• View in gallery

    Least-squares means of visual count of mosquitoes around birds over time, after controlling for variance between phases and replicates within a phase. Counts were square-root transformed. Values that do not share a letter are significantly different from each other (α = 0.05), after using Tukey’s adjustment for pairwise comparisons.

  • View in gallery

    Interaction between experiment phase (x axis) and status of bird (control or treatment) as a predictor of total defensive behaviors. Treatment birds were infected during the infection phase; all birds were healthy at all other times. Behavior counts are given as least-squares means to evaluate behavior after controlling for mosquito density, replicate number, and cage position. Behaviors were square root-transformed to improve homoskedacity. Using the Bonferroni correction, differences were considered significant if α < 0.0167.

  • View in gallery

    Interaction between experiment phase (x axis) and status of bird (control or treatment) as a predictor of head movements. Treatment birds were infected during the infection phase: all birds were healthy at all other times. Head movements per minute are given as least-squares means after accounting for mosquito density and time. Using the Bonferroni correction, differences were considered significant if α < 0.0167.

  • View in gallery

    Blood-feeding patterns of Cx. p. pipiens on control and treatment on house finches (raw data). Treatment birds were infected with M. gallisepticum during the infection phase. Mosquitoes that fed on both birds were excluded from this graph.

  • 1

    CDC, 1999. Outbreak of West Nile-like encephalitis—New York, 1999. MMWR Morb Mortal Wkly Rep 48 :845.

  • 2

    CDC, 2000. Update: West Nile Virus activity—Eastern United States, 2000. MMWR Morb Mortal Wkly Rep 49 :1044–1047.

  • 3

    CDC, 2002. West Nile Virus activity—United States, 2001. MMWR Morb Mortal Wkly Rep 31 :497–501.

  • 4

    CDC, 2003. West Nile virus activity—United States, November 6–12, 2003. MMWR Morb Mortal Wkly Rep 52 :1105–1106.

  • 5

    Goddard LB, Roth AE, Reisen WK, Scott TW, 2002. Vector competence of California mosquitoes of West Nile virus. Emerg Infect Dis 8 :1385–1391.

    • Search Google Scholar
    • Export Citation
  • 6

    Turell MJ, Dohn DJ, Sardelis MR, O’Guinn ML, Andreadis TG, Blow JA, 2005. An update on the potential of North American mosquitoes (Diptera: Culicidae) to transmit West Nile virus. J Med Entomol 42 :57–62.

    • Search Google Scholar
    • Export Citation
  • 7

    Apperson CP, Harrison BA, Unnasch TR, Hassan HK, Irby WS, Savage HM, Aspen SE, Watson DW, Rueda LM, Engber BR, Nasci RS, 2002. Host-feeding habits of Culex and other mosquitoes (Diptera: Culicidae) in the borough of Queens in New York City, with characters and techniques for identification of Culex mosquitoes. J Med Entomol 39 :777–785.

    • Search Google Scholar
    • Export Citation
  • 8

    Apperson CS, Hassan HK, Harrison BA, Savage HM, Aspen SE, Farajollahi A, Crans W, Daniels TJ, Falco RC, Benedict M, Anderson M, McMillen L, Unnasch TR, 2004. Host feeding patterns of established and potential mosquito vectors of West Nile virus in the Eastern United States. Vector Borne Zoonotic Dis 4 :71–82.

    • Search Google Scholar
    • Export Citation
  • 9

    Molaei G, Andreadis TG, Armstrong PM, Anderson JF, Voss-brinck CR, 2006. Host feeding patterns of Culex mosquitoes and West Nile virus transmission, northeastern United States. Emerg Infect Dis 12 :468–474.

    • Search Google Scholar
    • Export Citation
  • 10

    Komar N, Langevin S, Hinten S, Nemeth N, Edwards E, Hettler D, Davis B, Bowen R, Bunning M, 2003. Experimental infection of North American birds with the New York 1999 strain of West Nile Virus. Emerg Infect Dis 9 :311–322.

    • Search Google Scholar
    • Export Citation
  • 11

    Godsey MS Jr, Blackmore MS, Panella NA, Burkhalter K, Gott-fried K, Halsey LA, Rutledge R, Langevin SA, Gates R, La-monte KM, Lambert A, Lanciotti RS, Blackmore CGM, Loy-less T, Stark L, Oliveri R, Conti L, Komar N, 2005. West Nile Virus epizootiology in the southeastern United States, 2001. Vector Borne Zoonotic Dis 5 :82–89.

    • Search Google Scholar
    • Export Citation
  • 12

    Woolhouse MEJ, Dye C, Etard J-F, Smith T, Charlwood JD, Garnett GP, Hagan P, Hii JLK, Ndhlovu PD, Quinnell RJ, Watts CH, Chandiwana SK, Anderson RM, 1997. Heterogeneities in the transmission of infectious agents: implications for the design of control programs. Proc Natl Acad Sci USA 94 :338–342.

    • Search Google Scholar
    • Export Citation
  • 13

    Scott TW, Githeko AK, Fleisher A, Harrington LC, Yan G, 2006. DNA profiling of human blood in anophelines from lowland and highland sites in western Kenya. Am J Trop Med Hyg 75 :231–237.

    • Search Google Scholar
    • Export Citation
  • 14

    Day JF, Edman JD, 1983. Malaria renders mice susceptible to mosquito feeding when gametocytes are most infective. J Parasitol 69 :163–170.

    • Search Google Scholar
    • Export Citation
  • 15

    Day JF, Ebert KM, Edman JD, 1983. Feeding patterns of mosquitoes (Diptera: Culicidae) simultaneously exposed to malarious and healthy mice, including a method for separating blood meals from conspecifics hosts. J Med Entomol 20 :120–127.

    • Search Google Scholar
    • Export Citation
  • 16

    Coleman RE, Edman JD, Semprevivo LH, 1988. Interactions between malaria (Plasmodium yoelli) and leishmaniasis (Leishmania mexicana amazonensis): effective of concomitant infection on host activity, host body temperature, and vector engorgement success. J Med Entomol 25 :467–471.

    • Search Google Scholar
    • Export Citation
  • 17

    Mahon R, Gibbs A, 1982. Arbovirus-infected hens attract more mosquitoes. In: Mackenzie JS, editor. Viral Diseases in SouthEast Asia and the Western Pacific. New York: Academic Press, 502–505.

  • 18

    Turell MJ, Bailey CL, Rossi CA, 1984. Increased mosquito feeding on Rift Valley Fever virus-infected lambs. Am J Trop Med Hyg 33 :1232–1238.

    • Search Google Scholar
    • Export Citation
  • 19

    Lacroix R, Mukabana WR, Gouagna LC, Koella JC, 2005. Malaria infection increases attractiveness of humans to mosquitoes. PLoS Biol 3 :1590–1593.

    • Search Google Scholar
    • Export Citation
  • 20

    Reisen WK, Fang Y, Martinez VM, 2005. Avian host and mosquito (Diptera: Culicidae) vector competence determine the efficiency of West Nile and St. Louis encephalitis virus transmission. J Med Entomol 42 :367–375.

    • Search Google Scholar
    • Export Citation
  • 21

    Hochachka WM, Dhondt AA, 2000. Density-dependent decline of host abundance resulting from a new infectious disease. Proc Natl Acad Sci USA 97 :5303–5306.

    • Search Google Scholar
    • Export Citation
  • 22

    Ley DH, Berkhoff JE, McLaren JM, 1996. Isolation of Mycoplasma gallisepticum from eastern house finches with conjunctivitis. Avian Dis 30 :480–483.

    • Search Google Scholar
    • Export Citation
  • 23

    Fischer JR, Stallknecht DE, Luttrell MP, Dhondt AA, Converse KA, 1997. Mycoplasmal conjunctivitis in wild songbirds: the spread of a new contagious disease in a mobile host population. Emerg Infect Dis 3 :69–72.

    • Search Google Scholar
    • Export Citation
  • 24

    Dhondt AA, Tessaglia DL, Slothower RL, 1998. Epidemic mycoplasmal conjunctivitis in house finches from eastern North America. J Wildl Dis 34 :265–280.

    • Search Google Scholar
    • Export Citation
  • 25

    Dhondt AA, Badyaev AV, Dobson AP, Hawley DM, Driscoll MJL, Hochachka WM, Ley DH, 2006. Mycoplasmal conjunctivitis spreads more slowly in native than in introduced range of the host. EcoHealth 3 :95–102.

    • Search Google Scholar
    • Export Citation
  • 26

    Kollias GV, Sydenstricker KV, Kollias HW, Ley DH, Hosseini PR, Connolly V, Dhondt AA, 2004. Experimental infection of house finches with Mycoplasma gallisepticum. J Wildl Dis 40 :79–86.

    • Search Google Scholar
    • Export Citation
  • 27

    Seutin G, White BN, Boag PT, 1991. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool 69 :82–90.

  • 28

    Darbro JM, Harrington LC, 2007. Avian defensive behavior and blood-feeding success of the West Nile vector mosquito, Culex pipiens. Behav Ecol 18 :750–757.

    • Search Google Scholar
    • Export Citation
  • 29

    Hawley DM, 2005. Isolation and characterization of eight micro-satellite loci from the house finch (Carpodacus mexicanus). Mol Ecol Notes 5 :443.

    • Search Google Scholar
    • Export Citation
  • 30

    Edman JD, Cody E, Lynn H, 1975. Blood-feeding activity of partially engorged Culex nigripalpus (Diptera: Culicidae). Entomol Exp Appl 18 :261–268.

    • Search Google Scholar
    • Export Citation
  • 31

    SAS Institute, 1998. User’s Manual, version 8.0 Cary (NC): SAS Institute.

  • 32

    Kenward MG, Roger JH, 1997. Small sample inference for fixed effects from restricted maximum likelihood. Biometrics 53 :938–997.

  • 33

    Webber LA, Edman JD, 1972. Anti-mosquito behaviour of cico-niiform birds. Anim Behav 20 :228–232.

  • 34

    Allan SA, Bernier UR, Kline DL, 2006. Laboratory evaluation of avian odors for mosquito (Diptera: Culicidae) attraction. J Med Entomol 43 :225–231.

    • Search Google Scholar
    • Export Citation
  • 35

    Russell CE, Hunter FF, 2005. Attraction of Culex pipiens/restuans (Diptera: Culicidae) mosquitoes to bird uropygial gland odors at two elevations in the Niagara region of Ontario. J Med Entomol 42 :301–305.

    • Search Google Scholar
    • Export Citation
  • 36

    Scott TW, Edman JD, Lorenz LH, Hubbard JL, 1988. Effect of disease on vertebrates’ ability behaviorally to repel host-seeking mosquitoes. Misc Publ Entomol Soc Am 68 :9–17.

    • Search Google Scholar
    • Export Citation
  • 37

    Edman JD, Scott TW, 1987. Host defensive behaviour and the feeding success of mosquitoes. Insect Sci Appl 8 (4–6):617–622.

  • 38

    Anderson RA, Brust RA, 1996. Blood feeding success of Aedes aegypti and Culex nigripalpus (Diptera: Culicidae) in relation to defensive behavior of Japanese quail (Coturnix japonica) in the laboratory. J Vect Ecol 21 :94–104.

    • Search Google Scholar
    • Export Citation
  • 39

    Hodgson JC, Spielman A, Komar N, Krahforst CF, Wallace GT, Pollack RJ, 2001. Interrupted blood-feeding by Culiseta melanura (Diptera: Culicidae) on European starlings. J Med Entomol 38 :59–66.

    • Search Google Scholar
    • Export Citation

 

 

 

 

 

Mycoplasma gallisepticum Infection in House Finches (Carpodacus mexicanus) Affects Mosquito Blood Feeding Patterns

View More View Less
  • 1 Department of Entomology, Cornell University, Ithaca, New York; Laboratory of Ornithology, Cornell University, Ithaca, New York; Cornell Statistical Consulting Unit, Cornell University, Ithaca, New York

Disease-induced lethargy can diminish host capacity to repel or kill biting mosquitoes. We exposed house finches (Carpodacus mexicanus) to mosquitoes (Culex pipiens pipiens), repeated the experiment after inoculating finches with Mycoplasma gallisepticum, and then repeated the experiment with the same birds after curing their infections. We videotaped avian behaviors before and during mosquito exposure, identifying hosts through blood meal DNA fingerprinting. Results revealed heterogeneity in mosquito preference regardless of infection. Mosquitoes choosing between two healthy finches were more likely to feed upon the same individual bird consistently. When one bird was sick, mosquitoes exhibited no preference. Sick birds made fewer total defensive behaviors than healthy birds, but only foot stomps were associated with reduced mosquito feeding success. Our results suggest that Mycoplasma and other avian infections that alter bird defensive behavior may influence mosquito feeding patterns and transmission of arthropod-borne pathogens such as West Nile virus.

INTRODUCTION

West Nile virus (WNV) was first detected in New York City in 19991 and quickly spread across the continental United States.24 WNV is primarily transmitted by Culex mosquitoes.5,6 Two primary Culex vectors in the northeastern United States, Culex pipiens pipiens L. and Culex restuans Theobald, feed largely on passerine birds.79 Susceptible passerine birds are thought to serve as amplifying hosts for WNV.10,11 This system may represent the primary enzootic cycle of WNV, yet little is understood about the ecology of mosquito–bird interactions in nature and how fine scale dynamics of vector–host–pathogen interactions can influence WNV transmission.

Heterogeneities in vector–host contact may affect the distribution of WNV transmission foci, just as 20% of host populations may be responsible for up to 80% of transmission of other vector-borne pathogens.12 One such pattern was reported in Kenya, where < 20% of human hosts contributed to > 50% of mosquito blood meals.13 One potential difference among hosts is illness. Host infections and illness can influence vector–host contact by increasing vector attraction (e.g., by fever) or decreasing host behavioral capacity to repel blood-seeking vectors. Mice infected with Plasmodium spp.14,15 or Leishmania mexicana amazonensis16 exhibited fewer defensive behaviors, which allowed more mosquitoes to feed successfully than on uninfected mice. Mosquitoes also fed more successfully on chickens infected with Sindbis virus17 and lambs infected with Rift Valley Fever virus.18 Furthermore, children were more attractive to malaria vectors when infected with Plasmodium falciparum parasites than when uninfected.19 Avian pathogens such as WNV may similarly manipulate hosts by increasing probability of contact with vectors.

House finches (Carpodacus mexicanus) are potentially important reservoir hosts of WNV due to high viremia10,20 and their tendency to aggregate near human populations. House finches were introduced in Long Island, NY, in the 1940s from California and by 1995 had spread west to join native populations.21 An outbreak of conjunctivitis in United States house finch populations in 1994 was caused by a Mycoplasma gallisepticum strain not previously reported as pathogenic to finches.22 By 1996, mycoplasmal conjunctivitis had been reported throughout the eastern population of house finches in the United States23,24 and into its western native range.25 Besides causing conjunctivitis in house finches, M. gallisepticum also causes diminished motor activity,26 suggesting that house finches infected with M. gallisepticum may be more susceptible to biting mosquitoes. In this case, one emerging infectious disease may facilitate transmission of a second emerging infectious disease in an exotic host.

In this study, we compared antimosquito defensive behavior of healthy house finches to those infected with M. gallisepticum to determine: (1) if sick birds exhibited less vigorous antimosquito defensive behavior, and (2) if Cx. p. pipiens, an enzootic vector of WNV, had greater blood-feeding success on sick finches than healthy finches.

MATERIALS AND METHODS

Mosquitoes.

We used Cx. p. pipiens larvae from a colony established with wild-captured mosquitoes in New York State in 2003 and augmented with wild material annually. Larvae were reared at 25°C in water-filled plastic trays with 200 larvae per liter. Diet slurry (60 mL) was added (1:2:1 ratio of ground fish food [TetraMin, Blacksburg, VA]: rabbit pellets [L/M Classic Blend Rabbit Food, Secaucus, NJ]: liver powder [ICN Biomedicals, Inc., Aurora, OH]). We placed pupae into 7.6-L cages with cloth mesh covers so adults in each experiment eclosed within a 24-hour period. Adults fed on 20% sucrose solution during the first 5 days of the holding period. On Days 6 and 7, mosquitoes fed only on water. Six days after emergence, we anaesthetized mosquitoes by placing the cage in a −20°C freezer for 3 min and transferred 100 females to clean, empty 7.6-L cages. On Day 7, we confirmed the number of live females per cage before beginning the experiment.

House finches.

We used six captive female house finches (F1 reared from adults captured in the Ithaca, NY, area), > 1 year of age without prior exposure to M. gallisepticum. We divided the finches into 3 pairs that remained the same throughout the experiment. To minimize stressful effects of new surroundings, we kept the finches in individual cages 1 week before the first trial began. All house finch handling and care was approved by the Cornell University Institute of Animal Care and Use Committee (Protocols 04–45 and 00–90–93). Before trials began, we collected 200 μL of blood via brachial venipuncture to determine DNA profiles for each bird. Blood was stored in lysis buffer until DNA extraction.27 DNA was extracted using Perfect gDNA Blood Mini Isolation Kit (Ep-pendorf, Westbury, NY). We assigned birds in pairs, based on their profiles, to ensure that individual birds within each pair had unique microsatellite DNA signatures.

M. gallisepticum.

Inoculation of finches with M. gallisepticum and subsequent treatment were conducted as previously described.26 After completion of infection trials, finches received a treatment combination therapy of tylosin tartrate (Tylan, Eli Lilly Co., Indianapolis, IN) in water for 21 days and topically applied oxytetracycline hydrochloride with polymixin B sulfate (Terramycin, Pfizer, Exton, PA) once daily for 5 days. After Day 21, all finches were confirmed free of infection by testing conjunctival samplings for M. gallisepticum using PCR.

Experimental apparatus.

We conducted all trials in an observation cage (2.4 m × 1.2 m × 1.2 m) constructed with a wooden frame covered with fiberglass and aluminum screen (New York Wire, Mt. Wolf, PA).28 Within the observation cage, we placed two bird cages (30 cm × 30 cm × 60 cm) on the floor, at least 50 cm apart to prevent direct transmission of M. gallisepticum. We recorded avian behaviors with a Sony 1/2″ (13 mm) Super HAD CCD Sensor Color Cameras (Liberty Hill, TX) with built-in infrared illuminators. Data loggers (HOBO, Onset Corporation, Bourne, MA) recorded temperature (mean = 22.6 ± 1.0°C) and relative humidity hourly (mean = 23.5% ± 0.1%).

Experimental procedures.

At 1900 hr, one bird was placed into each birdcage within the observation enclosure. A 7.6-L bucket (with cover) containing 100 7-day-old female mosquitoes was placed on the floor between the birdcages. Videotaping began 30 min before mosquito release to record avian behavior in absence of mosquito attack. We released mosquitoes after sundown (8:30 pm) by pulling a string tied to the lid from outside the cage. At 8:00 am the next morning, we aspirated live mosquitoes from the cage with a battery-powered aspirator and removed dead mosquitoes from the cage (and from analysis).

Each pair of birds was used in 2 trials (total = 6 trials). During the second replicate, we switched the relative locations of the birdcages to control for location effects.

After six pre-infection experiments, one bird from each pair was randomly selected and inoculated with M. gallisepticum. After birds developed visible conjunctivitis,26 in ≈ 14 days, we repeated the experiment. The same bird was infected for each replicate. After completion of infection experiments, birds were treated for M. gallisepticum as described above.

Blood meal analysis.

Bird DNA from engorged and partially engorged mosquitoes was extracted using DNAzol (In-vitrogen, Carlsbad, CA). Microsatellite loci were amplified by PCR following the methods of Hawley29 (Table 1). Each 10- μL PCR reaction contained 1.0 μL of GeneAmp (Applied Biosystems, Branchburg, NJ), 10× PCR buffer (100 mM Tris-HCl, pH 8.3, 500 mM KCl, 0.01% [wt/vol] gelatin), 0.8 μL 50 L 25 mM dNTPs (Invitrogen), 0.5 μL of 5 mM MgCl2, 0.2 μU/μL Platinum Taq polymerase (Invitrogen), and 0.125 μL of 0.25 or 0.50 mM forward and reverse primers (Table 1); one primer was fluorescently labeled at the 5′ end with VIC, PET, or NED (Applied Biosystems, Branchburg, NJ). Samples were initially denatured at 90°C for 2 min, followed by 35 cycles of 50 s at 95°C, 60 s at the locus-specific optimal annealing temperature (see Table 1), and 60 s at 72°C, followed by final extension (4.5 min) at 72°C.

We used an ABI Prism 3100 Genetic Analyzer (Applied Biosystems, Foster City, CA) to analyze labeled fragments, and estimated allele sizes using Genemapper v3.0 (Applied Biosystems, Foster City, CA). Each bird pair was distinguished using 3–4 alleles across 2 loci, depending on which pair of loci provided the best distinction.

Data collection.

We visually characterized all mosquitoes as non blood-fed (NBF, no blood in abdomen), partially blood-fed (PBF, < 50% abdomen with blood), or fully blood-fed (FBF, > 50% abdomen with blood). This classification scheme was chosen based on results with Culex nigripalpus Theobald,30 where females with PBF blood meals or less usually attempted to refeed within 30 seconds of interruption. Mosquitoes not recovered were considered eaten by birds.

We recorded avian behavior for 30 min before mosquito release and 6 hours afterward. We recorded and categorized all pre-mosquito exposure behaviors (Table 2) during the viewing of the 30-min prerelease footage. After mosquito release, we viewed 15 min of each hour for the entire video footage. Observations of complete footage from selected trials demonstrated that this sampling regimen was representative of the entire footage.28

We estimated “mosquito density” by visually counting mosquito numbers flying, walking, or resting in proximity (< 15 cm) to the bird for each 15-min scoring period and reporting maximum counts.

Data analysis.

Predictors of mosquito density.

Mosquito density was analyzed using a mixed model (PROC MIXED, SAS v9.0, Cary, NC)31 with mosquito counts as the dependent variable. Main effects of interest included experimental phase (pre-infection, infection, post-treatment), status (control, infected), cage location (left, right), temperature, and humidity. For mixed models, all 2-way interactions of these main interest variables were tested. Bird pair, individual bird within each pair (designated bird × pair), and bird × pair × replicate × phase were random variables.

For all linear models, we removed predictors from the model if Type III P values were > 0.05 and there were no significant pairwise comparisons in class variables. Variables not meeting assumptions of normal distribution or equal variance were square-root–transformed. Degrees of freedom were calculated using the Kenward–Rogers method.32 Multiple comparisons of class variables were evaluated using the Bonferroni correction.

Predictors of total finch behavior.

House finch behavior was analyzed using a mixed model (PROC MIXED) with total behaviors as the dependent variable. We also tested fixed main effects in the initial model, including experimental phase, status, cage location, mosquito density, temperature, humidity, and all 2-way interactions. We tested random variables as above. We were particularly interested in comparisons between control and treatment birds for each experimental phase.

Analysis of individual defensive behavior types.

To determine if certain defensive behavior types were over- or under-represented in sick birds, we constructed a mixed model (PROC MIXED) for each behavior type. Numbers of each behavior type were the dependent variables. The predictor of interest was the interaction between experiment phase and bird status. We tested main effects, interactions, and random variables as described to determine total defensive behaviors.

Analysis of mosquito blood feeding pattern.

We evaluated blood-feeding preference in each experiment using the difference in proportion of mosquitoes that fed on the treatment bird minus the proportion of mosquitoes that fed on the control bird. The assumptions for parametric tests were evaluated for these differences, and then differences were used as dependent variables in a general linear model (PROC MIXED). The predictor of interest was experimental phase. Other variables included replicate number, cage location of the control bird (to test for location effects), average temperature, average humidity, and defensive behavior. We estimated defensive behaviors per trial as either total behaviors or average behaviors per viewing period.

RESULTS

Mosquito density.

Exposure time, experiment phase, and replicate number affected mosquito density. The number of visible mosquitoes diminished throughout the night (Figure 1) as mosquitoes obtained blood meals. During the first hour of the trial, 4.6 ± 0.4 mosquitoes were counted around the bird, and this number decreased to 1.6 ± 0.2 mosquitoes by the sixth hour. According to a mixed model, the only significant predictors detected were time (F5,163 = 43.46, P < 0.0001, Figure 1) and random variation within individual birds between experiments (Z = 2.95, P = 0.0016). Variation in temperature, bird weight, and cage position did not contribute significantly to variation in mosquito density.

Behavior analysis.

When under mosquito attack, birds exhibited certain behaviors rarely observed during control periods. We observed 11,723 individual defensive behaviors (Table 2) over 36 finch-nights. Categories of behaviors remained similar to those described for ciconiiform birds33 and for house sparrows28; consequently, we used similar names and descriptions. Over 60% of total defensive behaviors consisted of head movements, foot stomps, and wing movements.

Bird weight and temperature did not have significant effects on total behavior in our mixed model (Table 3). These variables were removed from the final model. Variation between bird pairs (Z = 0.90, P > 0.18) and individual birds within pairs (Z = 0.006, P = 0.24) were not significant components of random variance, but there was significant variation in individual pairs within pairs over repeated trials (Z = 2.29, P = 0.0110). Main effects of time, experimental phase, and bird status (over all phases) were not significant but were retained in the model because of significant interaction terms. There was a significant positive correlation between finch behavior and mosquito density (t = 5.81, df = 190, P < 0.0001). The effect of mosquito density on behavior increased over time (t = 2.64, df = 179, P = 0.009). After controlling for other variables, finches in the left cage displayed significantly fewer behaviors as opposed to finches in the right cage (t = − 2.54, df = 25.8, P < 0.0175).

The interaction between experiment phase and status was not significant overall (F = 0.99, df = 24.7, P > 0.38), but there were significant pairwise comparisons. Defensive behavior was similar between control and treatment birds in pre-infection (P > 0.37) and post-treatment (Adj. P > 0.12) phases, but during the infection phase the control birds exhibited significantly more behaviors than the infected bird (P < 0.0106). Furthermore, behaviors between pre-infection and post-infection phases were similar (Figure 2).

Analysis of individual defensive behavior types.

We evaluated four common individual defensive behavior types: head movements, foot stomps, wing movements, and whole-body movements (Table 2). Head movements followed similar patterns as total defensive behaviors. Control and treatment finches displayed similar head movement rates during pre-infection (Adj. P > 0.15) and post-treatment (P > 0.63) phases. Treatment finches displayed significantly lower head movement rates than control birds during infection (estimate = −1.4861 ± 0.4938, df = 28.3, t = 3.01, Adj. P < 0.017; Figure 3). Other significant predictors are listed in Table 4. Although treatment birds during the infection phase tended to have fewer foot stomps than control birds, the trend was not significant (estimate = −0.4630 ± 0.1859, df = 26.3, t = 0.49, Adj. P = 0.0582). There was no difference between control and treatment birds for whole-body movements or wing movements.

Blood meal analysis.

We collected 1,447 blood-fed mosquitoes (1,387 full blood meals and 60 partial blood meals), representing 84.4% ± 3.7% of mosquitoes originally released into the cage. Of these, 1,355 (93.6%) were identified to individual host. Strong host preference was indicated in pre-infection and post-treatment trials. Mosquitoes fed on both hosts equally during infection trials (Figure 4). General linear model results confirmed that treatment birds were fed upon more often in pre-infection (t = 6.603, df = 6.07, P = 0.0008) and post-treatment (t = 4.02, df = 6.24, P = 0.0064) phases, but mosquitoes fed equally on hosts in infection phases (t = 0.06, df = 6.48, P > 0.95). Differences in foot stomp rate (treatment - control) were negatively correlated with differences in mosquito feeding rates for all experimental phases (b = −0.02517 ± 0.007568, df = 13.6, t = −3.33, P = 0.0052, partial R2 = 0.46), suggesting that more defensive birds were fed upon less often.

Total number of defensive behaviors and other individual behavior types were not significant predictors of mosquito host selection. Other variables (temperature, variation between pairs of finches, cage position, replicate number, and differences in bird weight) did not show significant effects on mosquito feeding preference. Variation between bird pairs was not a significant component of random variance (Z = 0.47, P > 0.31).

We detected DNA from both birds in 143 (9.9%) of analyzed blood meals. No variables were found to explain significant variation in the frequency of double meals within full blood meals. Results yielded 60 (4.1% of total) partial blood meals. Of these, 34 contained DNA from a single host, and 4 represented double blood meals. Of single-host blood meals, no significant difference was found between mosquito feeding preference with partial blood meals (a potential indicator of effective host defensive behavior) and feeding preference of replete blood meals (χ2 = 1.815, df = 1, P > 0.17).

DISCUSSION

We tested the ability of disease to affect house finch anti-mosquito defensive behavior and mosquito blood feeding success. Mosquitoes were often (> 80%) able obtain a replete blood meal from at least 1 house finch despite defensive activity, reinforcing the notion that house finches may be important reservoirs of WNV in nature if continually permissive to mosquito feeding activity. We present behavior data demonstrating that house finches symptomatic for M. gallisepticum exhibited fewer total defensive behaviors (compared with control birds) against Cx. p. pipiens. Of all defensive behaviors, only foot stomps were associated with reduced mosquito blood feeding success. We expected that equal numbers of mosquitoes would feed upon two healthy, equally defensive house finches. On the contrary, one bird was consistently fed upon at higher rates. More surprising, results showed that equal numbers of mosquitoes fed on each bird after one bird was infected. It is not clear why one healthy bird was consistently fed upon more than another, though we controlled for sex, age, size, and behavior. Intraspecific heterogeneity in songbirds in nature could increase vector-borne transmission.12 Intraspecific heterogeneity in attractiveness, such as we observed in house finches, may further amplify the complexity of WNV transmission.

Though mosquitoes fed more frequently on treatment birds, they fed equally between control and treatment birds when treatment birds were infected with M. gallisepticum. This result suggests that infected birds were less attractive to mosquitoes than when they were healthy, a finding in direct opposition to the hypothesis that less defensive birds are fed upon more frequently. This is the first study to our knowledge showing that mosquitoes are less likely to feed upon sick birds. Because sick birds do not defend themselves better than healthy birds, they may instead emit volatiles not present in healthy birds that are repellent to mosquitoes. Culex mosquitoes have been found to be attracted to certain bird volatiles, notably feathers34 and uropygial glands.35 Differences in skin or feather volatiles may also contribute to the heterogeneity found in pre-infection and post-treatment trials. It is important to note that M. gallisepticum is a bacterium, not an arbovirus, and it produces conjunctivitis not present in avian arboviral disease. Studies to see if mycoplasmal conjunctiva contain unique volatiles would be interesting. We are not aware of studies evaluating arbovirus infection and mosquito-feeding success in house finches, although Cx. p. quinquefasciatus Say and Culex tarsalis Coquillett were equally attracted to house sparrows (Passer domesticus) with and without St. Louis encephalitis virus (SLEV) infection.36 Edman and Scott37 found that house sparrows infected with SLEV and western equine encephalitis virus were no less defensive against Cx. tarsalis than were uninfected sparrows. Olfacto-meter studies with finches are warranted, as are studies evaluating the effect of WNV infection on blood-feeding success.

Anderson and Brust38 found that Aedes aegypti L. consistently fed upon the less defensive of two Japanese quail (Coturnix japonicus). In the current study, defensive behavior played a significant but minor role on mosquito feeding patterns. Foot stomps, though representing only 20.5% of total defensive behaviors, were associated with reduced mosquito blood feeding success. Head movements, on the other hand, were significantly reduced in sick birds but had no effect on mosquito blood feeding success. Most mosquitoes appeared to attack the feet and legs of the bird, so it is not surprising that foot stomps would reduce mosquito blood feeding success. It is not clear why head movements did not affect mosquito feeding success. The head may present a less attractive target for mosquitoes, possibly due to the bird moving its head more vigorously in response to host-seeking mosquitoes or the head being better protected with feathers.

The presence of double and partial blood meals may represent changes in rates of interrupted feeding due to disease-induced changes in host defensive behavior. Culiseta melanura (Coquillett) were found to take small, multiple blood meals from European starlings (Sturnus vulgaris) and larger meals from American robins (Turdus migratorius), possibly because starlings are more defensive than robins.39 Our results did not support this hypothesis for finches: of the blood meals we analyzed, regardless of infection status, 10% were double blood meals and 4% were partial blood meals.

This study is the first to use polymorphic microsatellite bird DNA markers to assess the effect of an avian pathogen on mosquito blood feeding patterns. We demonstrated that M. gallisepticum, an emerging disease in wild house finch populations in the United States, decreases defensive behavior and is associated with reduced feeding preference by Cx. p. pipiens. Our results reveal the complexity of interactions between hosts, vectors, and pathogens, especially for introduced species. House finches and West Nile virus are both exotic to the eastern United States, and M. gallisepticum is exotic to house finches. All three species have expanded successfully throughout their new ranges. We also report high degrees of heterogeneity in mosquito feeding preferences between healthy house finches, a result that has implications for the host competence of house finches or other passerines in their role as amplifying reservoirs of arboviruses such as West Nile.

Table 1

Microsatellite loci used to identify individual house finch DNA in mosquito blood meals

LocusConcentration (mM)53–33 Primer sequenceTA(°C)No. of alleles (size range)
Hofi-52290.25F:GCGGGAATTCCAGACAAACT
 R:CACTGAACTATGCTGACACTATGA626 (235–268 bp)
Hofi-24290.50F:CTTCAGCCCTTTGCACAGGCAGTTTG
 R:GAGAGCCAACAAACACCCGTCAGTGG643 (122–128 bp)
Lox-2400.50F:CAGGCAGAGTGGACATTTATG
 R:CAGTTTCATGTGGATTTTTAG59.56 (178–235 bp)
Table 2

Frequency distribution of types of defensive behaviors employed by house finches against host-seeking Cx. p. pipiens

BehaviorTotalPercentage of total
* Head shakes, beak snaps, and beak pecks.
† Wing shakes and brief wing “twitches.”
‡ Flights or hops within the bird cge or turning around on the perch.
§ Summation of wing (n = 636), tail (n = 80), and chest (n = 12) pecks.
Head movements*3,76332.1
Wing movements†2,48421.2
Foot stomps2,40820.5
Foot pecks1,0238.7
Movements‡9918.5
Body pecks§7246.2
Tail shakes1881.6
Feather fluffs1301.1
Head scratches80.1
Total11,723100.0
Table 3

Significant main effects predicting total house finch defensive behavior

PredictorEstimateSEdft valueP value*Partial R2
* P values in bold are < 0.05 and considered significant.
† Partial R2 values were calculated by taking the ratio of [1 - (Variance(full model) - Variance(reduced model))]/Variance(full model).
‡ Refers to finches in the infection phase of the experiment, as opposed to during pre-infection or post-treatment phases. Nonsignificant main effects were retained in the model if there was a significant interaction.
§ Refers to control finches as opposed to treatment finches. Treatment finches were infected with M. gallisepticum during the infection phase but were healthy during pre-infection and post-treatment phases.
Experimental phase
    Infection‡0.3420.19123.91.790.087NA
    Pre-infection0.2800.19023.91.470.154NA
Status (control)§0.3490.21412.21.630.130NA
Mosquito density0.1590.0291885.43< 0.00010.34
Cage location−0.2980.11825.8−2.540.0175NA
Time × mosquitoes0.000510.00021792.360.0190.03
Table 4

Significant main effects predicting total house finch head movements

PredictorEstimateSEdft valueP value*Partial R2
* P values in bold are < 0.05 and considered significant.
† Partial R2 values were calculated by taking the ratio of [1 - (Variance(full model) - Variance(reduced model))]/Variance(full model).
‡ Refers to finches in the infection phase of the experiment, as opposed to during pre-infection or post-treatment phases. Nonsignificant main effects were retained in the model if there was a significant interaction.
§ Refers to control finches as opposed to treatment finches. Treatment finches were infected with M. gallisepticum during the infection phase but were healthy during pre-infection and post-treatment phases.
Experimental phase
    Infection‡0.0310.35220.60.090.930NA
    Pre-infection−0.1200.34420.4−3.050.732NA
Status (control)§0.9080.58225.91.560.131NA
Mosquito density0.1330.0471852.790.0060.15
Time × mosquitoes0.007950.0003351782.370.019< 0.01
Figure 1.
Figure 1.

Least-squares means of visual count of mosquitoes around birds over time, after controlling for variance between phases and replicates within a phase. Counts were square-root transformed. Values that do not share a letter are significantly different from each other (α = 0.05), after using Tukey’s adjustment for pairwise comparisons.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 77, 3; 10.4269/ajtmh.2007.77.488

Figure 2.
Figure 2.

Interaction between experiment phase (x axis) and status of bird (control or treatment) as a predictor of total defensive behaviors. Treatment birds were infected during the infection phase; all birds were healthy at all other times. Behavior counts are given as least-squares means to evaluate behavior after controlling for mosquito density, replicate number, and cage position. Behaviors were square root-transformed to improve homoskedacity. Using the Bonferroni correction, differences were considered significant if α < 0.0167.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 77, 3; 10.4269/ajtmh.2007.77.488

Figure 3.
Figure 3.

Interaction between experiment phase (x axis) and status of bird (control or treatment) as a predictor of head movements. Treatment birds were infected during the infection phase: all birds were healthy at all other times. Head movements per minute are given as least-squares means after accounting for mosquito density and time. Using the Bonferroni correction, differences were considered significant if α < 0.0167.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 77, 3; 10.4269/ajtmh.2007.77.488

Figure 4.
Figure 4.

Blood-feeding patterns of Cx. p. pipiens on control and treatment on house finches (raw data). Treatment birds were infected with M. gallisepticum during the infection phase. Mosquitoes that fed on both birds were excluded from this graph.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 77, 3; 10.4269/ajtmh.2007.77.488

*

Address correspondence to Laura C. Harrington, Department of Entomology, Cornell University, 3138 Comstock Hall, Ithaca, NY 14853. E-mail: lch27@cornell.edu

Authors’ addresses: Jonathan M. Darbro, Department of Entomology, Cornell University, 3132 Comstock Hall, Ithaca, NY 14853, Telephone: +1 (607) 255-7040, Fax: +1 (607) 255-0939, E-mail: jon.darbro@gmail.com. André A. Dhondt, Cornell Laboratory of Ornithology, 159 Sapsucker Road, Ithaca, NY 14850, Telephone: +1 (607) 254-2445, Fax: +1 (607) 253-2104, E-mail: aad4@cornell.edu. Françoise M. Vermeylen, Cornell Statistical Consulting Unit, Cornell University, B11 Savage Hall, Ithaca, NY 14853, Telephone: +1 (607) 255-8211, Fax: +1 (607) 255-1033, E-mail: fmv1@cornell.edu. Laura C. Harrington, Department of Entomology, Cornell University, 3138 Comstock Hall, Ithaca, NY 14853, Telephone: +1 (607) 255-4475, Fax: +1 (607) 255-0939, E-mail: lch27@cornell.edu.

Acknowledgments: The authors thank K.V. Dhondt for infecting and treating finches with M. gallisepticum, T. Moscato for assistance with house finch care and maintenance, M. Ortega-Breña and G. Wein-stein for assistance in video analysis, B. Poulson, L. Evans, M. Mc-Kenna, and S. Woo for laboratory assistance, and L. Stenzler and C. Makarewich for technical support with house finch genotyping.

Financial support: This work was funded by Hatch Project (NYC-139432) and CDC (USO/CCU 220512) grants (awarded to L.C.H.), Grace H. Griswold Endowment funds (to J.M.D.), and an NIH-NSF “Ecology of Infectious Diseases” Program grant (DEB0094456, to A.A.D.).

REFERENCES

  • 1

    CDC, 1999. Outbreak of West Nile-like encephalitis—New York, 1999. MMWR Morb Mortal Wkly Rep 48 :845.

  • 2

    CDC, 2000. Update: West Nile Virus activity—Eastern United States, 2000. MMWR Morb Mortal Wkly Rep 49 :1044–1047.

  • 3

    CDC, 2002. West Nile Virus activity—United States, 2001. MMWR Morb Mortal Wkly Rep 31 :497–501.

  • 4

    CDC, 2003. West Nile virus activity—United States, November 6–12, 2003. MMWR Morb Mortal Wkly Rep 52 :1105–1106.

  • 5

    Goddard LB, Roth AE, Reisen WK, Scott TW, 2002. Vector competence of California mosquitoes of West Nile virus. Emerg Infect Dis 8 :1385–1391.

    • Search Google Scholar
    • Export Citation
  • 6

    Turell MJ, Dohn DJ, Sardelis MR, O’Guinn ML, Andreadis TG, Blow JA, 2005. An update on the potential of North American mosquitoes (Diptera: Culicidae) to transmit West Nile virus. J Med Entomol 42 :57–62.

    • Search Google Scholar
    • Export Citation
  • 7

    Apperson CP, Harrison BA, Unnasch TR, Hassan HK, Irby WS, Savage HM, Aspen SE, Watson DW, Rueda LM, Engber BR, Nasci RS, 2002. Host-feeding habits of Culex and other mosquitoes (Diptera: Culicidae) in the borough of Queens in New York City, with characters and techniques for identification of Culex mosquitoes. J Med Entomol 39 :777–785.

    • Search Google Scholar
    • Export Citation
  • 8

    Apperson CS, Hassan HK, Harrison BA, Savage HM, Aspen SE, Farajollahi A, Crans W, Daniels TJ, Falco RC, Benedict M, Anderson M, McMillen L, Unnasch TR, 2004. Host feeding patterns of established and potential mosquito vectors of West Nile virus in the Eastern United States. Vector Borne Zoonotic Dis 4 :71–82.

    • Search Google Scholar
    • Export Citation
  • 9

    Molaei G, Andreadis TG, Armstrong PM, Anderson JF, Voss-brinck CR, 2006. Host feeding patterns of Culex mosquitoes and West Nile virus transmission, northeastern United States. Emerg Infect Dis 12 :468–474.

    • Search Google Scholar
    • Export Citation
  • 10

    Komar N, Langevin S, Hinten S, Nemeth N, Edwards E, Hettler D, Davis B, Bowen R, Bunning M, 2003. Experimental infection of North American birds with the New York 1999 strain of West Nile Virus. Emerg Infect Dis 9 :311–322.

    • Search Google Scholar
    • Export Citation
  • 11

    Godsey MS Jr, Blackmore MS, Panella NA, Burkhalter K, Gott-fried K, Halsey LA, Rutledge R, Langevin SA, Gates R, La-monte KM, Lambert A, Lanciotti RS, Blackmore CGM, Loy-less T, Stark L, Oliveri R, Conti L, Komar N, 2005. West Nile Virus epizootiology in the southeastern United States, 2001. Vector Borne Zoonotic Dis 5 :82–89.

    • Search Google Scholar
    • Export Citation
  • 12

    Woolhouse MEJ, Dye C, Etard J-F, Smith T, Charlwood JD, Garnett GP, Hagan P, Hii JLK, Ndhlovu PD, Quinnell RJ, Watts CH, Chandiwana SK, Anderson RM, 1997. Heterogeneities in the transmission of infectious agents: implications for the design of control programs. Proc Natl Acad Sci USA 94 :338–342.

    • Search Google Scholar
    • Export Citation
  • 13

    Scott TW, Githeko AK, Fleisher A, Harrington LC, Yan G, 2006. DNA profiling of human blood in anophelines from lowland and highland sites in western Kenya. Am J Trop Med Hyg 75 :231–237.

    • Search Google Scholar
    • Export Citation
  • 14

    Day JF, Edman JD, 1983. Malaria renders mice susceptible to mosquito feeding when gametocytes are most infective. J Parasitol 69 :163–170.

    • Search Google Scholar
    • Export Citation
  • 15

    Day JF, Ebert KM, Edman JD, 1983. Feeding patterns of mosquitoes (Diptera: Culicidae) simultaneously exposed to malarious and healthy mice, including a method for separating blood meals from conspecifics hosts. J Med Entomol 20 :120–127.

    • Search Google Scholar
    • Export Citation
  • 16

    Coleman RE, Edman JD, Semprevivo LH, 1988. Interactions between malaria (Plasmodium yoelli) and leishmaniasis (Leishmania mexicana amazonensis): effective of concomitant infection on host activity, host body temperature, and vector engorgement success. J Med Entomol 25 :467–471.

    • Search Google Scholar
    • Export Citation
  • 17

    Mahon R, Gibbs A, 1982. Arbovirus-infected hens attract more mosquitoes. In: Mackenzie JS, editor. Viral Diseases in SouthEast Asia and the Western Pacific. New York: Academic Press, 502–505.

  • 18

    Turell MJ, Bailey CL, Rossi CA, 1984. Increased mosquito feeding on Rift Valley Fever virus-infected lambs. Am J Trop Med Hyg 33 :1232–1238.

    • Search Google Scholar
    • Export Citation
  • 19

    Lacroix R, Mukabana WR, Gouagna LC, Koella JC, 2005. Malaria infection increases attractiveness of humans to mosquitoes. PLoS Biol 3 :1590–1593.

    • Search Google Scholar
    • Export Citation
  • 20

    Reisen WK, Fang Y, Martinez VM, 2005. Avian host and mosquito (Diptera: Culicidae) vector competence determine the efficiency of West Nile and St. Louis encephalitis virus transmission. J Med Entomol 42 :367–375.

    • Search Google Scholar
    • Export Citation
  • 21

    Hochachka WM, Dhondt AA, 2000. Density-dependent decline of host abundance resulting from a new infectious disease. Proc Natl Acad Sci USA 97 :5303–5306.

    • Search Google Scholar
    • Export Citation
  • 22

    Ley DH, Berkhoff JE, McLaren JM, 1996. Isolation of Mycoplasma gallisepticum from eastern house finches with conjunctivitis. Avian Dis 30 :480–483.

    • Search Google Scholar
    • Export Citation
  • 23

    Fischer JR, Stallknecht DE, Luttrell MP, Dhondt AA, Converse KA, 1997. Mycoplasmal conjunctivitis in wild songbirds: the spread of a new contagious disease in a mobile host population. Emerg Infect Dis 3 :69–72.

    • Search Google Scholar
    • Export Citation
  • 24

    Dhondt AA, Tessaglia DL, Slothower RL, 1998. Epidemic mycoplasmal conjunctivitis in house finches from eastern North America. J Wildl Dis 34 :265–280.

    • Search Google Scholar
    • Export Citation
  • 25

    Dhondt AA, Badyaev AV, Dobson AP, Hawley DM, Driscoll MJL, Hochachka WM, Ley DH, 2006. Mycoplasmal conjunctivitis spreads more slowly in native than in introduced range of the host. EcoHealth 3 :95–102.

    • Search Google Scholar
    • Export Citation
  • 26

    Kollias GV, Sydenstricker KV, Kollias HW, Ley DH, Hosseini PR, Connolly V, Dhondt AA, 2004. Experimental infection of house finches with Mycoplasma gallisepticum. J Wildl Dis 40 :79–86.

    • Search Google Scholar
    • Export Citation
  • 27

    Seutin G, White BN, Boag PT, 1991. Preservation of avian blood and tissue samples for DNA analyses. Can J Zool 69 :82–90.

  • 28

    Darbro JM, Harrington LC, 2007. Avian defensive behavior and blood-feeding success of the West Nile vector mosquito, Culex pipiens. Behav Ecol 18 :750–757.

    • Search Google Scholar
    • Export Citation
  • 29

    Hawley DM, 2005. Isolation and characterization of eight micro-satellite loci from the house finch (Carpodacus mexicanus). Mol Ecol Notes 5 :443.

    • Search Google Scholar
    • Export Citation
  • 30

    Edman JD, Cody E, Lynn H, 1975. Blood-feeding activity of partially engorged Culex nigripalpus (Diptera: Culicidae). Entomol Exp Appl 18 :261–268.

    • Search Google Scholar
    • Export Citation
  • 31

    SAS Institute, 1998. User’s Manual, version 8.0 Cary (NC): SAS Institute.

  • 32

    Kenward MG, Roger JH, 1997. Small sample inference for fixed effects from restricted maximum likelihood. Biometrics 53 :938–997.

  • 33

    Webber LA, Edman JD, 1972. Anti-mosquito behaviour of cico-niiform birds. Anim Behav 20 :228–232.

  • 34

    Allan SA, Bernier UR, Kline DL, 2006. Laboratory evaluation of avian odors for mosquito (Diptera: Culicidae) attraction. J Med Entomol 43 :225–231.

    • Search Google Scholar
    • Export Citation
  • 35

    Russell CE, Hunter FF, 2005. Attraction of Culex pipiens/restuans (Diptera: Culicidae) mosquitoes to bird uropygial gland odors at two elevations in the Niagara region of Ontario. J Med Entomol 42 :301–305.

    • Search Google Scholar
    • Export Citation
  • 36

    Scott TW, Edman JD, Lorenz LH, Hubbard JL, 1988. Effect of disease on vertebrates’ ability behaviorally to repel host-seeking mosquitoes. Misc Publ Entomol Soc Am 68 :9–17.

    • Search Google Scholar
    • Export Citation
  • 37

    Edman JD, Scott TW, 1987. Host defensive behaviour and the feeding success of mosquitoes. Insect Sci Appl 8 (4–6):617–622.

  • 38

    Anderson RA, Brust RA, 1996. Blood feeding success of Aedes aegypti and Culex nigripalpus (Diptera: Culicidae) in relation to defensive behavior of Japanese quail (Coturnix japonica) in the laboratory. J Vect Ecol 21 :94–104.

    • Search Google Scholar
    • Export Citation
  • 39

    Hodgson JC, Spielman A, Komar N, Krahforst CF, Wallace GT, Pollack RJ, 2001. Interrupted blood-feeding by Culiseta melanura (Diptera: Culicidae) on European starlings. J Med Entomol 38 :59–66.

    • Search Google Scholar
    • Export Citation
Save