• View in gallery

    Localization of Opisthorchis viverrini antigens in the liver of O. viverrini-infected hamsters treated with praziquantel. Hamsters were infected with 50 metacercariae of O. viverrini for 3 months and then a single dose of praziquantel (400 mg/kg of body weight suspended in 2% cremophor) was given. After 6 (D), 12 (E), and 24 (F) hours of treatment, animals were killed. Opisthorchis viverrini–infected hamsters were treated with 2% cremophor (C). Normal hamsters were treated with 2% cremophore (A) or praziquantel for 12 hours before analysis (B). Tissue section of hamster liver was stained with rabbit polyclonal anti-crude O. viverrini antibody and visualized using 3,3′-diaminobenzidine solution as a chromogen. (Magnification × 100). OV = O. viverrini, Bd = bile duct. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Histopathologic changes in the liver of Opisthorchis viverrini–infected hamsters treated with praziquantel. Hematoxylin and eosin staining (A–C) was performed in the liver of O. viverrini-infected hamsters 6 hours after treatment with praziquantel (B and C), and in hamsters treated with 2% cremophor (A). Six hours after drug administration, eosinophils are accumulated around broken worm (arrowheads) and in an inflamed area (B and C). Aldehyde fuchsin staining (D–I) shows that mast cells are accumulated 6 hours ( G and H) and 12 hours (I) after praziquantel treatment, but only a few mast cells can be seen in O. viverrini-infected hamsters treated with 2% cremophor (E and F) and normal hamster treated with praziquantel for 12 hours (D). Six hours (G and H) and 12 hours (I) after drug treatment, increased accumulation of mast cells was observed around a broken worm and in an inflamed area compared with O. viverrini-infected hamsters treated with 2% cremophore (E and F). The arrowheads (F, H, and I) show mast cells in the inflammatory area. (Magnification × 100 for A, B, E, and G; × 200 for F and H; and × 400 for C, D, and I.) OV = O. viverrini; IC = inflammatory cells; Eo = eosinophils; Mc = mast cells. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Effect of praziquantel on expression of inducible nitric oxide synthase (iNOS) and nuclear factor-κB (NF-κB) in livers of Opisthorchis viverrini–infected hamsters. Expression of iNOS and NF-κB in hamster livers was assessed by double immunofluorescence. Opisthorchis viverrini infection induced iNOS expression (red) in the cytoplasm and NF-κB accumulation (green) in the nucleus of bile duct epithelial cells. Treatment with praziquantel gradually increased expression of these proteins 6 hours post-treatment. Expression reached its highest level 12 hours post-treatment and then decreased 24 hours post-treatment. Normal hamsters treated with praziquantel and analyzed 12 hours after treatment (N + PZ, 12 hr) showed weak immunoreactivity. (Magnification × 400; magnification × 200 for N + PZ). OV = O. viverrini; Bd = bile duct. This figure appears in color at www.ajtmh.org.

  • View in gallery

    Effect of praziquantel on mRNA expression of inducible nitric oxide synthase (iNOS), nuclear factor-κB (NF-κB), and antioxidant enzymes in livers of Opisthorchis viverrini–infected hamsters. Relative mRNA expression of iNOS (A), NF-κB (B), superoxide dismutase (SOD1) (C), SOD2 (D), SOD3 (E), and catalase (CAT) (F) to glyceraldehyde 3-phosphate dehydrogenase was studied by real-time reverse transcription–polymerase chain reaction analysis. Relative mRNA expression of NF-κB in the livers of O. viverrini-infected hamsters increased significantly 6 hours after treatment with praziquantel, whereas mRNA expression of iNOS, SOD1, SOD2, SOD3, and CAT increased significantly 12 hours post-treatment. The level of mRNA expression of these genes was not changed in normal hamster livers for 6–24 hours post-treatment. Values on the ordinate represent the mean ± SE of three hamsters and the experiment was performed in triplicate. Statistical significance was analyzed using Student’s t-test to compare the O. viverrini-infected hamsters and normal hamsters treated with praziquantel at the same time point. * P < 0.05; **P < 0.01; ***P < 0.001.

  • View in gallery

    Effect of praziquantel on biochemical parameters in the plasma of Opisthorchis viverrini–infected hamsters. Plasma levels of nitrate (A), malondialdehyde (MDA) (B), and ferric-reducing antioxidant power (FRAP) (C) were measured as described in the Materials and Methods. A significant increase in praziquantel-treated group is seen 12–24 hours post-treatment for nitrate levels (A), 6–24 hours post-treatment for MDA (B), and 12–24 hours post-treatment for FRAP (C) compared with normal hamster treated with praziquantel at the same time point. Data are means ± SE. The experiment was performed in duplicate. Statistical significance was analyzed using Student’s t-test to compare the 10 O. viverrini-infected hamsters and 5 normal hamsters in each group. *P < 0.05; **P < 0.01; ***P < 0.001.

  • 1

    IARC, 1994. Infection with liver flukes (Opisthorchis viverrini, Opisthorchis felineus and Clonorchis sinensis). IARC Monogr Eval Carcinog Risks Hum 61 :121–175.

    • Search Google Scholar
    • Export Citation
  • 2

    Jongsuksuntigul P, Imsomboon T, 2003. Opisthorchiasis control in Thailand. Acta Trop 88 :229–232.

  • 3

    Ohshima H, Bartsch H, 1994. Chronic infections and inflammatory processes as cancer risk factors: possible role of nitric oxide in carcinogenesis. Mutat Res 305 :253–264.

    • Search Google Scholar
    • Export Citation
  • 4

    Coussens LM, Werb Z, 2002. Inflammation and cancer. Nature 420 :860–867.

  • 5

    Ohshima H, Tatemichi M, Sawa T, 2003. Chemical basis of inflammation-induced carcinogenesis. Arch Biochem Biophys 417 :3–11.

  • 6

    Pinlaor S, Hiraku Y, Ma N, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, Sithithaworn P, Kawanishi S, 2004. Mechanism of NO-mediated oxidative and nitrative DNA damage in hamsters infected with Opisthorchis viverrini: a model of inflammation-mediated carcinogenesis. Nitric Oxide 11 :175–183.

    • Search Google Scholar
    • Export Citation
  • 7

    Pinlaor S, Ma N, Hiraku Y, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, Sithithaworn P, Kawanishi S, 2004. Repeated infection with Opisthorchis viverrini induces accumulation of 8-nitroguanine and 8-oxo-7,8-dihydro-2′-deoxy-guanine in the bile duct of hamsters via inducible nitric oxide synthase. Carcinogenesis 25 :1535–1542.

    • Search Google Scholar
    • Export Citation
  • 8

    Pinlaor S, Hiraku Y, Yongvanit P, Tada-Oikawa S, Ma N, Pinlaor P, Sithithaworn P, Sripa B, Murata M, Oikawa S, Kawanishi S, 2006. iNOS-dependent DNA damage via NF-κB expression in hamsters infected with Opisthorchis viverrini and its suppression by the antihelminthic drug praziquantel. Int J Cancer 119 :1067–1072.

    • Search Google Scholar
    • Export Citation
  • 9

    Bunnag D, Pungpark S, Harinasuta T, Viravan C, Vanijanonta S, Suntharasamai P, Migasena S, Charoenlarp P, Riganti M, LooAreesuwan S, 1984. Opisthorchis viverrini: clinical experience with praziquantel in Hospital for Tropical Diseases. Arzneimittelforschung 34 :1173–1174.

    • Search Google Scholar
    • Export Citation
  • 10

    Matsumoto J, Matsuda H, 2002. Mast-cell-dependent histamine release after praziquantel treatment of Schistosoma japonicum infection: implications for chemotherapy-related adverse effects. Parasitol Res 88 :888–893.

    • Search Google Scholar
    • Export Citation
  • 11

    Abend Y, Ashkenazy Y, Witzling V, Feigl D, Geltner D, Moshonov S, Zor U, 1996. Nitric oxide: a mediator in anaphylactic shock in guinea-pigs. J Basic Clin Physiol Pharmacol 7 :57–69.

    • Search Google Scholar
    • Export Citation
  • 12

    Mak JC, Leung HC, Ho SP, Law BK, Lam WK, Tsang KW, Ip MS, Chan-Yeung M, 2004. Systemic oxidative and antioxidative status in Chinese patients with asthma. J Allergy Clin Immunol 114 :260–264.

    • Search Google Scholar
    • Export Citation
  • 13

    Ceylan E, Aksoy N, Gencer M, Vural H, Keles H, Selek S, 2005. Evaluation of oxidative-antioxidative status and the L-arginine-nitric oxide pathway in asthmatic patients. Respir Med 99 :871–876.

    • Search Google Scholar
    • Export Citation
  • 14

    Mitsuhata H, Shimizu R, Yokoyama MM, 1995. Role of nitric oxide in anaphylactic shock. J Clin Immunol 15 :277–283.

  • 15

    Kowluru RA, Kowluru V, Xiong Y, Ho YS, 2006. Overexpression of mitochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stress. Free Radic Biol Med 41 :1191–1196.

    • Search Google Scholar
    • Export Citation
  • 16

    Sripa B, Kaewkes S, 2000. Localisation of parasite antigens and inflammatory responses in experimental opisthorchiasis. Int J Parasitol 30 :735–740.

    • Search Google Scholar
    • Export Citation
  • 17

    Pinlaor S, Sripa B, Sithithaworn P, Yongvanit P, 2004. Hepatobiliary changes, antibody response, and alteration of liver enzymes in hamsters re-infected with Opisthorchis viverrini. Exp Parasitol 108 :32–39.

    • Search Google Scholar
    • Export Citation
  • 18

    Gerard CJ, Olsson K, Ramanathan R, Reading C, Hanania EG, 1998. Improved quantitation of minimal residual disease in multiple myeloma using real-time polymerase chain reaction and plasmid-DNA complementarity determining region III standards. Cancer Res 58 :3957–3964.

    • Search Google Scholar
    • Export Citation
  • 19

    Miranda KM, Espey MG, Wink DA, 2001. A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite. Nitric Oxide 5 :62–71.

    • Search Google Scholar
    • Export Citation
  • 20

    Nowak D, Kalucka S, Bialasiewicz P, Krol M, 2001. Exhalation of H2O2 and thiobarbituric acid reactive substances (TBARs) by healthy subjects. Free Radic Biol Med 30 :178–186.

    • Search Google Scholar
    • Export Citation
  • 21

    Benzie IF, Strain JJ, 1996. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Anal Biochem 239 :70–76.

    • Search Google Scholar
    • Export Citation
  • 22

    Liu LX, Weller PF, 1996. Antiparasitic drugs. N Engl J Med 334 :1178–1184.

  • 23

    Brindley PJ, Sher A, 1990. Immunological involvement in the efficacy of praziquantel. Exp Parasitol 71 :245–248.

  • 24

    Dean Befus YS, Moon TC, Munoz S, Befus AD, 2005. Role of nitric oxide in mast cells: controversies, current knowledge, and future applications. Immunol Res 33 :223–239.

    • Search Google Scholar
    • Export Citation
  • 25

    Shorter D, Makone I, Elliott EJ, 2006. Fever and urticaria in an African refugee. J Paediatr Child Health 42 :731–733.

  • 26

    Matsumoto J, 2002. Adverse effects of praziquantel treatment of Schistosoma japonicum infection: involvement of host anaphylactic reactions induced by parasite antigen release. Int J Parasitol 32 :461–471.

    • Search Google Scholar
    • Export Citation
  • 27

    Mendes AF, Caramona MM, Carvalho AP, Lopes MC, 2003. Differential roles of hydrogen peroxide and superoxide in mediating IL-1-induced NF-κB activation and iNOS expression in bovine articular chondrocytes. J Cell Biochem 88 :783–793.

    • Search Google Scholar
    • Export Citation
  • 28

    Surh YJ, Chun KS, Cha HH, Han SS, Keum YS, Park KK, Lee SS, 2001. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-κB activation. Mutat Res 480–481 :243–268.

    • Search Google Scholar
    • Export Citation
  • 29

    Balkwill F, Coussens LM, 2004. Cancer: an inflammatory link. Nature 431 :405–406.

  • 30

    Pinlaor S, Tada-Oikawa S, Hiraku Y, Pinlaor P, Ma N, Sithithaworn P, Kawanishi S, 2005. Opisthorchis viverrini antigen induces the expression of Toll-like receptor 2 in macrophage RAW cell line. Int J Parasitol 35 :591–596.

    • Search Google Scholar
    • Export Citation
  • 31

    Miyake H, Sakal I, Harada K, Eto H, Hara I, 2004. Clinicopathological outcome of radical retropubic prostatectomy for 200 men with prostate cancer in a single institution in Japan. Hinyokika Kiyo 50 :151–156.

    • Search Google Scholar
    • Export Citation
  • 32

    McCormick ML, Roeder TL, Railsback MA, Britigan BE, 1994. Eosinophil peroxidase-dependent hydroxyl radical generation by human eosinophils. J Biol Chem 269 :27914–27919.

    • Search Google Scholar
    • Export Citation
  • 33

    Meilhac O, Zhou M, Santanam N, Parthasarathy S, 2000. Lipid peroxides induce expression of catalase in cultured vascular cells. J Lipid Res 41 :1205–1213.

    • Search Google Scholar
    • Export Citation
  • 34

    Ikediobi CO, Badisa VL, Ayuk-Takem LT, Latinwo LM, West J, 2004. Response of antioxidant enzymes and redox metabolites to cadmium-induced oxidative stress in CRL-1439 normal rat liver cells. Int J Mol Med 14 :87–92.

    • Search Google Scholar
    • Export Citation
  • 35

    Murley JS, Kataoka Y, Hallahan DE, Roberts JC, Grdina DJ, 2001. Activation of NFκB and MnSOD gene expression by free radical scavengers in human microvascular endothelial cells. Free Radic Biol Med 30 :1426–1439.

    • Search Google Scholar
    • Export Citation
  • 36

    Kolodziejczyk L, Siemieniuk E, Skrzydlewska E, 2005. Antioxidant potential of rat liver in experimental infection with Fasciola hepatica. Parasitol Res 96 :367–372.

    • Search Google Scholar
    • Export Citation

 

 

 

 

 

Oxidative and Nitrative Stress in Opisthorchis viverrini–Infected Hamsters: An Indirect Effect after Praziquantel Treatment

View More View Less
  • 1 Department of Parasitology, Department of Biochemistry, and Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, and Department of Clinical Microbiology, Faculty of Associated Medical Science, Khon Kaen University, Khon Kaen, Thailand; Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie, Japan; Department of Anatomy and Developmental Neurobiology Institute of Health Biosciences, The University of Tokushima Graduate School, Tokushima, Japan; Faculty of Health Science, Suzuka University of Medical Science, Mie, Japan

Praziquantel causes adverse effects after short-term treatment. To examine the mechanism of these effects, we studied the distribution of Opisthorchis viverrini antigens and the expression of inducible nitric oxide synthase (iNOS), nuclear factor-κB (NF-κB), and antioxidant enzymes in O. viverrini-infected hamsters during short-term praziquantel treatment. Praziquantel-induced dispersion of parasite antigens produced a recruitment of inflammatory cells. NF-κB and iNOS mRNA expression was significantly elevated and associated with their immunoreactivity in the bile duct epithelium and inflammatory cells. Plasma nitrate, end products of nitric oxide, and malondialdehyde level increased significantly. Expression of mRNA for antioxidant enzymes (superoxide dismutases, catalase, and glutathione peroxidase) also increased significantly, which suggests host defense against oxidative stress. These results suggest that short-term praziquantel treatment induces inflammation and resulting oxidative and nitrative stress through O. viverrini antigen release. Data in this study can be used as a basis to understand potential side effects of praziquantel treatment in humans.

INTRODUCTION

Opisthorchis viverrini is a liver fluke that is endemic in southeast Asia (Thailand, Lao People’s Democratic Republic, Vietnam, and Cambodia).1 Approximately six million people are estimated to be infected with the liver fluke in Thailand.2 Opisthorchis viverrini infection is the major risk factor for development of cholangiocarcinoma (CCA) in northeastern Thailand, which has the highest incidence in the world.1 Host immune response to this parasite during chronic infection is one of the major mechanisms leading to inflammation-associated carcinogenesis.3 During chronic inflammation, reactive oxygen species (ROS) and reactive nitrogen species are generated from inflammatory and epithelial cells and play a key role in pathologic conditions and carcinogenesis.4,5

Praziquantel is the current drug of choice for treatment of O. viverrini infection and its cure rate is > 90%.2 We have previously reported that O. viverrini infection mediates inducible nitric oxide synthase (iNOS)–dependent DNA damage in the intrahepatic bile duct epithelium and inflammatory cells of animals.6,7 This DNA lesion is reduced after one week of praziquantel treatment.8 However, praziquantel induces considerable adverse clinical effects. Although several side effects occur within 24 hours,9 the mechanism of side effects of short-term treatment with praziquantel has not been clarified.

Mast cell–dependent histamine release after short-term treatment with praziquantel in Schistosoma japonicum–infected mice may have implications for chemotherapy-related adverse effects.10 Mast cells generate not only acute inflammation, but also free radical production, which mediates anaphylactic reactions.11 Several studies have proposed that reactive species such as nitric oxide (NO) may participate in side effects including anaphylactic reactions.1214 In addition, antioxidant defense against free radical production seems to be important in reducing oxidative damage.15

To clarify the role of praziquantel in induction oxidative and nitrative stress during short-term treatment, expression of iNOS and its transcriptional factor nuclear factor-κB (NF-κB) in the liver of O. viverrini–infected hamsters treated with praziquantel was investigated at the mRNA and protein levels. Expression of antioxidant enzymes as a defense against oxidative damage, such as Cu/Zn-superoxide dismutase (SOD1), Mn-SOD (SOD2), extracellular SOD (SOD3), catalase (CAT), and glutathione peroxidase (GPx), was analyzed. Biochemical parameters including plasma nitrate levels, end products of NO, plasma malondialdehyde (MDA), an oxidative biomarker, and the ferric-reducing antioxidant power (FRAP) in plasma were also analyzed.

MATERIALS AND METHODS

Parasites.

Opisthorchis viverrini metacercariae were isolated from naturally infected fish by pepsin digestion as described previously.7 The cyprinid fish, obtained from the parasite-endemic area of Khon Kaen Province, Thailand, were digested with 0.25% pepsin-HCl and washed several times with normal saline. Metacercariae were collected under a dissecting microscope and viable cysts were used to infect test hamsters.

Animal experiment.

Sixty male Syrian hamsters approximately 6–8 weeks of age were used in this study and divided into 2 groups, uninfected and infected hamsters. For the infected group, 50 metacercariae of O. viverrini were given by intra-gastric intubation. After 12 weeks post-infection, both groups were treated with praziquantel (Biltricide®, single dose of 400 mg/kg of body weight; Bayer, Pittsburgh, PA) suspended in 2% Cremophor EI (Sigma, St. Louis, MO), and killed at 6, 12, and 24 hours post-treatment. In addition, un-infected and infected hamsters that did not receive drug treatment were treated with 2% cremophor and referred to as normal controls and untreated controls (0 hours post-treatment), respectively. In this case, infected hamsters were referred to as untreated controls. Ten and five animals were used for each time point for O. viverrini-infected and normal control hamsters, respectively. Animals were housed under conventional conditions and fed a stock diet and water ad libitum. The protocol used was reviewed and approved by the Animal Ethics Committee, Khon Kaen University (Khon Kaen, Thailand).

Sample collection and pathologic study.

Hamsters were anaesthetized with ether and blood was collected from the heart. Plasma was collected after centrifugation at 3,000 × g for 10 minutes at 4°C and stored at −80°C until used. The hilar region and adjacent areas of the liver were dissected and tissues were placed in 10% buffered formalin. After fixation overnight, they were processed in a conventional manner. Tissue sections (5-μm thickness) were stained with hematoxylin and eosin to evaluate histopathologic changes and immunostained to observe the localization of O. viverrini antigens.

Preparation of parasite antigens and antibody production.

Hamsters were infected with 50 O. viverrini metacercariae. After three months, adult worms were recovered from the liver and bile ducts for antigen preparations. Crude extract and excretory-secretory (ES) O. viverrini antigens were prepared as described previously.16,17 Antibodies against crude extract and ES antigens were produced using a standard method with minor modifications.6 Parasite antigens were mixed with Freund’s complete adjuvant and given to rabbits by subcutaneous administration. Six weeks after immunization, the same antigen was given and blood was collected 10 days later. The IgG fraction was purified by affinity chromatography using a protein A-Sepharose 4B column (Zymed, South San Francisco, CA). Purified antibodies were tested for cross-reactivity with other parasites by using an indirect enzyme-linked immunosorbent assay (ELISA) technique.

Enzyme-linked immunosorbent assay for confirmation of antibody production.

Taenia saginata adults were obtained from an infected patient after drug treatment. Fasciola gigantica adults were collected from infected cattle in the field. Ancylostoma caninum and Angiostrongylus cantonensis adults, and sparganum (larva stage of Spirometra spp.) were obtained from infected experimental dogs, rats, and mice, respectively. Strongyloides stercoralis third-stage larvae were isolated from an agar plate culture from an infected patient. A crude extract of antigens of these parasites was prepared and indirect ELISA was performed as described previously.17 The optimal condition for the indirect ELISA included 2.5 μg/mL of parasite antigen, rabbit polyclonal antibody (diluted 1:800), goat anti-rabbit IgG horseradish peroxidase conjugate (diluted; 1:4,000, Zymed) and its substrate (p-phenylenediamine dihydrochloride; Zymed). The optical density (OD) was read at 492 nm. Antibodies were aliquoted and stored at −80°C until used for immunohistochemical staining.

Primer design for quantitative real-time reverse transcription–polymerase chain reaction (RT-PCR) and sequence analysis.

Oligonucleotide primers specific for the hamster (Mesocricetus auratus) database for iNOS, SOD3, and endogenous control (glyceraldehyde-3-phosphate dehydrogenase [GAPDH]) mRNA sequence were designed from sequences in GenBank (accession nos. DQ355357.1, AB212861.1, and DQ403054.1, respectively). Primer sequences are as follows: for iNOS, forward: (5′-CAGAACAGAGGGCTCAAAGG-3′), reverse (5′-TCTGCAGGATGTCTTGAACG-3′); for SOD3, forward (5′-GGCAGCCCTTGGCTCTGT-3′), reverse (5′-AAAGCTGGACTCCGCAGGAT-3′); and for GAPDH, forward (5′-AGAAGACTGTGGATGGCCCC-3′), reverse (5′-TGACCTTGCCCACAGCCTT-3′).

In addition, oligonucleotide primers specific to the Rattus norvegicus for NF-κB and antioxidant enzymes SOD1, SOD2, CAT, and GPx were designed from sequences in GenBank (accession nos. XM_342346.2, NM_017050.1, NM_017051.2, NM_012520.1, and NM_030826.2, respectively). Primer sequences are as follows: for NF-κB, forward (5′-GCTTTGCA AACCTGGGAATA-3′), reverse (5′-CAAGGTCAGAAT GCACCAGA-3′); for SOD1, forward (5′-CGGATGAAGA GAGGCATGTT-3′), reverse (5′-CACCTTTGCCCAAGT CATCT-3′); for SOD2, forward (5′-CCGAGGAGAAGT ACCACGAG-3′), reverse (5′-GCTTGATAGCCTCCAGC AAC-3′); for CAT, forward (5′-TTGACAGAGAGCGGA TTCCT-3′), reverse (5′-AGCTGAGCCTGACTCTCCAG 3′); and for GPx, forward (5′-GGTTCG AGCCCAACT TTACA-3′), reverse (5′-CGGGGACCAAATGATGTA CT-3′). The PCR products were confirmed after cloning into in-house constructed T-vectors and sequencing using respective gene-specific primers with Cy5-labeled primers (Applied Biosystems, Foster City, CA) in the MegaBACE™ 1000 DNA analysis System (Pharmacia, Piscataway, NJ). The DNA sequences were assembled and analyzed using BioEdit software (http://www.mbio.ncsu.edu/BioEdit). The BLAST network service was used to search the nucleotide and protein database at the National Center for Biotechnology Information (http://www.ncbi.nlm.nih.gov./BLASTn or BLASTX).

Preparation of RNA from livers of O. viverrini-infected hamsters with and without praziquantel treatment.

Total RNA was isolated from the liver of O. viverrini-infected hamsters with and without drug treatment using TRIzol (Invitrogen, Carlsbad, CA) according to the protocol provided by the manufacturer. Approximately 150 mg of the hamster liver from hilar and adjacent areas was quickly dissected and dipped into TRIzol. Total RNA was treated with 5 units of DNase (Promega, Madison, WI) and 119 units of ribonuclease inhibitor (Promega) in 400 mM Tris-HCl, 100 mM NaCl, 60 mM MgCl2, 20 mM ditheothreitol, pH 7.5. Total RNA was extracted with phenol/chloroform, precipitated with ethanol, and dissolved in RNase-free water. Total RNA (3 μg) was reverse-transcribed into cDNA using Oligo(dT)15 primers (Promega) following the protocol for transcription by Moloney murine leukemia virus reverse transcriptase (Promega). cDNA was used for real-time RT-PCR analysis.

SYBR green real-time RT-PCR analysis.

Real-time RT-PCR for iNOS, NF-κB, SODs, CAT, and GPx mRNA expression was performed using a SYBR green assay. The reaction mixture (20 μL) contained 5 μL of single-stranded cDNA (1:3), 1 × PCR buffer (20 mM Tris-HCl, pH 8.3, 20 mM KCl, 5 mM (NH4)2SO4, 3 mM MgCl2), 0.25 mM of each deoxynucleotide triphosphate, 5 pmol of forward and reverse primers, 0.5 × SYBR green, and 1 unit of Hot start Taq polymerase (MBI Fermantas, St. Leon-Rot, Germany). The PCR cycling conditions were 95°C for 10 minutes, then 40 cycles at 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute, followed by 72°C for 10 minute. At each cycle, the accumulated PCR products were detected by monitoring the increase in fluorescence of the reporter dye from dsDNA-binding SYBR green.

After the PCR, a dissociation curve (melting curve) was constructed in the range of 50°C to 99°C according to the dissociation protocol of the ABI7500 instrument (Applied Biosystems). All data were analyzed using Rotor Gene 5 software (Corbett Research, Sydney, New South Wales, Australia). Validation experiments were carried out in triplicate. Relative expression of iNOS, NF-κB, SODs, CAT, and GPx mRNA was calculated using the comparative cycle threshold method as described previously.18 All values were normalized to the GAPDH gene and reported as fold change over background levels detected in normal hamsters without praziquantel treatment as a calibrator.

Immunohistochemical study.

We performed an immunohistochemical study to examine the localization of O. viverrini antigens using rabbit polyclonal antibody against crude extract or ES O. viverrini antigen (each diluted 1:300). Sections were incubated with goat anti-rabbit IgG antibody conjugated with horseradish peroxidase (diluted 1:200) and visualized with 3,3-diaminobenzidine tetrahydrochloride as a chromogen.

Co-localization of iNOS and NF-κB in hamster liver was assessed by a double immunofluorescence-labeling study.7 Paraffin sections (5-μm thickness) were incubated with primary antibodies (rabbit polyclonal anti-iNOS antibody diluted 1:300; Calbiochem-Novabiochem Corporation, San Diego, CA) and mouse monoclonal anti-NF-κB p65 antibody (diluted 1:300; Santa Cruz Biotechnology, Santa Cruz, CA) overnight at room temperature. Sections were incubated for three hours with an Alexa 488-labeled goat anti-mouse IgG and an Alexa 594-labeled goat anti-rabbit IgG (each diluted 1:400; Molecular Probes Inc., Eugene, OR). Stained sections were examined using a fluorescence microscope.

Histopathologic changes were assessed using hematoxylin and eosin staining of the paraffin sections that were processed in a conventional manner. In addition, tissue mast cells in inflamed areas were examined using aldehyde fuchsin staining. The number of mast cells was counted in the inflamed areas around the bile ducts with and without O. viverrini in the tissue section.

Analysis of biochemical parameters.

The amount of NO production was determined as nitrate in plasma by the vanadium-based simple spectrophotometric method using the Griess reaction19 with minor modifications. The assay was performed in a standard, flat-bottomed, 96-well, polystyrene microtiter plates. Nitrate concentration in the biological samples was measured after catalyzed reduction to nitrite using VCl3. Plasma (100 μL) was deproteinized to reduce turbidity with 200 μL of cold absolute methanol:diethyl ether (3:1, v/v) for 30 minutes at −80°C. Samples were centrifuged at 12,000 × g for 10 minutes and the supernatant was analyzed. After 100 μL of supernatant or nitrate standard was added to a well, 100 μL of VCl3 was added, followed by immediate addition of 100 μL of the Griess reagent (pre-mixed 50 μL of 2% sulfanilamide in 5% HCl and 50 μL of 0.1% of N-(1-naphthyl) ethylenediamine dihydrochloride). The contents were vigorously mixed and the plate was incubated for 20 minutes at 37°C and absorbance was read at 540 nm.

A thiobarbituric acid reactive substances (TBARS) reaction equivalent to MDA was measured as described previously.20 The TBARS were determined with fluorescence spectrofluorometry (GEMINI XPS; Molecular Devices, Sunnyvale, CA) with 520 nm excitation and 550 nm emission, using 1,1,3,3-tetramethoxypropane as the standard.

The FRAP in the plasma was measured by spectrophotometric analysis.21 One thousand microliters of FRAP reagents (300 mM acetate buffer, 10 mM 2,4,6-tripyridyl-s-triazine; Fluka Chemicals, Buchs, Switzerland, and 20 mM FeCl3.6H2O) (ratio 10:1:1) were incubated with 30 μL of plasma or standard calibrator (FeSO4.7H2O) for 4 minutes at 37°C. The change in absorbance at 593 nm (ΔA593nm) between the final reading and the reagent blank reading was calculated for each sample and related to ΔA593nm of a FeII standard solution tested in parallel.

Statistical analysis.

Data are presented as the mean ± SE. The t-test was used to compare infected and normal groups. To compare three or more groups, we performed a one-way analysis of variance with SPSS version 11 software (SPSS Inc., Chicago, IL). A P value < 0.05 was considered statistically significant.

RESULTS

Specificity of rabbit polyclonal antibodies against crude or ES antigen of O. viverrini.

Purified antibodies against O. viverrini antigens were tested for confirmation of antibody production and cross-reactivity with other parasites such as F. gigantica, A. caninum, A. cantonensis, T. saginata, sparganum, and S. stercoralis using an indirect ELISA technique. The mean OD for ES O. viverrini antibody was 0.722 for F. gigantica, 1.149 for A. caninum, 1.259 for A. cantonensis, 0.369 for S. stercoralis, 1.788 for T. saginata, and 0.072 for sparganum antigens. The mean OD was 2.168 for crude O. viverrini and 2.148 for ES O. viverrini antigens. The mean OD for crude O. viverrini antibody was 1.399 for F. gigantica, 0.264 for A. caninum, 0.243 for A. cantonensis, 0.104 for S. stercoralis, 2.103 for T. saginata, and 0.835 for sparganum antigens. The mean OD was 2.370 for crude O. viverrini and 2.648 for ES O. viverrini antigens. In addition, the background of the mean OD against normal rabbit sera was less than 0.05 for all antigens used.

Increase in O. viverrini antigens in livers of O. viverrini-infected hamsters caused by praziquantel.

Figure 1 shows the distribution of O. viverrini antigens in livers of O. viverrini-infected hamsters treated with praziquantel and evaluated using rabbit polyclonal antibody against crude extract of O. viverrini. At 6, 12, and 24 hours, O. viverrini antigens were identified not only in the worm but also in the destructive parasite in the bile duct lumen and bile duct epithelial cells. Intense immunoreactivity of these antigens was observed in the bile duct lumen around the worm at 6 hours. At 6 and 12 hours, O. viverrini antigens were observed in the bile duct epithelium but they decreased by 24 hours. In contrast, antigen was present mainly in the parasite in O. viverrini-infected hamsters not treated with praziquantel (Figure 1C), and other cell types (i.e., damaged liver cells and macrophages) were faintly stained as reported previously.16 In addition, intense immunoreactivity was not observed at 12 hours in the normal control and the normal hamster treated with praziquantel. The same result was obtained by using rabbit polyclonal antibody against ES of O. viverrini.

Effect of praziquantel on histopathologic changes in livers of O. viverrini-infected hamsters.

Figure 2 shows histopathologic changes in livers of O. viverrini-infected hamsters that were treated with praziquantel. After treatment, parasites remained in the bile duct lumen in 100% (10 of 10) of the hamsters at 6 hours and 20% (2 of 10) at 12 hours. The parasite was not found in any hamsters at 24 hours. In O. viverrini-infected hamsters, marked infiltration of inflammatory cells, especially mononuclear cells and eosinophils, was observed around the parasites 6 hours after treatment with praziquantel (Figure 2B and C). Accumulation of inflammatory cells was also observed in inflamed areas surrounding the worm and persisted for 24 hours after drug administration. In addition, only slight infiltration of inflammatory cells was found in periductal areas of O. viverrini-infected hamsters not treated with praziquantel (Figure 2A).

In O. viverrini-infected hamsters treated with praziquantel, increased numbers of mast cells were observed around inflammatory areas (Figure 2G, H, and I) than in O. viverrini-infected hamsters not treated with praziquantel (Figure 2E and F). The number of mast cells observed in the inflammatory areas around bile ducts was 33.44 ± 7.92, 35.88 ± 10.89, and 45.33 ± 11.12 at 6, 12, and 24 hours after drug treatment, respectively. A total of 11.38 ± 1.56 cells were present in O. viverrini-infected hamsters at 0 hours that were not treated with praziquantel. Mast cell degranulation, characterized by a reduced number of intracellular granules, was observed more frequently in inflamed areas of the praziquantel-treated group (Figure 2I) than in those of hamsters not treated with praziquantel (Figure 2F). In contrast, no histologic change was observed in normal control and normal hamsters 12 hours after treatment with praziquantel (Figure 2D).

Effect of praziquantel on expression of iNOS and NF-κB in livers of O. viverrini-infected hamsters.

Figure 3 shows expression of iNOS and NF-κB in livers of hamsters infected with O. viverrini and the effect of praziquantel treatment. Co-localization of iNOS and NF-κB expression was observed in the epithelium of bile ducts and inflammatory cells at 6–24 hours post-treatment (Figure 3). Immunoreactivity of NF-κB was observed mainly in the nucleus, whereas iNOS was observed in the cytoplasm of bile duct epithelial and inflammatory cells in the post-treatment groups. In animals not treated with praziquantel, there was weak immunoreactivity of NF-κB and iNOS in the bile duct epithelium and inflammatory cells. No or weak immunoreactivity of iNOS and NF-κB was observed in the liver of normal hamsters 12 hours after treatment with praziquantel.

Increased iNOS, NF-κB, and antioxidant enzyme mRNA expression in livers of O. viverrini-infected hamsters after praziquantel treatment.

To confirm the expression of iNOS, NF-κB, and antioxidant enzyme genes, we performed RT-PCR with primers designed from homologous regions in published sequences of other species, as shown in Table 1. A high level of sequence conservation of cloned cDNA fragments confirmed their identity. The sequences were compared with published sequences of rat, mouse, and human genes. The cloned hamster sequence showed the greatest homology to rat and mouse sequences, not to human sequence, as summarized in Table 1.

Figure 4 shows the time profiles of mRNA expression of iNOS, NF-κB, and antioxidant enzymes in livers of O. viverrini-infected hamsters after short-term praziquantel treatment. After praziquantel treatment, iNOS mRNA increased 2.45 ± 0.57-, 4.69 ± 1.43-, 166.25 ± 9.21-, and 13.29 ± 6.75-fold for O. viverrini-infected hamsters at 0, 6, 12, and 24 hours post-treatment, respectively, compared with the normal control group at the same time points (1.00 ± 0.19-, 1.07 ± 0.01-, 1.71 ± 0.03-, and 1.71 ± 0.95-fold, respectively). A significant increase in iNOS expression was observed at 12 hours (166.25 ± 9.21-fold; P < 0.001) compared with normal hamsters treated with praziquantel (1.71 ± 0.03-fold) (Figure 4A). In addition, iNOS mRNA expression in normal hamsters treated with praziquantel (1.07 ± 0.01-, 1.71 ± 0.03-, and 1.71 ± 0.95-fold at 6, 12, and 24 hours, respectively) was not different from that in normal controls.

NF-κB mRNA expression increased 1.11 ± 0.14-, 2.13 ± 0.25-, 4.05 ± 0.12-, and 1.41 ± 0.06-fold for O. viverrini-infected hamsters groups at 0, 6, 12, and 24 hours post-treatment, respectively, compared with normal controls at the same time points (1.00 ± 0.25-, 1.27 ± 0.22-, 1.26 ± 0.18-, and 1.37 ± 0.02-fold, respectively). Expression of mRNA significantly increased at 6 hours (2.13 ± 0.25-fold; P < 0.05) and 12 hours (4.05 ± 0.12-fold; P < 0.001) compared with normal hamsters treated with praziquantel (1.26 ± 0.18-fold) (Figure 4B). In addition, NF-κB mRNA expression in normal hamsters treated with praziquantel (1.27 ± 0.22-, 1.26 ± 0.18-, and 1.37 ± 0.02-fold at 6, 12, and 24 hours, respectively) was not different from that in normal controls.

Expression of SOD1, SOD2, SOD3, and CAT genes in livers of O. viverrini-infected hamsters after praziquantel treatment is shown in Figure 4C–F. In O. viverrini-infected hamsters after praziquantel treatment, mRNA expression showed a significant increase for SOD1 (1.85 ± 0.07-fold; P < 0.05), SOD2 (3.24 ± 0.43-fold; P < 0.01), SOD3 (2.35 ± 0.17-fold; P < 0.05), CAT (1.96 ± 0.06-fold; P < 0.01), and GPx (1.25 ± 0.04-fold; P < 0.01) at 12 hours than in normal hamsters treated with praziquantel (1.06 ± 0.22-fold for SOD1, 1.19 ± 0.30-fold for SOD2, 1.11 ± 0.20-fold for SOD3, 1.14 ± 0.18-fold for CAT, and 0.94 ± 0.05-fold for GPx). In addition, mRNA expression of SOD1, SOD2, SOD3, CAT, and GPx genes in normal hamsters 6, 12, and 24 hours after treatment with praziquantel was not different from that in the normal control group.

Changes in biochemical parameters in O. viverrini-infected hamsters and effect of praziquantel treatment.

Figure 5 shows the effect of praziquantel treatment on plasma nitrate level (Figure 5A), MDA (Figure 5B), and FRAP (Figure 5C) in O. viverrini-infected hamsters. After praziquantel treatment, levels of nitrate increased compared with those in normal hamsters 6–24 hours after treatment. Levels of nitrate significantly increased 12 hours (23.66 ± 1.73 μM; P < 0.001) and 24 hours (20.52 ± 1.70 μM; P < 0.05) after treatment with praziquantel compared with levels in normal hamsters after treatment (14.36 ± 1.08 μM at 12 hours and 14.78 ± 0.77 μM at 24 hours). The highest level of plasma nitrate was observed at 12 hours and tended to decrease by 24 hours. In addition, the level of plasma nitrate in O. viverrini-infected hamsters not treated with praziquantel (14.34 ± 1.61 μM) was not different from that in normal controls (13.97 ± 1.08 μM).

Figure 5B shows the effect of praziquantel treatment on the plasma level of MDA, an oxidative biomarker, in O. viverrini-infected hamsters during short-term treatment. After praziquantel treatment, the MDA level in the plasma increased at 6–24 hours post-treatment compared with that in normal hamsters. The MDA levels significantly increased 6 hours (0.68 ± 0.09 μM; P < 0.05), 12 hours (0.92 ± 0.05 μM; P < 0.001), and 24 hours (0.90 ± 0.07 μM; P < 0.01) after treatment compared with levels in normal hamsters post-treatment (0.31 ± 0.02 μM at 6 hours, 0.32 ± 0.02 μM at 12 hours, and 0.30 ± 0.01 μM at 24 hours). The highest level of MDA in the plasma was observed at 12 hours after treatment. In addition, the level of plasma MDA in O. viverrini-infected hamsters not treated with praziquantel (0.55 ± 0.07 μM) was not significantly different from that in normal controls (0.34 ± 0.05 μM).

Figure 5C shows the effect of praziquantel treatment on the plasma level of FRAP in O. viverrini-infected hamsters during short-term treatment. The FRAP level was increased compared with that in normal hamsters at 6–24 hours post-treatment. This level gradually increased 6 hours post-treatment, reached its peak at 12 hours, and then decreased at 24 hours. The FRAP level significantly increased at 12 hours (737.92 ± 50.58 μM; P < 0.001) and 24 hours (678.31 ± 36.76 μM; P < 0.01) compared with that in normal hamsters (423.13 ± 22.85 μM at 12 hours and 507.08 ± 4.33 at 24 hours). In addition, the level of plasma FRAP in O. viverrini-infected hamsters not treated with praziquantel (471.42 ± 47.49 μM) was not significantly different from that in normal controls (356.75 ± 57.57 μM).

DISCUSSION

We have shown that short-term praziquantel treatment induces dispersion of parasite antigens, which induce recruitment of inflammatory cells, including eosinophils and mast cells, and result in expression of iNOS, NF-κB, and antioxidant enzymes related to oxidative and nitrative stress in O. viverrini-infected hamsters. Praziquantel treatment increased iNOS expression and NF-κB activation in the bile duct epithelium and inflammatory cells, which is supported by an increase in plasma levels of nitrate, end products of NO. Immediately after NO is produced it rapidly reacts with superoxide anion (O2·−) to form highly reactive peroxynitrite (ONOO), which mediates nitrative and oxidative damage to cellular components.

Praziquantel may have an indirect effect on inflammatory cell infiltration through O. viverrini antigen-mediated inflammation. Interestingly, after praziquantel treatment, O. viverrini antigen was identified in not only the parasites but also bile duct epithelium around the destructive parasites, and antigen remained only in the parasites in hamsters without drug treatment. Localization of the antigen in hamsters infected with O. viverrini is consistent with results of a previous report.16 These findings suggest that the drug disrupts the surface membrane of the parasite and releases its antigen, which can affect the action of immune cells of the host.22 Localization of parasite antigen was associated with accumulation of inflammatory cells, especially eosinophils and mast cells. These cells migrated close to the tegument of the parasite. This migration was predominately observed starting at 6 hours post-treatment. A parasite antigen-mediated immunologic process may be involved in the side effects of praziquantel, as suggested by results of a previous study.23 Eosinophils and mast cells, which are effective in host defense against parasites, generate free radicals, which are important in the pathogenesis of allergic inflammation.24 In O. viverrini-infected hamsters, antigen was distributed in the bile duct epithelium at 6 hours post treatment, and the expression of iNOS and antioxidant enzymes began to increase at 6 hours and reached maximal levels at 12 hours. These results suggest that praziquantel triggers the release of antigens, which mediate expression of iNOS and antioxidant enzymes. This suggestion is supported by similar mechanisms observed in human schistosomiasis25 and in Schistosoma japonicum-infected mice26 treated with praziquantel. Therefore, praziquantel may show an indirect effect on the accumulation of inflammatory cells around parasites.

Increased NO production may be involved in an indirect effect after short-term praziquantel treatment in O. viverrini-infected hamsters. In this study, we demonstrated that praziquantel induces NF-κB activation and iNOS expression at the transcription and protein levels in livers of O. viverrini-infected hamsters. Increased expression of iNOS mRNA was observed after 12 hours and coincided with expression of SODs.27 We previously reported that O. viverrini infection strongly induces iNOS in bile duct epithelial cells and inflammatory cells.6,7 Activated NF-κB regulates expression of iNOS.28,29 Recently, we reported that O. viverrini antigen induces expression of toll-like reptror 2 (TLR2), which leads to NF-κB-mediated iNOS expression in a macrophage cell line.30 NF-κB was expressed through TLR and related molecules in cultured biliary epithelial cells treated with lipopolysaccharides.31 These findings suggest that antigen released by praziquantel treatment triggers NF-κB-mediated iNOS expression via a TLR-dependent pathway.

Transcription of mRNA of SOD1, SOD2, SOD3, CAT, and GPx increased 12 hours post-treatment and then showed a decrease at 24 hours. Expression of mRNA of antioxidant enzymes was associated with an increase in the plasma level of FRAP, probably because eosinophils and mast cells are accumulated in a short time and generate O2·− and hydrogen peroxide (H2O2), which play an important role in induction of host defense against parasite infection.32 The overproduction of ROS after short-term praziquantel treatment is supported by the increased plasma level of MDA.

Expression of antioxidant enzymes plays a key role in host defense against oxidative stress.33,34 The first line of antioxidant defense to overproduction of O2·− are SODs, which are derived from the cytoplasm (SOD1), mitochondria (SOD2), and extracellular regions (SOD3). Reactive oxygen species may induce NF-κB-mediated SOD2 expression.35 It is speculated that over-expression of SODs mRNA partially protect the liver from injury caused by increased reactive oxygen production.35 Expression of CAT and GPx mRNA was also observed 12 hours after treatment, which suggests that these enzymes induce catalysis of H2O2 into nontoxic substances (H2O and O2). The increase in the expression of these anti-oxidant enzymes in response to oxidative stress is supported by results of a previous study.34 Changes in gene expression of antioxidant enzymes in the liver and phospholipid structure of the cell membrane were accompanied by increases in liver damage in rats infected with Fasciola hepatica.36 Therefore, our data suggest that the host responds to O. viverrini antigen-mediated acute injuries by activating antioxidant enzymes during short-term drug treatment.

In conclusion, the increase in expression of iNOS and NF-κB in response to O. viverrini antigens are induced by short-term praziquantel treatment in relation to oxidative and nitrative stress. In addition, expression of antioxidant enzymes would serve as a defense against oxidative stress. Therefore, this study may provide a basis for subsequent clinical trials in opisthorchiasis to investigate or prevent side effects induced by drug treatment in parasite-endemic areas.

Table 1

Sequences of amplified fragment identities to rat, mouse, and human nucleotides and amino acids

% Nucleotide (% amino acid) identities†
Genes*Sequence (5′ → 3′)cDNA fragment size, basepairsRatMouseHuman
* iNOS = inducible nitric oxide synthase; NF-κB = nuclear factor-κB; SOD1 = superoxide dismutase 1; CAT = catalase; GPx = glutathione peroxidase; GAPDH = glyceraldehyde 3-phosphate dehydrogenase.
† Sequence identities are shown for the portion of the sequence corresponding to the hamster cDNA reported here. The amino acid sequence is deduced from the nucleotide sequence. The GenBank accession numbers used in the sequence comparison of rat, mouse and human were as follows: iNOS, NM_012611.2 (CAA54208.1), NM_010927.1 (AAH62378.1), AF049656 (AAC83553.1); NF-κB, XM_001075876.1 (EDL82271.1), NM_008689.2 (EDL12139.1), (EAX06134.1); SOD1, BC082800.1 (NP_058746.1), BC086886.1 (NP_035564.1), EF151142.1 (AAP36703.1); SOD2, NM_017051.2 (CAA30928.1), NM_008160.5 (AAH86649.1), BC007865.2 (CAA68491.1); SOD3, BC061861.1; CAT, BC081853.1 (EDL79667.1), BC013447.1 (AAH13447.1), BC110398.1 (AAK29181.1); GPx, NM030826.3 (CAA30928.1), NM008160.5 (AAH86649.1), BC007865.2 (CAA68491.1); GAPDH, NW_047470.1(ABD77186.1), XR_033853.1 (XP_001473673.1), and NT_009759 (88_014556). The GenBank accession numbers are shown as nucleotide (protein) database for rat, mouse, and human, respectively.
iNOSCAGAACAGAGGGCTCAAAGGAGGCCGCATGACCTTGGTGTTTGG
 GTGCCGGCACCCAGAGGAGGACCACCTCTATCGGGAAGAGAT
 GCAGGAGATGGCCCACAAGGGAGTGCTGCACCAGGTGCATA
 CAGCCTACTCCAGGCTGCCAGGCAAGCCCAAGGTCTACGTTC
 AAGACATCCTGCAGA18492 (90)91 (85)91 (90)
NF-κBGCTTTGCAAACCTGGGAATACTTCATGTAACTAAGCAAAAGGT
 ATTTGCAACACTGGAGGCCCGGATGACAGAGGCGTGTATA
 CGGGGCTACAATCCTGGACTTCTGGTGCATTCTGACCTTG12391 (95)93 (95)– (92)
SOD1CGGATGAAGAGAGGCATGTTGGGGACCTGGGCAACGTGACTG
 CTGGGAAGGATGGTGTGGCCACTGTGTCCATTGAAGACCCTG
 TGATCTCTCTCTCAGGAGAGCACTCCATCATTGGCCGAACG
 ATGGTGGTCCATGAGAAGCAAGATGACTTGGGCAAAGGTG16591 (94)92 (96)86 (87)
SOD2CCGAGGAGAAGTACCACGAGGCCCTGGCCAAGGGAGATGTT
 ACGACTCAGATTGCTCTTCAACCTGCCCTGAAAGTTCAATGG
 TGGGGGACATATCAATCACAGCATTTTCTGGACAAACCTGAG
 CCCTAATGGTGGTGGAGAGCCCAAAGGAGAGTTGCTGGAGG
 CTATCAAGC17594 (97)93 (94)89 (100)
SOD3GTGCACCAGATAACTCCCTATGATGGAGGTTCCCTCCGTTCTTGAC
 ACTCCACTTTAAGGGCCCTCTGTGTCCCGATAACCACACAAGCC
 CTTAGCATCCCCTTTGAAACAGTCTTTGAGTCTGTTTGCTTCC13397
CATTTGACAGAGAGCGGATTCCTGAGAGAGTGGTGCATGCAAAGGGA
 GCAGGTGCCTTTGGATACTTTGAGGTCACTCACGATATTACCAG
 GTACTGTAAGGCAAAGGTGTTTGAGCACATTGGAAAGAGGA
 CCCCCATTGCCGTTCGATTCTCCACAGTCGCTGGAGAGTCAG
 GCTCAGCT17993 (98)93 (98)84 (94)
GPxGGTTCGAGCCCAACTTTACATTGTTCGAAAAGTGCGAGGTCAATGG
 TGAGAAGGCTCACCCGCTCTTTACCTTCCTGCGGGAGTCCTTGCC
 AGCGCCCAGTGACGACCCGACTGCGCTCATGACCGACCCCAAGT
 ACATCATTTGGTCCCCG15294 (96)92 (94)81 (84)
GAPDHAGAAGACTGTGGATGGCCCCTCCGGGAAGCTGTGGCGTGATGGC
 CGTGGGGCTGCCCAGAACATCATCCCTGCATCCACTGGTGCTG
 CCAAGGCTGTGGGCAAGGTCA10897 (100)98 (100)93 (97)
Figure 1.
Figure 1.

Localization of Opisthorchis viverrini antigens in the liver of O. viverrini-infected hamsters treated with praziquantel. Hamsters were infected with 50 metacercariae of O. viverrini for 3 months and then a single dose of praziquantel (400 mg/kg of body weight suspended in 2% cremophor) was given. After 6 (D), 12 (E), and 24 (F) hours of treatment, animals were killed. Opisthorchis viverrini–infected hamsters were treated with 2% cremophor (C). Normal hamsters were treated with 2% cremophore (A) or praziquantel for 12 hours before analysis (B). Tissue section of hamster liver was stained with rabbit polyclonal anti-crude O. viverrini antibody and visualized using 3,3′-diaminobenzidine solution as a chromogen. (Magnification × 100). OV = O. viverrini, Bd = bile duct. This figure appears in color at www.ajtmh.org.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.564

Figure 2.
Figure 2.

Histopathologic changes in the liver of Opisthorchis viverrini–infected hamsters treated with praziquantel. Hematoxylin and eosin staining (A–C) was performed in the liver of O. viverrini-infected hamsters 6 hours after treatment with praziquantel (B and C), and in hamsters treated with 2% cremophor (A). Six hours after drug administration, eosinophils are accumulated around broken worm (arrowheads) and in an inflamed area (B and C). Aldehyde fuchsin staining (D–I) shows that mast cells are accumulated 6 hours ( G and H) and 12 hours (I) after praziquantel treatment, but only a few mast cells can be seen in O. viverrini-infected hamsters treated with 2% cremophor (E and F) and normal hamster treated with praziquantel for 12 hours (D). Six hours (G and H) and 12 hours (I) after drug treatment, increased accumulation of mast cells was observed around a broken worm and in an inflamed area compared with O. viverrini-infected hamsters treated with 2% cremophore (E and F). The arrowheads (F, H, and I) show mast cells in the inflammatory area. (Magnification × 100 for A, B, E, and G; × 200 for F and H; and × 400 for C, D, and I.) OV = O. viverrini; IC = inflammatory cells; Eo = eosinophils; Mc = mast cells. This figure appears in color at www.ajtmh.org.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.564

Figure 3.
Figure 3.

Effect of praziquantel on expression of inducible nitric oxide synthase (iNOS) and nuclear factor-κB (NF-κB) in livers of Opisthorchis viverrini–infected hamsters. Expression of iNOS and NF-κB in hamster livers was assessed by double immunofluorescence. Opisthorchis viverrini infection induced iNOS expression (red) in the cytoplasm and NF-κB accumulation (green) in the nucleus of bile duct epithelial cells. Treatment with praziquantel gradually increased expression of these proteins 6 hours post-treatment. Expression reached its highest level 12 hours post-treatment and then decreased 24 hours post-treatment. Normal hamsters treated with praziquantel and analyzed 12 hours after treatment (N + PZ, 12 hr) showed weak immunoreactivity. (Magnification × 400; magnification × 200 for N + PZ). OV = O. viverrini; Bd = bile duct. This figure appears in color at www.ajtmh.org.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.564

Figure 4.
Figure 4.

Effect of praziquantel on mRNA expression of inducible nitric oxide synthase (iNOS), nuclear factor-κB (NF-κB), and antioxidant enzymes in livers of Opisthorchis viverrini–infected hamsters. Relative mRNA expression of iNOS (A), NF-κB (B), superoxide dismutase (SOD1) (C), SOD2 (D), SOD3 (E), and catalase (CAT) (F) to glyceraldehyde 3-phosphate dehydrogenase was studied by real-time reverse transcription–polymerase chain reaction analysis. Relative mRNA expression of NF-κB in the livers of O. viverrini-infected hamsters increased significantly 6 hours after treatment with praziquantel, whereas mRNA expression of iNOS, SOD1, SOD2, SOD3, and CAT increased significantly 12 hours post-treatment. The level of mRNA expression of these genes was not changed in normal hamster livers for 6–24 hours post-treatment. Values on the ordinate represent the mean ± SE of three hamsters and the experiment was performed in triplicate. Statistical significance was analyzed using Student’s t-test to compare the O. viverrini-infected hamsters and normal hamsters treated with praziquantel at the same time point. * P < 0.05; **P < 0.01; ***P < 0.001.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.564

Figure 5.
Figure 5.

Effect of praziquantel on biochemical parameters in the plasma of Opisthorchis viverrini–infected hamsters. Plasma levels of nitrate (A), malondialdehyde (MDA) (B), and ferric-reducing antioxidant power (FRAP) (C) were measured as described in the Materials and Methods. A significant increase in praziquantel-treated group is seen 12–24 hours post-treatment for nitrate levels (A), 6–24 hours post-treatment for MDA (B), and 12–24 hours post-treatment for FRAP (C) compared with normal hamster treated with praziquantel at the same time point. Data are means ± SE. The experiment was performed in duplicate. Statistical significance was analyzed using Student’s t-test to compare the 10 O. viverrini-infected hamsters and 5 normal hamsters in each group. *P < 0.05; **P < 0.01; ***P < 0.001.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 78, 4; 10.4269/ajtmh.2008.78.564

*

Address correspondence to Somchai Pinlaor, Department of Parasitology, Faculty of Medicine, Khon Kaen University, Khon Kaen 40002, Thailand. E-mail: psomec@kku.ac.th

Authors’ addresses: Somchai Pinlaor, Suksanti Prakobwong, Butsara Kaewsamut, Thidarut Boonmars, and Paiboon Sithithaworn, Department of Parasitology, and Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002, Thailand, Telephone: 66-43-348-387, Fax: 66-43-202-475. Yusuke Hiraku, Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie, 514-8507, Japan. Somkid Dechakhamphu and Puangrat Yongvanit, Department of Biochemistry, and Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002, Thailand, Telephone: 66-43-348-386. Porntip Pinlaor, Department of Clinical Microbiology, Faculty of Associated Medical Science, and Liver Fluke and Cholangiocarcinoma Research Center, Faculty of Medicine, Khon Kaen University, Khon Kaen, 40002, Thailand. Ning Ma, Department of Anatomy and Developmental Neurobiology Institute of Health Biosciences, The University of Tokushima Graduate School 3-18-15 Kuramoto-cho Tokushima 770-8503, Japan. Shosuke Kawanishi, Department of Environmental and Molecular Medicine, Mie University Graduate School of Medicine, Mie, 514-8507, and Faculty of Health Science, Suzuka University of Medical Science, 1001-1 Kishioka, Suzuka, Mie 510-0293, Japan.

Acknowledgments: We thank Thaweesak Saraboon for technical support and R. H. Andrews for comments on the manuscript while supported by the Faculty of Medicine Khon Kaen University Overseas Visiting Professor Program.

Financial support: This work was supported by the Khon Kaen University Research Fund (grant no. 48-49-03-1-01-01), the Thailand Research Fund (grant no. MRG4880128) in Thailand, and Grants-in-Aid for Scientific Research from the Ministry of Education, Science, Sports and Culture of Japan.

REFERENCES

  • 1

    IARC, 1994. Infection with liver flukes (Opisthorchis viverrini, Opisthorchis felineus and Clonorchis sinensis). IARC Monogr Eval Carcinog Risks Hum 61 :121–175.

    • Search Google Scholar
    • Export Citation
  • 2

    Jongsuksuntigul P, Imsomboon T, 2003. Opisthorchiasis control in Thailand. Acta Trop 88 :229–232.

  • 3

    Ohshima H, Bartsch H, 1994. Chronic infections and inflammatory processes as cancer risk factors: possible role of nitric oxide in carcinogenesis. Mutat Res 305 :253–264.

    • Search Google Scholar
    • Export Citation
  • 4

    Coussens LM, Werb Z, 2002. Inflammation and cancer. Nature 420 :860–867.

  • 5

    Ohshima H, Tatemichi M, Sawa T, 2003. Chemical basis of inflammation-induced carcinogenesis. Arch Biochem Biophys 417 :3–11.

  • 6

    Pinlaor S, Hiraku Y, Ma N, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, Sithithaworn P, Kawanishi S, 2004. Mechanism of NO-mediated oxidative and nitrative DNA damage in hamsters infected with Opisthorchis viverrini: a model of inflammation-mediated carcinogenesis. Nitric Oxide 11 :175–183.

    • Search Google Scholar
    • Export Citation
  • 7

    Pinlaor S, Ma N, Hiraku Y, Yongvanit P, Semba R, Oikawa S, Murata M, Sripa B, Sithithaworn P, Kawanishi S, 2004. Repeated infection with Opisthorchis viverrini induces accumulation of 8-nitroguanine and 8-oxo-7,8-dihydro-2′-deoxy-guanine in the bile duct of hamsters via inducible nitric oxide synthase. Carcinogenesis 25 :1535–1542.

    • Search Google Scholar
    • Export Citation
  • 8

    Pinlaor S, Hiraku Y, Yongvanit P, Tada-Oikawa S, Ma N, Pinlaor P, Sithithaworn P, Sripa B, Murata M, Oikawa S, Kawanishi S, 2006. iNOS-dependent DNA damage via NF-κB expression in hamsters infected with Opisthorchis viverrini and its suppression by the antihelminthic drug praziquantel. Int J Cancer 119 :1067–1072.

    • Search Google Scholar
    • Export Citation
  • 9

    Bunnag D, Pungpark S, Harinasuta T, Viravan C, Vanijanonta S, Suntharasamai P, Migasena S, Charoenlarp P, Riganti M, LooAreesuwan S, 1984. Opisthorchis viverrini: clinical experience with praziquantel in Hospital for Tropical Diseases. Arzneimittelforschung 34 :1173–1174.

    • Search Google Scholar
    • Export Citation
  • 10

    Matsumoto J, Matsuda H, 2002. Mast-cell-dependent histamine release after praziquantel treatment of Schistosoma japonicum infection: implications for chemotherapy-related adverse effects. Parasitol Res 88 :888–893.

    • Search Google Scholar
    • Export Citation
  • 11

    Abend Y, Ashkenazy Y, Witzling V, Feigl D, Geltner D, Moshonov S, Zor U, 1996. Nitric oxide: a mediator in anaphylactic shock in guinea-pigs. J Basic Clin Physiol Pharmacol 7 :57–69.

    • Search Google Scholar
    • Export Citation
  • 12

    Mak JC, Leung HC, Ho SP, Law BK, Lam WK, Tsang KW, Ip MS, Chan-Yeung M, 2004. Systemic oxidative and antioxidative status in Chinese patients with asthma. J Allergy Clin Immunol 114 :260–264.

    • Search Google Scholar
    • Export Citation
  • 13

    Ceylan E, Aksoy N, Gencer M, Vural H, Keles H, Selek S, 2005. Evaluation of oxidative-antioxidative status and the L-arginine-nitric oxide pathway in asthmatic patients. Respir Med 99 :871–876.

    • Search Google Scholar
    • Export Citation
  • 14

    Mitsuhata H, Shimizu R, Yokoyama MM, 1995. Role of nitric oxide in anaphylactic shock. J Clin Immunol 15 :277–283.

  • 15

    Kowluru RA, Kowluru V, Xiong Y, Ho YS, 2006. Overexpression of mitochondrial superoxide dismutase in mice protects the retina from diabetes-induced oxidative stress. Free Radic Biol Med 41 :1191–1196.

    • Search Google Scholar
    • Export Citation
  • 16

    Sripa B, Kaewkes S, 2000. Localisation of parasite antigens and inflammatory responses in experimental opisthorchiasis. Int J Parasitol 30 :735–740.

    • Search Google Scholar
    • Export Citation
  • 17

    Pinlaor S, Sripa B, Sithithaworn P, Yongvanit P, 2004. Hepatobiliary changes, antibody response, and alteration of liver enzymes in hamsters re-infected with Opisthorchis viverrini. Exp Parasitol 108 :32–39.

    • Search Google Scholar
    • Export Citation
  • 18

    Gerard CJ, Olsson K, Ramanathan R, Reading C, Hanania EG, 1998. Improved quantitation of minimal residual disease in multiple myeloma using real-time polymerase chain reaction and plasmid-DNA complementarity determining region III standards. Cancer Res 58 :3957–3964.

    • Search Google Scholar
    • Export Citation
  • 19

    Miranda KM, Espey MG, Wink DA, 2001. A rapid, simple spectrophotometric method for simultaneous detection of nitrate and nitrite. Nitric Oxide 5 :62–71.

    • Search Google Scholar
    • Export Citation
  • 20

    Nowak D, Kalucka S, Bialasiewicz P, Krol M, 2001. Exhalation of H2O2 and thiobarbituric acid reactive substances (TBARs) by healthy subjects. Free Radic Biol Med 30 :178–186.

    • Search Google Scholar
    • Export Citation
  • 21

    Benzie IF, Strain JJ, 1996. The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Anal Biochem 239 :70–76.

    • Search Google Scholar
    • Export Citation
  • 22

    Liu LX, Weller PF, 1996. Antiparasitic drugs. N Engl J Med 334 :1178–1184.

  • 23

    Brindley PJ, Sher A, 1990. Immunological involvement in the efficacy of praziquantel. Exp Parasitol 71 :245–248.

  • 24

    Dean Befus YS, Moon TC, Munoz S, Befus AD, 2005. Role of nitric oxide in mast cells: controversies, current knowledge, and future applications. Immunol Res 33 :223–239.

    • Search Google Scholar
    • Export Citation
  • 25

    Shorter D, Makone I, Elliott EJ, 2006. Fever and urticaria in an African refugee. J Paediatr Child Health 42 :731–733.

  • 26

    Matsumoto J, 2002. Adverse effects of praziquantel treatment of Schistosoma japonicum infection: involvement of host anaphylactic reactions induced by parasite antigen release. Int J Parasitol 32 :461–471.

    • Search Google Scholar
    • Export Citation
  • 27

    Mendes AF, Caramona MM, Carvalho AP, Lopes MC, 2003. Differential roles of hydrogen peroxide and superoxide in mediating IL-1-induced NF-κB activation and iNOS expression in bovine articular chondrocytes. J Cell Biochem 88 :783–793.

    • Search Google Scholar
    • Export Citation
  • 28

    Surh YJ, Chun KS, Cha HH, Han SS, Keum YS, Park KK, Lee SS, 2001. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: down-regulation of COX-2 and iNOS through suppression of NF-κB activation. Mutat Res 480–481 :243–268.

    • Search Google Scholar
    • Export Citation
  • 29

    Balkwill F, Coussens LM, 2004. Cancer: an inflammatory link. Nature 431 :405–406.

  • 30

    Pinlaor S, Tada-Oikawa S, Hiraku Y, Pinlaor P, Ma N, Sithithaworn P, Kawanishi S, 2005. Opisthorchis viverrini antigen induces the expression of Toll-like receptor 2 in macrophage RAW cell line. Int J Parasitol 35 :591–596.

    • Search Google Scholar
    • Export Citation
  • 31

    Miyake H, Sakal I, Harada K, Eto H, Hara I, 2004. Clinicopathological outcome of radical retropubic prostatectomy for 200 men with prostate cancer in a single institution in Japan. Hinyokika Kiyo 50 :151–156.

    • Search Google Scholar
    • Export Citation
  • 32

    McCormick ML, Roeder TL, Railsback MA, Britigan BE, 1994. Eosinophil peroxidase-dependent hydroxyl radical generation by human eosinophils. J Biol Chem 269 :27914–27919.

    • Search Google Scholar
    • Export Citation
  • 33

    Meilhac O, Zhou M, Santanam N, Parthasarathy S, 2000. Lipid peroxides induce expression of catalase in cultured vascular cells. J Lipid Res 41 :1205–1213.

    • Search Google Scholar
    • Export Citation
  • 34

    Ikediobi CO, Badisa VL, Ayuk-Takem LT, Latinwo LM, West J, 2004. Response of antioxidant enzymes and redox metabolites to cadmium-induced oxidative stress in CRL-1439 normal rat liver cells. Int J Mol Med 14 :87–92.

    • Search Google Scholar
    • Export Citation
  • 35

    Murley JS, Kataoka Y, Hallahan DE, Roberts JC, Grdina DJ, 2001. Activation of NFκB and MnSOD gene expression by free radical scavengers in human microvascular endothelial cells. Free Radic Biol Med 30 :1426–1439.

    • Search Google Scholar
    • Export Citation
  • 36

    Kolodziejczyk L, Siemieniuk E, Skrzydlewska E, 2005. Antioxidant potential of rat liver in experimental infection with Fasciola hepatica. Parasitol Res 96 :367–372.

    • Search Google Scholar
    • Export Citation
Save