Erratum

In Am J Trop Med Hyg 76: 139–143 by Hatta and Smits, an error occurred when reporting the sequences of primers ST1 and ST2. The correct sequence of primer ST1 is 5′ TATGCCGCTACATATGATGAG 3′ and the correct sequence of primer ST2 is 5′ TTAACGCAGTAAAGAGAG 3′.

Save