Bourlioux P, Collignon A, 1998. Protease activity of Clostridium difficile strains. Can J Microbiol 44 :157–161.

    • Search Google Scholar
    • Export Citation
  • 16

    Eveillard M, Fourel V, Barc MC, Kerneis S, Coconnier MH, Karjalainen T, Bourlioux P, Servin AL, 1993. Identification and characterization of adhesive factors of Clostridium difficile involved in adhesion to human colonic enterocyte-like Caco-2 and mucus-secreting HT 29 cells in culture. Mol Microbiol 7 :371–381.

    • Search Google Scholar
    • Export Citation
  • 17

    Karjalainen T, Barc MC, Collignon A, Trolle S, Boureau H, Cotte-Laffitte J, Bourlioux P, 1994. Cloning of a genetic determinant from Clostridium difficile involved in adherence to tissue culture cells and mucus. Infect Immun 62 :4347–4355.

    • Search Google Scholar
    • Export Citation
  • 18

    Bartlett JG, 2006. Narrative review: the new epidemic of Clostridium difficile-associated enteric disease. Ann Intern Med 145 :758–764.

  • 19

    Johal SS, Hammond J, Solomon K, James PD, Mahida YR, 2004. Clostridium difficile associated diarrhea in hospitalised patients: onset in the community and hospital and role of flexible sigmoidoscopy. Gut 53 :673–677.

    • Search Google Scholar
    • Export Citation
  • 20

    Rupnik M, Avesani V, Janc M, von Eichel-Streiber C, Delmee M, 1998. A novel toxinotyping scheme and correlation of toxino-types with serogroups of Clostridium difficile isolates. J Clin Microbiol 36 :2240–2247.

    • Search Google Scholar
    • Export Citation
  • 21

    Rahmati A, Gal M, Northey G, Brazier JS, 2005. Subtyping of Clostridium difficile polymerase chain reaction (PCR) ribotype 001 by repetitive extragenic palindromic PCR genomic fingerprinting. J Hosp Infect 60 :56–60.

    • Search Google Scholar
    • Export Citation
  • 22

    Silletti RP, Lee G, Ailey E, 1996. Role of stool screening tests in diagnosis of inflammatory bacterial enteritis and in selection of specimens likely to yield invasive enteric pathogens. J Clin Microbiol 34 :1161–1165.

    • Search Google Scholar
    • Export Citation
  • 23

    Ruiz-Pelaez JG, Mattar S, 1999. Accuracy of fecal lactoferrin and other stool tests for diagnosis of invasive diarrhea at a Colombian pediatric hospital. Pediatr Infect Dis J 18 :342–346.

    • Search Google Scholar
    • Export Citation
  • 24

    Vaishnavi C, Thapa BR, Thennarasu K, Singh K, 2002. Faecal lactoferrin assay as an adjunct to Clostridium difficile diarrhea. Indian J Pathol Microbiol 45 :69–73.

    • Search Google Scholar
    • Export Citation
  • 25

    Samie A, Obi CL, Barrett LJ, Powell SM, Guerrant RL, 2006. Prevalence of Campylobacter species, Helicobacter pylori and Arcobacter species in stool samples from the Venda region, Limpopo, South Africa: studies using molecular diagnostic methods. J Infect 54 :558–566.

    • Search Google Scholar
    • Export Citation
  • 26

    Lemee L, Dhalluin A, Testelin S, Mattrat MA, Maillard K, Lemeland JF, Pons JL, 2004. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J Clin Microbiol 42 :5710–5714.

    • Search Google Scholar
    • Export Citation
  • 27

    Terhes G, Urbán E, Sóki J, Hamid KA, Nagy E, 2004. Community-acquired Clostridium difficile caused by binary toxin, toxin A, toxin B gene-positive isolates in Hungary. J Clin Microbiol 42 :4316–4318.

    • Search Google Scholar
    • Export Citation
  • 28

    Cohen SH, Tang YJ, Silva J Jr, 2000. Analysis of the pathogenicity locus in Clostridium difficile strains. J Infect Dis 181 :659–663.

  • 29

    Stubbs S, Rupnik M, Gibert M, Brazier J, Duerden B, Popoff M, 2000. Production of actin-specific ADP-ribosyltransferase (binary toxin) by strains of Clostridium difficile. FEMS Microbiol Lett 186 :307–312.

    • Search Google Scholar
    • Export Citation
  • 30

    Nataro JP, Mai V, Johnson J, Blackwelder WC, Heimer R, Tirrell S, Edberg SC, Braden CR, Glenn Morris J Jr, Hirshon JM, 2006. Diarrheagenic Escherichia coli infection in Baltimore, Maryland, and New Haven, Connecticut. Clin Infect Dis 43 :402–407.

    • Search Google Scholar
    • Export Citation
  • 31

    Kyne L, Merry C, O’Connell B, Keane C, O’Neill D, 1998. Community-acquired Clostridium difficile infection. J Infect 36 :287–288.

  • 32

    Johal SS, Hammond J, Solomon K, James PD, Mahida YR, 2004. Clostridium difficile associated diarrhoea in hospitalised patients: onset in the community and hospital and role of flexible sigmoidoscopy. Gut 53 :673–677.

    • Search Google Scholar
    • Export Citation
  • 33

    Raveh D, Rabinowitz B, Breuer GS, Rudensky B, Yinnon AM, 2006. Risk factors for Clostridium difficile toxin-positive nosocomial diarrhea. Int J Antimicrob Agents 28 :231–237.

    • Search Google Scholar
    • Export Citation
  • 34

    Pulvirenti JJ, Mehra T, Hafiz I, DeMarais P, Marsh D, Kocka F, Meyer PM, Fischer SA, Goodman L, Gerding DN, Weinstein RA, 2002. Epidemiology and outcome of Clostridium difficile infection and diarrhea in HIV infected inpatients. Diagn Microbiol Infect Dis 44 :325–330.

    • Search Google Scholar
    • Export Citation
  • 35

    Hutin Y, Molina JM, Casin I, Daix V, Sednaoui P, Welker Y, Lagrange P, Decazes JM, Modai J, 1993. Risk factors for Clostridium difficile-associated diarrhea in HIV-infected patients. AIDS 7 :1441–1447.

    • Search Google Scholar
    • Export Citation
  • 36

    Colarian J, 1988. Clostridium difficile colitis following antiviral therapy in the acquired immunodeficiency syndrome. Am J Med 84 :1081.

  • 37

    McDonald LC, Coignard B, Dubberke E, Song X, Horan T, Kutty PK, Ad Hoc Clostridium difficile Surveillance Working Group, 2007. Recommendations for surveillance of Clostridium difficile-associated disease. Infect Control Hosp Epidemiol 28 :140–145.

    • Search Google Scholar
    • Export Citation
  • 38

    Taha S, Johansson O, Rivera Jonsson S, Heimer D, Krovacek K, 2007. Toxin production by and adhesive properties of Clostridium difficile isolated from humans and horses with antibiotic-associated diarrhea. Comp Immunol Microbiol Infect Dis 30 :163–174.

    • Search Google Scholar
    • Export Citation
  • 39

    Songer JG, Anderson MA, 2006. Clostridium difficile: an important pathogen of food animals. Anaerobe 12 :1–4.

  • 40

    Arroyo LG, Staempfli H, Weese JS, 2007. Molecular analysis of Clostridium difficile isolates recovered from horses with diarrhea. Vet Microbiol 120 :179–183.

    • Search Google Scholar
    • Export Citation
  • 41

    Rodriguez-Palacios A, Stampfli HR, Duffield T, Peregrine AS, Trotz-Williams LA, Arroyo LG, Brazier JS, Weese JS, 2006. Clostridium difficile PCR ribotypes in calves, Canada. Emerg Infect Dis 12 :1730–1736.

    • Search Google Scholar
    • Export Citation
  • 42

    Simango C, 2006. Prevalence of Clostridium difficile in the environment in a rural community in Zimbabwe. Trans R Soc Trop Med Hyg 100 :1146–1150.

    • Search Google Scholar
    • Export Citation
  • 43

    Wultanska D, Pituch H, Obuch-Woszczatynski P, Meisel-Mikolajczyk F, Luczak M, 2005. Profile of toxigenicity of Clostridium difficile strains isolated from paediatric patients with clinical diagnosis of antibiotic associated diarrhea (AAD). Med Dosw Mikrobiol 57 :377–382.

    • Search Google Scholar
    • Export Citation
  • 44

    Pituch H, Obuch-Woszczatynski P, Luczak M, Meisel-Mikolajczyk F, 2003. Clostridium difficile and enterotoxigenic Bacteroides fragilis strains isolated from patients with antibiotic associated diarrhea. Anaerobe 9 :161–163.

    • Search Google Scholar
    • Export Citation
  • 45

    Price MF, Dao-Tran T, Garey KW, Graham G, Gentry LO, Dhungana L, DuPont HL, 2007. Epidemiology and incidence of Clostridium difficile-associated diarrhea diagnosed upon admission to a university hospital. J Hosp Infect 65 :42–46.

    • Search Google Scholar
    • Export Citation
  • 46

    Kazakova SV, Ware K, Baughman B, Bilukha O, Paradis A, Sears S, Thompson A, Jensen B, Wiggs L, Bessette J, Martin J, Clukey J, Gensheimer K, Killgore G, McDonald LC, 2006. A hospital outbreak of diarrhea due to an emerging epidemic strain of Clostridium difficile. Arch Intern Med 166 :2518–2524.

    • Search Google Scholar
    • Export Citation
  • 47

    Curry SR, Marsh JW, Muto CA, O’Leary MM, Pasculle AW, Harrison LH, 2007. tcdC genotypes associated with severe TcdC truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 45 :215–221.

    • Search Google Scholar
    • Export Citation
  • 48

    Rexach CE, Tang-Feldman YJ, Cantrell MC, Cohen SH, 2006. Epidemiologic surveillance of Clostridium difficile diarrhea in a freestanding pediatric hospital and a pediatric hospital at a university medical center. Diagn Microbiol Infect Dis 56 :109–114.

    • Search Google Scholar
    • Export Citation

 

 

 

 

PCR Detection of Clostridium difficile Triose Phosphate Isomerase (tpi), Toxin A (tcdA), Toxin B (tcdB), Binary Toxin (cdtA, cdtB), and tcdC Genes in Vhembe District, South Africa

View More View Less
  • 1 AIDS Virus Research Laboratory and Laboratory for Molecular Microbiology, Department of Microbiology, University of Venda, Thohoyandou, South Africa; College of Agriculture and Environmental Sciences, School of Agriculture and Life Sciences, University of South Africa, Pretoria, South Africa; Centre for Global Health, Division of Infectious Diseases and International Health University of Virginia, Charlottesville, Virginia

Specific polymerase chain reaction (PCR) protocols were used to determine the prevalence of toxigenic Clostridium difficile in Vhembe, South Africa. Of 322 stool samples collected, toxigenic C. difficile was found in 23 (7.1%) cases and was significantly associated with diarrhea 20 (11.4%) compared with 3 (2%) in non-diarrheal samples (χ2 = 426, P = 0.001), intestinal inflammation in 18 (12.1%) compared with 5 (2.9%) in lactoferrin-negative samples (χ2 = 10.194, P = 0.001), and occult blood in 19 (16%) compared with 4 (2%) in occult blood–negative samples (χ2 = 22.157, P < 0.001). Toxigenic C. difficile was more common among individuals > 50 years of age (20%), followed by those between 30 and 39 years of age (19%) and was not associated with HIV infections (χ2 = 0.289, P = 0.591). Co-infection with other pathogens was common. Multivariate analysis indicated that toxigenic C. difficile was associated with E. bieneusi (P = 0.028), C. parvum (P = 0.007), and Enteroaggregative Escherichia coli (EAEC) (P = 0.007) in diarrheal samples. This study confirms the usefulness of PCR methodologies in the detection of toxigenic C. difficile and suggests that C. difficile is responsible for a small, but underappreciated, proportion of diarrheal cases in the region, and further study is warranted in this area.

INTRODUCTION

Clostridium difficile is a spore-forming, anaerobic gram-positive bacillus that produces exotoxins and is pathogenic to humans. Infection can lead to asymptomatic carriage or clinical disease, ranging from mild diarrhea to life-threatening pseudomembranous colitis.1 C. difficile–associated disease (CDAD) is an important clinical problem that is believed to occur predominantly after hospitalization and administration of broad spectrum antibiotics, and it especially affects the elderly.2 Community-acquired disease has been reported, but the incidence is felt to be low, and the rate of disease resulting in hospitalization is reported as negligible.3 For example, a Swedish study of 5,133 cases of C. difficile diarrhea indicated a prevalence of 16 per 100,000 inhabitants per year as being community acquired.4 Recent events in the United States, Canada, and Europe have indicated the changing epidemiology of CDAD, with the occurrence of serious CDAD in otherwise healthy patients with minimal or no exposure to a health care setting.5,6 However, the occurrence of C. difficile in the Vhembe district, South Africa, a developing country, has not been reported.

Several factors that contribute to the virulence of C. difficile have been described. However, the pathogenicity is mainly caused by two large protein toxins, toxin A and toxin B, and a more recently described binary toxin.7,8 Toxin A is a potent enterotoxin that causes fluid accumulation in the gut, is cytotoxic to tissue culture cells, and is lethal for experimental animals.9 Toxin B is 1,000-fold more potent as a cytotoxin than toxin A but is not an enterotoxin in original animal studies, although more recent studies have indicated that strains that produce toxin B but not toxin A can cause severe diarrhea in humans.9,10 Strains of toxin A–negative, toxin B–positive C. difficile have recently been associated with human diseases and described in epidemics around the world and might be more common than previously thought.11,12

Binary toxin (CDT) is related to the clostridial binary toxins, including the iota toxin produced by Clostridium perfringens type E, the toxin produced by Clostridium spiroforme, and the C2 toxin from Clostridium botulinum types C and D. C. difficile has a 16-kb pathogenicity locus (PaLoc) with genes encoding enterotoxin A (tcdA) and cytotoxin B (tcdB), where toxin production is negatively controlled by TcdC.13 Genes for the binary toxin are located outside the PaLoc, but the significance of CDT in intestinal disorders has not yet been fully elucidated.14 Other potential virulence factors that may be involved in colonization by C. difficile are the presence of capsule and flagella and production of tissue degradative exoenzymes such as collagenase and hyaluronidase.15 Moreover, like many other bacteria, C. difficile may possess fimbriae that are potential mediators of attachment to intestinal mucosa.10 Additionally, in in vivo experiments, its virulence has been positively correlated to intestinal mucosal attachment, and there is in vitro evidence of adhesion of C. difficile strains to various cultured cell lines, including Vero cells, HT29-MTX, and human Caco-2 cells.16,17 These toxins are thus generally used for the pathogenic characterization of infecting C. difficile isolates.

CDAD is usually diagnosed after a stool test for C. difficile cytotoxin or for the presence of toxigenic C. difficile in a cultured stool sample.18 Endoscopic examination of the colon can show characteristic yellowish pseudomembranes, often with intervening normal looking mucosa. Molecular methods have been described and successfully used for the detection and characterization of C. difficile. These have included methods such as toxinotyping based on variations in the PaLoc sequence, pulsed-field gel electrophoresis (PFGE), polymerase chain reaction (PCR) ribotyping, and restriction endonuclease analysis (REA).1921 Intestinal inflammation has been reported in cases of CDAD, and the lactoferrin test and occult blood tests have been used for the diagnosis of inflammatory diarrhea including C. difficile infection.3,2224 In this study, we determined the prevalence of C. difficile in the Vhembe district population and the profile of toxigenicity of the strains present in the stools by detecting the tcdA (toxin A), tcdB (toxin B), and cdtA and cdtB (binary toxin: CDT) genes using specific PCR protocols in association with diarrhea, lactoferrin, and occult blood. The putative negative regulator for toxins A and B (tcdC) was also studied.

MATERIALS AND METHODS

Ethical issues.

The research protocol was approved by the Research Ethics Committee of the University of Venda, South Africa. Authorizations to collect samples from primary schools and public health institutions were obtained from the Departments of Health and Education, Limpopo Province, before the beginning of the study. The molecular analysis was conducted according to the University of Virginia ethics guidelines on non-identified samples. Informed consent was obtained from all participants either directly or through their legal and competent guardians.

Study site and sample collection.

Stool samples were randomly collected from consenting outpatients attending three major hospitals (Tshilidzini, Elim, and Donald Frazer) serving local populations and two primary schools of the Vhembe district between November 2004 and May 2005 and preserved at −80°C until further needed. From the hospitals, all the samples were collected from the consenting patients within 24 hours of their arrival at the hospitals. At the schools, stool samples were randomly collected from children whose parents or guardians have consented to the study. A total of 322 samples were collected, of which 255 were from the hospitals and 67 were from the schools.

Genomic DNA purification.

Genomic DNA was extracted from the stool samples and control cultures using the QIAamp DNA Stool Mini kit (Qiagen, Hilden, Germany) following the instructions of the manufacturer after an initial treatment with potassium hydroxide as previously described.25

PCR assays.

All the PCR reactions were run with a positive and a negative control using the conditions previously described by the different authors (Table 1), with the exception that the PCR master mix was used instead of mixing the different reagents at the time of reaction. The final volume was 25 μL for all the reactions with 12.5 μL of the PCR master mix, 5.5 μL of nuclease free water, 1 μL of a stock of 4 μmol/L solution of each primer of the primer pair specific for each reaction, and 5 μL of the genomic DNA extract. A PCR protocol targeting a species-specific internal fragment of the triose phosphate isomerase (tpi) housekeeping gene was used as described.26 The toxin A gene (tcdA) and toxin B gene (tcdB) were tested using previously described protocols.27,28 The presence of the binary toxin was ascertained by two different reactions using two different primer pairs for the enzymatic and the binding components of the cdt gene using the conditions previously described.29 The negative regulator gene was detected using two different primer pairs.13 The first primer pair (C1 and C2) detects a fragment of the tcdC gene, whereas the second primer pair (Tim1 and Struppi2) amplifies an internal fragment of the first PCR product. The PCR products were observed in 2% agarose gel except for the product of the second PCR for the tcdc gene that was run in 3% agarose gel. This helped to observe any size difference that could exist in the amplification products. These samples were previously tested for other organisms including Entamoeba histolytica, Cryptosporidium, microsporidia, Campylobacter, and Enteroaggregative Escherichia coli.

Lactoferrin detection.

Stool supernatants were tested for the presence of lactoferrin using the LEUKO-TEST according to the manufacturer’s specifications including appropriate kit controls (TechLab, Blacksburg, VA). The level of lactoferrin in the stool samples was quantified using the IBD check and the IBD scan kits from Techlab following the instructions of the manufacturer.

Test for occult blood.

The presence of occult blood in the stool samples was tested by the hemoccult test kit (Beckman Coulter, Fullerton, CA) following the instructions of the manufacturer.

Statistical analysis.

The results of the study were analyzed using the SPSS software Version 10.1 (SPSS, Chicago, IL). The χ2 test was used to compare the proportions of patients who provided the stool samples based on parameters such as diarrheal symptoms, sex, age, origin, lactoferrin, or occult blood tests results. Multivariate logistic regression was used to analyze the impact of co-infection with other organisms on infection with toxigenic C. difficile. The differences were considered significant when P < 0.05.

RESULTS

Demographic information on the study population.

A total of 322 individuals consented to the study, and the same number of stool samples were collected and analyzed. Of these, 255 were from the hospitals. This number represents ~0.6% of the total population who visited the hospitals during the study period. Sixty-seven samples were from primary schools. The age of the patients from the hospitals varied between 1 month and 88 years, whereas the age of the school children varied between 3 and 15 years. There were more females (56.5%) than males (43.5%). Forty-four patients (17.2%) attending the hospitals were HIV positive. The HIV status of the primary school children was not known. Table 1 presents the demographic characteristics of the study population including the frequency of diarrhea and C. difficile infections in each age group. Diarrhea was more common among HIV-positive patients (86.4%) than in HIV-negative individuals (49.6%). Inflammation and the occurrence of occult blood in stool was more frequent among HIV-positive individuals (70.5% and 43.2%, respectively) than those uninfected by the virus (42.4% and 36%, respectively), further indicating the low general health conditions of HIV-positive patients.

Prevalence of C. difficile and toxin genes in the study population.

The different PCR protocols used yielded the expected products indicated by the appearance of clear bands after agarose gel electrophoresis as indicated in Figure 1. A sample was considered positive for each experiment if the band obtained was of the right size indicated in Table 1, whereas the appearance of a band at any other position was not considered positive. Toxigenic C. difficile was defined as a case of infection with C. difficile as indicated by a positive PCR result for the tpi gene with a positive test for any one or more of the three toxin genes studied. From a total of 322 stool samples, 45 were positive for the triose phosphate isomerase (tpi) gene, indicating that these individuals harbored C. difficile in their intestines. Only 2 (3%) samples were positive for the tpi gene from the schools, and both samples were negative by the toxin probes, whereas 43 (16.9%) samples were positive from the hospitals. Of the 45 samples positive for tpi, 22 (48.9%) were toxin negative, and 23 (51.1%) had at least one of the three toxin genes tested. Globally, the toxin A gene was found in 18 (40%) samples, the toxin B gene was found in 21 (46.7%) samples, and the binary toxin genes (cdtA and cdtB) were found in 12 (26.7%) of all the samples positive for C. difficile. Toxin A–positive, toxin B–positive (A+B+CDT−) strains were found in nine samples, whereas the toxin A–negative, toxin B–positive (A−B+CDT−) variant was found in two samples. Strains with all the three toxins, Toxin A positive, toxin B positive, and binary toxin positive (A+B+CDT+) strains, were found in nine (20%) samples. Binary toxin only (A−B−CDT+) was found in three samples. The tcdC gene was found in all of the 21 (46.7%) samples with toxin A or B genes. However, lower bands could be observed for two samples, indicating a possible mutation as previously described in this gene. Table 2 describes the distribution of C. difficile and the different genes in the study population. C. difficile infections did not seem to be associated with the sex of the individuals in the study population. C. difficile (tpi gene) was more common among individuals between 20 and 39 years of age (28.6%), followed by individuals > 50 years of age. However, toxigenic C. difficile was more common among individuals > 50 years of age (20%), followed by those between 30 and 39 years of age (19%; Table 2). When the whole patient population attending the hospitals was considered, the rate of toxigenic C. difficile in the population was estimated at 54 cases per 100,000 hospital visits. However, when multiple infections were removed from the analysis, this rate was reduced to 7 cases per 100,000 hospital visits.

C. difficile infections and HIV status.

The effect of HIV infections on the development of C. difficile infection was also monitored. The prevalence of infection for tpi (C. difficile housekeeping gene) was generally higher in HIV-negative individuals (14.4%) than HIV-positive individuals (11.4%), but the difference was not significant (χ2 = 0.289, P = 0.591). However, all the toxigenic C. difficile in HIV-positive patients were found in diarrheal samples with elevated lactoferrin and occult blood, whereas the non-toxigenic strains were found in stool samples negative for the lactoferrin test and for occult blood.

Pathogenic characteristics of C. difficile infections.

Three criteria were used to characterize the pathogenicity of the C. difficile strains found in the stool samples including diarrhea, intestinal inflammation as indicated by the elevated lactoferrin level, and the presence of occult blood in the stools. The pathogenicity index (PI), introduced in 2006 by Nataro and others,30 is the ratio of the prevalence of each condition in diarrheal, lactoferrin-positive, or occult blood–positive sample by the prevalence in non-diarrheal, lactoferrin-negative, or occult blood–negative samples.

Of the 322 samples, 176 (54.6%) were diarrheal, whereas 146 (45.4%) were non-diarrheal. Of the 176 diarrheal samples, 34 (19.3%) were positive for C. difficile compared with 11 (7.5%) in non-diarrheal samples (χ2 = 8.956; P = 0.003). Toxigenic C. difficile was found in 20 (11.4%) of the diarrheal samples compared with 3 (2.1%) in non-diarrheal samples (χ2 = 10.239; P = 0.001). The presence of one or more of the toxin genes tested was significantly associated with diarrhea. Thirty-four (75.5%, P = 0.002) of all C. difficile cases (by tpi) were diarrheal, with a PI of 2.6, which was lower compared with when the toxigenic cases were considered. For example, 15 (83.3%, P = 0.012) of all toxin A gene–positive samples were diarrheal with a PI of 4; 18 (85.7%, P = 0.003) of all toxin B gene–positive samples were diarrheal with a PI of 4.8; and 10 (83.3%, P = 0.042) of all binary toxin gene positive samples were diarrheal with a PI of 4. Binary toxin only genes were found in three (100%) diarrheal samples and none were found in non-diarrheal samples. The presence of any of the toxins genes was associated with a higher PI (5.4) than non-toxigenic strains (1.4; P = 0.001). This is related to the fact that these toxigenic C. difficile strains were found more often in diarrheal samples (20; 87%) than in non-diarrheal samples (3; 13%; Table 3).

Of the 322 samples, 149 (46.3%) had elevated lactoferrin, whereas 173 (53.7%) were negative for lactoferrin. Of those positive for lactoferrin, 28 (18.8%) were positive for C. difficile (tpi gene) compared with 17 (9.8%) in the samples negative for lactoferrin (χ2 = 5.352; P = 0.021). Toxigenic C. difficile was found in 18 (12.1%) of the samples with elevated lactoferrin compared with 5 (2.9%) in the samples that were negative for lactoferrin (χ2 = 10.194; P = 0.001). Of the 176 diarrheal samples, 139 (79%) had elevated lactoferrin compared with 9 (6.2%) in non-diarrheal samples. Of those with elevated lactoferrin, toxigenic C. difficile was found in 18 (13%) samples compared with 2 (5.4%) in those negative for lactoferrin [odds ratio (OR) = 2.582; 95% confidence interval (CI) = 0.571–11.670]. Intestinal inflammation indicated by the elevated level of lactoferrin in the stool samples was thus significantly associated with toxigenic C. difficile infections (Table 4). The presence of the toxin B gene was associated with a higher PI (5) than the toxin A gene (4) and the binary toxin genes (3.5). Fourteen (77.7%) of all the samples positive for the toxin A gene were inflammatory, with a PI of 4 (P = 0.021); 17 (81%) of all samples positive for the toxin B gene were inflammatory, with a PI of 5 (P = 0.006); and 9 (75%) of all the samples positive for the binary toxin were inflammatory, with a PI of 3.5 (P = 0.042).

We also studied the possible effect of the presence of C. difficile toxin genes on the presence of occult blood in the stool samples. Of the 322 samples tested, 119 (37%) were positive for occult blood. Of these 119 positive for occult blood, C. difficile (tpi) was found in 29 (24.4%) compared with 16 (7.9%) in occult blood negative samples (χ2 = 16.965; P < 0.001). Toxigenic C. difficile was found in 19 (16%) of the occult blood positive samples compared with 4 (2%) in occult blood negative samples. Of the 176 diarrheal samples, 84 (47.7%) were positive for lactoferrin. Of these 17 (20.2%) were positive for toxigenic C. difficile compared with 3 (3.2%) in occult blood negative samples. Of all the 18 samples positive for the toxin A gene, 15 (83.3%) were positive for occult blood, with a PI of 8.4 (P < 0.001); 17 (81%) of the 21 samples positive for the toxin B gene were positive for occult blood, with a PI of 7.2 (P < 0.001). Of the 12 samples positive for the binary toxin gene, 11 (92%) were positive for occult blood, with a PI of 18.4 (P < 0.001; Table 5).

Globally, the presence of the binary toxin gene was more associated with occult blood (χ2 = 16.013, P < 0.001), with a PI of 18.4, whereas the presence of toxin A or B genes was more associated with intestinal inflammation (χ2 = 10.867, P = 0.001) and diarrhea (χ2 = 8.743, P = 0.003). All three pathogenic features studied were associated with the presence of the toxin’s genes as opposed to non-toxigenic strains of C. difficile, with PIs of 5.4 versus 1.4 for diarrhea, 4.2 versus 1 for lactoferrin, and 8 versus 1.4 for occult blood for toxigenic and non-toxigenic strains, respectively. Multivariate analysis on age and CDAD including lactoferrin, the occult blood test, and other etiologies indicated that occult blood was associated with CDAD independent of age and other etiologies (OR = 16.154; 95% CI = 2.036–128.184; P = 0.001). However, high levels of lactoferrin were more associated with individuals > 20 years of age, even when all the other factors were excluded from the analysis (OR = 4.667; 95% CI = 0.992–21.946; P = 0.041).

C. difficile and multiple infections.

The samples used in this study were previously tested for the presence of other intestinal pathogens including Cryptosporidium, E. histolytica, Enterocytozoon bieneusi, Campylobacter, Arcobacter, and enteroaggregative E. coli. Of the 45 cases of C. difficile infections, C. difficile (tpi gene) was found alone only in 10 samples, whereas in 14 samples it was found together with at least one other organism, in 9 samples with at least two other organisms, in 4 samples with at least three other organisms, in 6 samples with at least four other organisms, in 1 sample with at least five other organisms, and in 1 sample with at least six other organisms. Of the 10 cases of infections with only C. difficile, 3 were toxigenic, and all 3 samples were diarrheal with a high level of intestinal inflammation and positive for occult blood. All three cases occurred in individuals > 20 years of age [one (2.3%) occurred in an individual between 20 and 29 years of age, one (3.7%) occurred in an individual between 30 and 39 years of age, and one (14.3%) occurred in an individual between 50 and 59 years of age). All three cases had both tcdA and tcdB genes, whereas only one also had the binary toxin gene. The multivariate logistic analysis indicated that toxigenic C. difficile was associated with E. bieneusi (OR = 3.529; 95% CI = 1.198–10.401; P = 0.028), Cryptosporidium parvum (OR = 0.052; 95% CI = 0.460–6.867; P = 0.007), and enteroaggregative E. coli (OR = 3.939; 95% CI = 0.362–49.519; P = 0.007) in diarrheal samples (Table 6).

DISCUSSION

The objectives of this study were to determine the prevalence of C. difficile and its toxigenic characteristics among hospital outpatients and school children and to evaluate the association between different pathologic features and the presence and toxigenic profiles of the isolates. C. difficile was less frequent among apparently healthy school children. The two positive samples obtained from the school children were toxin negative as opposed to the toxin-positive samples obtained from hospital outpatients.

Even though C. difficile is mostly known as a cause of nosocomial diarrhea, many cases have been described as acquired in the community before admission to the hospital.31 In this study, there was a high prevalence of C. difficile (14%) among the study participants, and about one half of these were toxigenic. In a related study by Johal and others,32 patients developing CDAD in the community had a significantly higher daily stool frequency, had a shorter duration of stay, had more hospital admissions over the preceding 12 months, and were more likely to be discharged to their own home than patients that developed diarrhea as inpatients (P < 0.01). In our study, these parameters were not determined; however, they might prove to be relevant in the region, but more studies are needed to confirm this. Older patients were found to have a higher prevalence of toxigenic C. difficile, and this is consistent with a previous report.33

The prevalence of C. difficile–associated diarrhea among HIV patients has been shown to vary according to different studies. In a study of C. difficile–associated diarrhea among HIV-positive patients in Illinois, CDAD was observed in 32% of all study patients with diarrhea, especially those with advanced HIV disease. However, CDAD seemed to have little impact on morbidity or mortality.34 Other reports have suggested that clinical manifestations and response to therapy in HIV-infected patients with CDAD were similar to that of patients without HIV, whereas others have noted a more severe, refractory presentation in HIV-infected patients.35,36 In our study, C. difficile did not seem to be associated with HIV. However, the number of HIV-positive individuals was low (44 patients) and was not clearly characterized in terms of CD4 + counts or HIV disease state. Thus, more studies are needed to confirm the role of C. difficile as a diarrheal agent among HIV-positive patients in the Vhembe district and in South Africa in general.

Limitations of this study included a lack of patient histories. Thus, we could not conclude with confidence whether the cases of C. difficile observed were community acquired or nosocomial.37 Although the stool samples were not screened using ELISA methods for the presence of toxins but with the more sensitive PCR analysis, this study was not able to determine the source of transmission of C. difficile infections in the Vhembe district. Studies in different regions such as Canada have indicated the presence of C. difficile in animals such as horses, dogs, ratites, pigs, and elephants, including possible zoonotic transmissions of CDAD.3840 In another study conducted in Canada, PCR ribotyping of 31 C. difficile isolates from cattle showed eight distinct patterns; seven were identified in humans, two of which were associated with outbreaks of severe disease (PCR types 017 and 027), indicating that cattle may be reservoirs of C. difficile for humans.41 Recent studies in Zimbabwe have shown the presence of toxigenic C. difficile in chicken feces, soil, and water samples, indicating that chickens kept by villagers might be important reservoirs of C. difficile, which may act as a source of human infection.42 In the Vhembe district, people live in close proximity with animals including cattle, pigs, horses, and chickens; thus, studies on the possibility of zoonotic CDAD are recommended. Further study to determine the toxinotypes and serotypes of the isolates would be beneficial.

Toxin A–negative, toxin B–positive (A−B+) C. difficile isolates have been identified in several studies.43 We found that only three (6.7%) of all C. difficile–positive samples were A−B+ variants, which is lower compared with those found in horses (16.6%)40 and around the same level as those described in Poland, where ~7% of the strains isolated from CDAD patients had the variant A−B+ isolates.44 The high prevalence of A−B+ C. difficile strains might have a negative impact on the detection of toxigenic C. difficile in stool samples when the ELISA test is used. This further underscores the importance of the implementation of molecular methods in the detection and characterization of C. difficile in specific settings.

The pathogenicity of C. difficile is mainly caused by the presence of the two large clostridial toxins A and B. The role of the recently described binary toxin is not clear. In this study, we found that the presence of any of the three toxin’s genes in C. difficile was significantly associated with all three pathogenic features tested in the study, including diarrhea, intestinal inflammation, and occult blood. More samples with the binary toxin had high levels of occult blood, indicating its possible role in the pathogenicity of C. difficile. Recent studies in hamsters have indicated that binary toxin (CDT) may play an adjunctive role to toxins A and B in the pathogenesis of C. difficile–associated disease, but by itself may not be sufficient to cause disease.45 One of the most important characteristics of the Quebec epidemic strain (NAP1/027 strain) was that it harbored both binary toxin genes and a partial tcdC deletion.46 In this study, we found two samples with shorter tcdC gene PCR products with increased pathogenic features in terms of lactoferrin and occult blood. Several studies have also described increased severity of diarrhea in patients infected with strains containing the tcdC deletion.47 The level of multiple infections with other pathogens was also high in this study. A recent study in central California indicated that underlying conditions increased the risk of colonization by C. difficile in children.48 In this study, the presence of some organisms such as E. bieneusi, C. parvum, and enteroaggregative E. coli might be associated with a more severe form of C. difficile disease because of the underlying immune status of the population. However, further clinical studies are warranted to clarify this hypothesis. Further molecular characterization of C. difficile strains from the Vhembe district will be helpful for the understanding of the global epidemiology of the tcdC gene partial deletion in the region. The role of toxigenic C. difficile in the pathogenesis of infectious diarrhea in the Vhembe district of South Africa needs further evaluation.

In conclusion, this study showed the presence of toxigenic C. difficile in the Vhembe district and its association with pathologic conditions and confirms the usefulness of the PCR methodology in the detection of toxigenic C. difficile. The presence of binary toxin genes was highly associated with occult blood, whereas toxin A and toxin B genes were more associated with diarrhea and inflammation. C. difficile is responsible for a small, but underappreciated proportion of diarrheal cases in the region, and further study is warranted in this area.

Table 1

Primers and gene targets for molecular characterization of C. difficile

Targeted geneGene functionPrimerSequenceExpected product size (bp)Reference
Triose phosphate isomerase ( tpi)C. difficile housekeeper genetpi-F
 tpi-RAAAGAAGCTACTAAGGGTACAAA
 CATAATATTGGGTCTATTCCTAC230Lemee and others 2004
tcdAToxin A, enterotoxic effects on epithelial cellstcdA (NK2)
 tcdA (NK3)CCCAATAGAAGATTCAATATTAAGCTT
 GGAAGAAAAGAACTTCTGGCTCACTCAGGT251Terhes and others 2004
tcdBToxin B, cytotoxic effects on epithelial cellsYT17
 YT18GGTGGAGCTGCTTCATTGGAGAG
 GTGTAACCTACTTTCATAACACCA399Cohen and others 2000
cdtA of binary toxinEnzymatic component of binary toxincdtAFor
 cdtARevTGAACCTGGAAAAGGTGATG
 AGGATTATTTACTGGACCATTTG376Stubbs and others 2000
cdtB of binary toxinBinding component of binary toxin3cdtBFor
 3cdtBRevGATTCACAGCTAATGTAACTA
 TATAGTCTGACCAACTATTTC475Primers derived by TechLab, Accession no. L76081
tcdCRegulator for toxins A and B, blocks transcriptionC1
 C2TTAATTAATTTTCTCTACAGCTATCC
 TCTAATAAAAGGGAGATTGTATTATG718Spigaglia and Mastrantonio 2002
Tim 2
 Struppi 2GCACCTCATCACCATCTTCAA
 TGAAGACCATGAGGAGGTCAT345
Table 2

Demographic information on the study population and distribution of C. difficile and its toxins

No. (%)No. of diarrheal samples (%)Occurrence of C. difficile (tpi)Toxin A (tcdA)Toxin B ( tcd B)Binary toxin (cdtA and B)Toxigenic (any of the three toxin genes)Non-toxigenic (none of the three toxin genes)
Origin
    Hospital255 (79.2%)167 (65.5%)43 (16.9%)18 (7.1%)21 (8.2%)12 (4.7%)23 (9%)20 (7.8%)
    Schools67 (20.8%)9 (13.4%)2 (3%)00002 (3%)
Sex
    Female182 (56.5%)106 (58.2%)27 (14.8%)13 (7.1%)13 (7.1%)7 (3.8%)14 (7.7%)13 (7.1%)
    Male140 (43.5%)70 (50%)18 (12.9%)5 (3.6%)8 (5.7%)5 (3.6%)9 (6.4%)9 (6.4%)
Age groups (years; hospitals)
    0–534 (13.3%)29 (85.3%)5 (14.7%)2 (5.9%)2 (5.9%)1 (6.3%)2 (5.9%)3 (8.9%)
    6–916 (6.3%)11 (68.8%)1 (6.3%)00001 (6.3%)
    10–1965 (25.5%)35 (53.8%)10 (15.4%)1 (1.5%)3 (4.6%)03 (4.6%)7 (19.8%)
    20–2962 (24.3%)42 (67.7%)11 (17.7%)6 (9.7%)6 (9.7%)3 (4.8%)7 (11.3%)4 (6.5%)
    30–3942 (16.5%)26 (61.9%)12 (28.6%)6 (14.3%)7 (16.7%)6 (14.3%)8 (19%)4 (9.5%)
    40–4918 (7.1%)13 (72.2%)1 (5.6%)1 (5.6%)1 (5.6%)1 (5.6%)1 (5.6%)0
    50–5910 (3.9%)6 (60%)2 (20%)2 (20%)2 (20%)1 (10%)2 (20%)0
    > 608 (3.1%)5 (62.5%)1 (12.5%)00001 (12.5%)
Age groups (years; schools)
    0–55 (7.5%)2 (40%)000000
    6–94 (6%)0000000
    10–1558 (8.6%)7 (12.1%)2 (3.4%)00002 (3.4%)
HIV positive4438 (86.4)5 (11.4%)2 (4.5%)2 (4.5%)1 (2.3%)2 (4.5%)3 (6.8%)
HIV negative278138 (49.6%)40 (14.4)16 (5.8%)19 (6.8%)11 (4%)21 (7.6%)19 (6.8%)
Total population (age groups; years)
    0–540 (12.4%)30 (75%)5 (12.5%)2 (5%)2 (5%)1 (2.5%)2 (5%)3 (7.5%)
    6–19147 (45.6%)56 (38.1%)16 (10.9%)3 (2%)5 (3.4%)1 (0.7%)5 (3.4%)11 (7.5%)
    > 20135 (42%)91 (67.4%)24 (17.8%)13 (9.6%)14 (10.4%)10 (7.4%)16 (11.9%)8 (5.9%)
    Total322176 (54.6%)45 (14%)18 (5.6%)21 (6.5%)12 (3.7%)23 (7.1%)22 (6.8%)
Table 3

Effects of C. difficile infections on diarrheal symptoms

Diarrheal*Non-diarrheal*TotalStatistics: χ2, P valuePI†
* The percentages are based on the whole population and should be considered for comparison between diarrheal cases and non-diarrheal samples.
† The pathogenic index (PI) is the ratio of the prevalence of C. difficile or the specific toxin gene in diarrheal samples by the prevalence in non-diarrheal samples (Nataro and others 2006).
tpi34 (19.3%)11 (7.5%)459.217, 0.0022.6
tcdA15 (8.5%)3 (2%)186.326, 0.0124
tcdB18 (10.2%)3 (2.1%)218.743, 0.0034.8
cdtA and B (binary toxin)10 (5.7%)2 (2%)124.135, 0.0424
A−B+CDT− (toxin B only)2 (1.1%)021.649, 0.199~1.1
A−B−CDT+ (binary toxin only)3 (1.7%)032.481, 0.115~1.7
A+B+CDT−8 (4.5%)1 (0.7%)94.304, 0.0386.4
A+B+CDT+7 (4%)2 (1.4%)91.946, 0.1632.8
Toxigenic C. difficile20 (11.4%)3 (2%)2310.426, 0.0015.4
Non-toxinogenic14 (8%)8 (5.5%)220.768, 0.3811.4
Table 4

Effects of C. difficile infections on intestinal inflammation as determined by the level of lactoferrin in the stool samples

Elevated lactoferrin*Lactoferrin negative*TotalStatistics: χ2, P valuePI†
* The percentages are based on the whole population and should be considered for comparison between cases with elevated lactoferrin levels and those negative for lactoferrin.
† The pathogenic index (PI) is the ratio of the prevalence of C. difficile or the specific toxin gene in inflammatory cases (with elevated lactoferrin levels) by the prevalence in non-inflammatory samples (negative for the lactoferrin test).
tpi28 (18.8%)17 (9.8%)455.352, 0.0212
tcdA14 (9.4%)4 (2.3%)187.612, 0.0064
tcdB17 (11.4%)4 (2.3%)2110.867, 0.0015
cdtA and B (binary toxin)9 (6%)3 (1.7%)124.137, 0.0423.5
A−B+CDT−2 (1.3%)022.337, 0.126~1.3
A−B−CDT+2 (1.3%)1 (0.6%)30.507, 0.4772.2
A+B+CDT−7 (4.7%)2 (1.1%)93.969, 0.0554
A+B+CDT+7 (4.7%)2 (1.1%)93.696, 0.0554
Toxigenic C. difficile18 (12.1%)5 (2.9%)2310.194, 0.0014.2
Non-toxinogenic10 (6.7%)12 (6.9%)220.006, 0.9361
Table 5

Effects of C. difficile infections on the presence of occult blood in the stools

Occult blood positive*Occult blood negative*TotalStatistics: χ2, P valuePI†
* The percentages are based on the whole population and should be considered for comparison between cases with positive occult blood test and those negative for occult blood.
† The pathogenic index (PI) is the ratio of the prevalence of C. difficile or the specific toxin gene in cases with positive occult blood by the prevalence in samples negative for occult blood.
tpi29 (24.4%)16 (7.9%)4516.965, 0.0003.1
tcdA15 (12.6%)3 (1.5%)1817.601, 0.0008.4
tcdB17 (14.3%)4 (2%)2118.664, 0.0007.2
cdtA and B11 (9.2%)1 (0.5%)1216.013, 0.00018.4
A−B+CDT−2 (1.7%)023.433, 0.064~1.7
A−B−CDT+2 (1.7%)1 (0.5%)31.147, 0.2843.4
A+B+CDT−6 (5%)3 (1.5%)93.508, 0.0613.3
A+B+CDT+9 (7.6%)0915.794, 0.000~7.6
Toxigenic
C. difficile19 (16%)4 (2%)2322.157, 0.0008
Non-toxinogenic10 (8.4%)12 (5.9%)220.732, 0.3921.4
Table 6

Multivariate logistic analysis of the study population for co-infection by toxigenic C. difficile and other bacterial and parasitic organisms in diarrheal samples

OrganismsOdd ratio95% confidence intervalP value
Enterocytozoon bieneusi3.5291.198–10.4010.028
Entamoeba histolytica2.1520.746–6.2050.155
Cryptosporidium hominis1.7770.460–6.8670.522
Cryptosporidium parvum0.0520.006–0.4670.007
Campylobacter jejuni1.8470.614–5.5580.332
Campylobacter coli0.5100.157–1.6520.383
Campylobacter concisus0.8920.116–6.8781.00
Arcobacter butzleri0.3180.110–0.9110.057
Helicobacter pylori0.8490.575–1.2540.485
Enteroaggregative E. coli3.9390.362–49.5190.007
Figure 1.
Figure 1.

Pictures of the different agarose gels of the PCR products. M, molecular marker (50-bp DNA ladder); PC, positive control (C. difficile from ATCC); NC, negative control (C. jejuni DNA). The numbers represent different samples negative or positive for the gene considered and do not refer to the same samples on different gels. A and B, PCR products of the tpi gene indicating the presence of C. difficile. C, PCR products of tcdA gene. D, tcdB gene PCR products. E, two samples (1 and 2) negative for binary toxin gene (cdtB), the positive and negative controls, and three positive samples (3, 4, and 5) positive for cdtB. F, control bands for cdtA (a) and cdtB (b) and other negative control organisms. G, tcdC gene PCR products from stool samples. H, positive control, negative control, and two samples positive for the tcdC genes. Sample 12 shows a shorter band, indicating the possibility of the deletion of the negative regulator gene shown in other studies to increase toxin production by the concerned strains.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.577

*

Address correspondence to Amidou Samie, MR-4 Building, Lane Rd, Room 3146, PO Box 801379, Charlottesville, VA 22908. E-mail: samieamidou@yahoo.com

Authors’ addresses: Amidou Samie, Jason Franasiak, Laurie Archbald-Pannone, Pascal Bessong, Cirle Alcantara-Warren, and Richard Guerrant, Department of Microbiology, University of Venda, Private Bag X5050, Thohoyandou 0950, Limpopo Province, South Africa, Tel: +27-15-962-8286, Fax: +27-15-962-8648, E-mail: samieamidou@yahoo.com. Chikwelu Obi, Academic and Research Directorate, Walter Sisulu University, Nelson Mandela Drive, Eastern Cape, South Africa.

Acknowledgments: The authors thank the officials of the primary schools and hospitals for collaboration in the sample collection.

Financial support: Additional support was provided by an Ellison Medical Foundation grant to the Centre for Global Health, and by the Pfizer Initiative in International Health, University of Virginia, Charlottesville, VA.

Disclosure: R. Guerrant licensed fecal lactoferrin testing to TechLab. This statement is made in the interest of full disclosure and not because the author considers this a conflict of interest.

REFERENCES

  • 1

    Cleary RK, 1998. Clostridium difficile-associated diarrhea and colitis: clinical manifestations, diagnosis, and treatment. Dis Colon Rectum 41 :1435–1449.

    • Search Google Scholar
    • Export Citation
  • 2

    Wilcox MH, 1996. Cleaning up Clostridium difficile infection. Lancet 348 :767–768.

  • 3

    Surawicz CM, McFarland LV, 1999. Pseudomembranous colitis: causes and cures. Digestion 60 :91–100.

  • 4

    Karlström O, Fryklund B, Tullus K, Burman LG, 1998. A prospective nationwide study of Clostridium difficile-associated diarrhea in Sweden. The Swedish C. difficile Study Group. Clin Infect Dis 26 :141–145.

    • Search Google Scholar
    • Export Citation
  • 5

    Kuijper EJ, Coignard B, Tull P, the ESCMID Study Group for Clostridium difficile (ESGCD)*, EU Member States and the European Centre for Disease Prevention and Control (ECDC), 2006. Emergence of Clostridium difficile-associated disease in North America and Europe. Clin Microbiol Infect 6 :2–18.

    • Search Google Scholar
    • Export Citation
  • 6

    Reichardt C, Chaberny IF, Kola A, Mattner F, Vonberg RP, Gastmeier P, 2007. Dramatic increase of diarrhea associated with Clostridium difficile in Germany: has the new strain PCR-ribotype 027 reached us? Dtsch Med Wochenschr 132 :223–228.

    • Search Google Scholar
    • Export Citation
  • 7

    Lyerly DM, Lockwood DE, Richardson SH, Wilkins TD, 1982. Biological activities of toxins A and B of Clostridium difficile. Infect Immun 35 :1147–1150.

    • Search Google Scholar
    • Export Citation
  • 8

    Borriello SP, 1998. Pathogenesis of Clostridium difficile infection. J Antimicrob Chemother 41 :13–19.

  • 9

    Riegler M, Sedivy R, Pothoulakis C, Hamilton G, Zacherl J, Bischof G, Cosentini E, Feil W, Schiessel R, LaMont JT, Wenzl E, 1995. Clostridium difficile toxin B is more potent than toxin A in damaging human colonic epithelium in vitro. J Clin Invest 95 :2004–2011.

    • Search Google Scholar
    • Export Citation
  • 10

    Barbut F, Decre D, Lalande V, Burghoffer B, Noussair L, Gigandon A, Espinasse F, Raskine L, Robert J, Mangeol A, Branger C, Petit JC, 2005. Clinical features of Clostridium difficile-associated diarrhea due to binary toxin (actin-specific ADP-ribosyltransferase)-producing strains. J Med Microbiol 54 :181–185.

    • Search Google Scholar
    • Export Citation
  • 11

    Johnson S, Kent SA, O’Leary KJ, Merrigan MM, Sambol SP, Peterson LR, Gerding DN, 2001. Fatal pseudomembranous colitis associated with a variant Clostridium difficile strain not detected by toxin A immunoassay. Ann Intern Med 135 :434–438.

    • Search Google Scholar
    • Export Citation
  • 12

    Moncrief JS, Zheng L, Neville LM, Lyerly DM, 2000. Genetic characterization of toxin A-negative, toxin B-positive Clostridium difficile isolates by PCR. J Clin Microbiol 38 :3072–3075.

    • Search Google Scholar
    • Export Citation
  • 13

    Spigaglia P, Mastrantonio P, 2002. Molecular analysis of the pathogenicity locus and polymorphism in the putative negative regulator of toxin production (TcdC) among Clostridium difficile clinical isolates. J Clin Microbiol 40 :3470–3475.

    • Search Google Scholar
    • Export Citation
  • 14

    Geric B, Carman RJ, Rupnik M, Genheimer CW, Sambol SP, Lyerly DM, Gerding DN, Johnson S, 2006. Binary toxin-producing, large clostridial toxin-negative Clostridium difficile strains are enterotoxic but do not cause disease in hamsters. J Infect Dis 193 :1143–1150.

    • Search Google Scholar
    • Export Citation
  • 15

    Poilane I, Karjalainen T, Barc MC, Bourlioux P, Collignon A, 1998. Protease activity of Clostridium difficile strains. Can J Microbiol 44 :157–161.

    • Search Google Scholar
    • Export Citation
  • 16

    Eveillard M, Fourel V, Barc MC, Kerneis S, Coconnier MH, Karjalainen T, Bourlioux P, Servin AL, 1993. Identification and characterization of adhesive factors of Clostridium difficile involved in adhesion to human colonic enterocyte-like Caco-2 and mucus-secreting HT 29 cells in culture. Mol Microbiol 7 :371–381.

    • Search Google Scholar
    • Export Citation
  • 17

    Karjalainen T, Barc MC, Collignon A, Trolle S, Boureau H, Cotte-Laffitte J, Bourlioux P, 1994. Cloning of a genetic determinant from Clostridium difficile involved in adherence to tissue culture cells and mucus. Infect Immun 62 :4347–4355.

    • Search Google Scholar
    • Export Citation
  • 18

    Bartlett JG, 2006. Narrative review: the new epidemic of Clostridium difficile-associated enteric disease. Ann Intern Med 145 :758–764.

  • 19

    Johal SS, Hammond J, Solomon K, James PD, Mahida YR, 2004. Clostridium difficile associated diarrhea in hospitalised patients: onset in the community and hospital and role of flexible sigmoidoscopy. Gut 53 :673–677.

    • Search Google Scholar
    • Export Citation
  • 20

    Rupnik M, Avesani V, Janc M, von Eichel-Streiber C, Delmee M, 1998. A novel toxinotyping scheme and correlation of toxino-types with serogroups of Clostridium difficile isolates. J Clin Microbiol 36 :2240–2247.

    • Search Google Scholar
    • Export Citation
  • 21

    Rahmati A, Gal M, Northey G, Brazier JS, 2005. Subtyping of Clostridium difficile polymerase chain reaction (PCR) ribotype 001 by repetitive extragenic palindromic PCR genomic fingerprinting. J Hosp Infect 60 :56–60.

    • Search Google Scholar
    • Export Citation
  • 22

    Silletti RP, Lee G, Ailey E, 1996. Role of stool screening tests in diagnosis of inflammatory bacterial enteritis and in selection of specimens likely to yield invasive enteric pathogens. J Clin Microbiol 34 :1161–1165.

    • Search Google Scholar
    • Export Citation
  • 23

    Ruiz-Pelaez JG, Mattar S, 1999. Accuracy of fecal lactoferrin and other stool tests for diagnosis of invasive diarrhea at a Colombian pediatric hospital. Pediatr Infect Dis J 18 :342–346.

    • Search Google Scholar
    • Export Citation
  • 24

    Vaishnavi C, Thapa BR, Thennarasu K, Singh K, 2002. Faecal lactoferrin assay as an adjunct to Clostridium difficile diarrhea. Indian J Pathol Microbiol 45 :69–73.

    • Search Google Scholar
    • Export Citation
  • 25

    Samie A, Obi CL, Barrett LJ, Powell SM, Guerrant RL, 2006. Prevalence of Campylobacter species, Helicobacter pylori and Arcobacter species in stool samples from the Venda region, Limpopo, South Africa: studies using molecular diagnostic methods. J Infect 54 :558–566.

    • Search Google Scholar
    • Export Citation
  • 26

    Lemee L, Dhalluin A, Testelin S, Mattrat MA, Maillard K, Lemeland JF, Pons JL, 2004. Multiplex PCR targeting tpi (triose phosphate isomerase), tcdA (Toxin A), and tcdB (Toxin B) genes for toxigenic culture of Clostridium difficile. J Clin Microbiol 42 :5710–5714.

    • Search Google Scholar
    • Export Citation
  • 27

    Terhes G, Urbán E, Sóki J, Hamid KA, Nagy E, 2004. Community-acquired Clostridium difficile caused by binary toxin, toxin A, toxin B gene-positive isolates in Hungary. J Clin Microbiol 42 :4316–4318.

    • Search Google Scholar
    • Export Citation
  • 28

    Cohen SH, Tang YJ, Silva J Jr, 2000. Analysis of the pathogenicity locus in Clostridium difficile strains. J Infect Dis 181 :659–663.

  • 29

    Stubbs S, Rupnik M, Gibert M, Brazier J, Duerden B, Popoff M, 2000. Production of actin-specific ADP-ribosyltransferase (binary toxin) by strains of Clostridium difficile. FEMS Microbiol Lett 186 :307–312.

    • Search Google Scholar
    • Export Citation
  • 30

    Nataro JP, Mai V, Johnson J, Blackwelder WC, Heimer R, Tirrell S, Edberg SC, Braden CR, Glenn Morris J Jr, Hirshon JM, 2006. Diarrheagenic Escherichia coli infection in Baltimore, Maryland, and New Haven, Connecticut. Clin Infect Dis 43 :402–407.

    • Search Google Scholar
    • Export Citation
  • 31

    Kyne L, Merry C, O’Connell B, Keane C, O’Neill D, 1998. Community-acquired Clostridium difficile infection. J Infect 36 :287–288.

  • 32

    Johal SS, Hammond J, Solomon K, James PD, Mahida YR, 2004. Clostridium difficile associated diarrhoea in hospitalised patients: onset in the community and hospital and role of flexible sigmoidoscopy. Gut 53 :673–677.

    • Search Google Scholar
    • Export Citation
  • 33

    Raveh D, Rabinowitz B, Breuer GS, Rudensky B, Yinnon AM, 2006. Risk factors for Clostridium difficile toxin-positive nosocomial diarrhea. Int J Antimicrob Agents 28 :231–237.

    • Search Google Scholar
    • Export Citation
  • 34

    Pulvirenti JJ, Mehra T, Hafiz I, DeMarais P, Marsh D, Kocka F, Meyer PM, Fischer SA, Goodman L, Gerding DN, Weinstein RA, 2002. Epidemiology and outcome of Clostridium difficile infection and diarrhea in HIV infected inpatients. Diagn Microbiol Infect Dis 44 :325–330.

    • Search Google Scholar
    • Export Citation
  • 35

    Hutin Y, Molina JM, Casin I, Daix V, Sednaoui P, Welker Y, Lagrange P, Decazes JM, Modai J, 1993. Risk factors for Clostridium difficile-associated diarrhea in HIV-infected patients. AIDS 7 :1441–1447.

    • Search Google Scholar
    • Export Citation
  • 36

    Colarian J, 1988. Clostridium difficile colitis following antiviral therapy in the acquired immunodeficiency syndrome. Am J Med 84 :1081.

  • 37

    McDonald LC, Coignard B, Dubberke E, Song X, Horan T, Kutty PK, Ad Hoc Clostridium difficile Surveillance Working Group, 2007. Recommendations for surveillance of Clostridium difficile-associated disease. Infect Control Hosp Epidemiol 28 :140–145.

    • Search Google Scholar
    • Export Citation
  • 38

    Taha S, Johansson O, Rivera Jonsson S, Heimer D, Krovacek K, 2007. Toxin production by and adhesive properties of Clostridium difficile isolated from humans and horses with antibiotic-associated diarrhea. Comp Immunol Microbiol Infect Dis 30 :163–174.

    • Search Google Scholar
    • Export Citation
  • 39

    Songer JG, Anderson MA, 2006. Clostridium difficile: an important pathogen of food animals. Anaerobe 12 :1–4.

  • 40

    Arroyo LG, Staempfli H, Weese JS, 2007. Molecular analysis of Clostridium difficile isolates recovered from horses with diarrhea. Vet Microbiol 120 :179–183.

    • Search Google Scholar
    • Export Citation
  • 41

    Rodriguez-Palacios A, Stampfli HR, Duffield T, Peregrine AS, Trotz-Williams LA, Arroyo LG, Brazier JS, Weese JS, 2006. Clostridium difficile PCR ribotypes in calves, Canada. Emerg Infect Dis 12 :1730–1736.

    • Search Google Scholar
    • Export Citation
  • 42

    Simango C, 2006. Prevalence of Clostridium difficile in the environment in a rural community in Zimbabwe. Trans R Soc Trop Med Hyg 100 :1146–1150.

    • Search Google Scholar
    • Export Citation
  • 43

    Wultanska D, Pituch H, Obuch-Woszczatynski P, Meisel-Mikolajczyk F, Luczak M, 2005. Profile of toxigenicity of Clostridium difficile strains isolated from paediatric patients with clinical diagnosis of antibiotic associated diarrhea (AAD). Med Dosw Mikrobiol 57 :377–382.

    • Search Google Scholar
    • Export Citation
  • 44

    Pituch H, Obuch-Woszczatynski P, Luczak M, Meisel-Mikolajczyk F, 2003. Clostridium difficile and enterotoxigenic Bacteroides fragilis strains isolated from patients with antibiotic associated diarrhea. Anaerobe 9 :161–163.

    • Search Google Scholar
    • Export Citation
  • 45

    Price MF, Dao-Tran T, Garey KW, Graham G, Gentry LO, Dhungana L, DuPont HL, 2007. Epidemiology and incidence of Clostridium difficile-associated diarrhea diagnosed upon admission to a university hospital. J Hosp Infect 65 :42–46.

    • Search Google Scholar
    • Export Citation
  • 46

    Kazakova SV, Ware K, Baughman B, Bilukha O, Paradis A, Sears S, Thompson A, Jensen B, Wiggs L, Bessette J, Martin J, Clukey J, Gensheimer K, Killgore G, McDonald LC, 2006. A hospital outbreak of diarrhea due to an emerging epidemic strain of Clostridium difficile. Arch Intern Med 166 :2518–2524.

    • Search Google Scholar
    • Export Citation
  • 47

    Curry SR, Marsh JW, Muto CA, O’Leary MM, Pasculle AW, Harrison LH, 2007. tcdC genotypes associated with severe TcdC truncation in an epidemic clone and other strains of Clostridium difficile. J Clin Microbiol 45 :215–221.

    • Search Google Scholar
    • Export Citation
  • 48

    Rexach CE, Tang-Feldman YJ, Cantrell MC, Cohen SH, 2006. Epidemiologic surveillance of Clostridium difficile diarrhea in a freestanding pediatric hospital and a pediatric hospital at a university medical center. Diagn Microbiol Infect Dis 56 :109–114.

    • Search Google Scholar
    • Export Citation

Author Notes

Reprint requests: A. Samie, Department of Microbiology, University of Venda, Private Bag X5050, Thohoyandou 0950, Limpopo Province, South Africa, E-mail: samieamidou@yahoo.com.
Save