INTRODUCTION
The genus Phlebovirus (family Bunyaviridae) consists of at least 53 distinct virus serotypes that are widely distributed in Europe, Africa, central Asia, and the Americas.1,2 The phleboviruses are arthropod-borne, and various members of the genus are transmitted by phlebotomines, mosquitoes, culi-coids, and ticks. The phleboviruses are antigenically unrelated to members of other genera in the family Bunyaviridae, but they cross-react serologically among themselves to different degrees.1 Until now, these serologic or antigenic relationships have been the basis for their taxonomic classification. The phleboviruses can be divided into two broad antigenic groups: the sand fly fever group viruses, which are transmitted by phlebotomine sand flies, mosquitoes and midges, and the Uukuniemi group viruses, which are transmitted by ticks. Some members of the sand fly fever group are of considerable veterinary and public health importance,2,3 and it is some of these viruses that will be the focus of this report.
According to the Eighth Report of the International Committee on Taxonomy of Viruses (ICTV),1 the genus Phlebovirus can be divided into nine species (antigenic complexes), which include 37 of the 53 recognized viruses. The remaining 16 virus serotypes are unclassified and are considered to be tentative members of the genus.1 However, additional tentative phleboviruses have been isolated, which were not included in the ICTV Eighth Report. The purpose of this report is to describe a new Phlebovirus serotype, designated Salobo virus (SLBOV), and to present data supporting a change in the number and composition of the current antigenic complexes (species) in the genus Phlebovirus.
MATERIALS AND METHODS
Virus.
Table 1 lists the 10 phlebovirus serotypes included in this study. The Rift Valley fever virus (RVFV) used to prepare antigen for serologic tests was the MP-12 attenuated vaccine candidate.4 MP-12 and the other nine viruses were obtained from the World Reference Center for Emerging Viruses and Arboviruses at the University of Texas Medical Branch (UTMB) or from the virus collection at the Evandro Chagas Institute, Belem, Para, Brazil.
Immune reagents.
The RVFV immune serum used in our serologic tests was obtained from the Plum Island Animal Disease Laboratory (Greenport, NY) and was of sheep origin. The RVFV antigen was prepared from livers of newborn mice inoculated with the MP-12 vaccine strain. All of the other antisera were prepared in adult mice, using infected brain or liver from newborn mice as antigen. The immunization schedule consisted of four intraperitoneal injections of antigen mixed with the complete Freund’s adjuvant, given at weekly intervals. After the final immunization, mice were inoculated with sarcoma 180 cells and the resulting immune ascitic fluids were collected.
Serologic tests.
Hemagglutination inhibition (HI) tests were done in microtiter plates, as previously described,5 using four units of antigen. Antigens were made by the sucrose-acetone extraction method6 and inactivated with β-propriolactone (Sigma, St. Louis, MO). The HI titer was read after overnight incubation of antigen and antibody at 4°C. Complement-fixation (CF) tests were performed by the microtiter technique,5 using two units of guinea pig complement and overnight incubation of the antigen and antibody at 4°C. The CF titers were recorded as the highest dilutions giving 3+ or 4+ fixation of complement on a scale of 0 to 4+.
Preparation of RNA, primer design, and sequencing.
Five New World phleboviruses shown in Table 1 (Icoravi virus [ICOV], Belterra virus [BELTV], Salobo virus [SLBOV], Joa virus [JOAV], and Frijoles virus [FRIV]) were inoculated into 25-cm2 flask cultures containing Vero cells. When the cell monolayer showed a 2+ to 3+ cytopathic effect, total RNA was extracted from the infected cell monolayer with Trizol reagent (Invitrogen, Carlsbad, CA), as previously described.7 To design primers for reverse transcription–polymerase chain reaction (RT-PCR), sequences of phleboviruses available from GenBank were aligned by the Clustal W program of MegAlign, implemented in the DNAStar package (DNAStar Inc., Madison, WI). Primers were designed according to conserved regions using the Primer Select program (DNAStar package). The sequences, polarities, and positions of primers are shown in Table 2, which also lists the expected product length. For the small (S) segment, forward primer PHLV-END was designed according to 5′ consensus sequences of S segment cDNA. Reverse primer PH-S-DR-RVF was located in the nucleocapsid or non-structural protein-coding region. For amplification of the medium (M) segment, cocktail primers Ph-M-2FM, Ph-M-3RM, and Ph-M-4R2M were used.7 The Ph-M-2FM primer was paired with Ph-M-3RM or Ph-M-4R2M, respectively, to amplify partial M segments of the five Brazilian and Panamanian phleboviruses. For the large (L) segment, three available complete L segment nucleotide sequences of phleboviruses in GenBank, namely RVFV (NC_002043), Toscana virus (TOSV, X68414), and Uukuniemi virus (UUKV, D10759), were aligned using the Clustal W program. Four conserved regions were selected for primer design. The primers were designated in Table 2 as PH-L-2770F, PH-L-2794F, PH-L-3625R, and PH-L-3574R. PH-L-2770F and PH-L-3625R were used to amplify the five aforementioned New World phleboviruses. PH-L-2794F and PH-L-3574R were used to amplify SLBOV only.
The PCR products were purified after electrophoresis on an agarose gel using QIAquick gel extraction kit (Qiagen, Valencia, CA), and were sequenced at the Protein Chemistry Core facility at UTMB. Raw sequence data were assembled and finalized using the SeqMan module within the DNAStar software package. Amino acid sequences were deduced by EditSeq module implemented in the DNAStar software package. To ensure the authenticity of the sequences, new specific primers were designed according to the obtained sequences, and these were used to perform new rounds of RT-PCR from the RNA samples, and sequenced again.
Phylogenetic analyses.
Partial nucleotide sequences of S, M, and L segments of ICOV, BELTV, SLBOV, JOAV, and FRIV and their deduced amino acid sequences were aligned with representative sequences of other known phleboviruses, including RVFV, TOSV, Punta Toro virus (PTV) Sand fly fever Sicilian virus (SFSV), and Uukuniemi virus (UUKV), using the Clustal W algorithm (version 1.4) implemented in MacVector (version 7.1.1; Accelrys, Cambridge, United Kingdom). To establish genetic relationships, phylogenetic trees were constructed by using the neighbor-joining (NJ), maximum parsimony (MP) and maximum likelihood (ML) methods implemented in the PAUP version 4.08,9 software packages. For NJ analysis, a distance matrix was calculated from the aligned sequences, using the Hasegawa, Kishino and Yano (HKY85) formula by allowing transmissions and transversions to occur at different rates, and base frequencies to vary as well. The distance from the aligned deduced amino acid was measured by the mean character difference. Parsimony analyses were used by selecting the tree or trees that minimize the number of evolutionary steps, including homoplasies to explain the data. For the likelihood analyses, the general time reversible model was used and nucleotide frequencies were estimated empirically. These data were sampled by 2,000 bootstrap replicates to determine the confidence indices within the phylogenetic tree and the statistical confidence of the topologies.10 Bayesian analyses were conducted with MRBAYES version 3.0 by using two replicates of one million generations. Bayesian posterior probabilities were calculated from the consensus of 19,602 trees after excluding the first 400 trees as burn-in.11 The resulting trees were plotted using Treeview version 1.6.6.12
RESULTS
Serologic tests.
Table 3 summarizes results of an antigenic comparison of the six phleboviruses, as determined by CF test. Complement-fixing antigenic determinants are principally associated with the nucleocapsid protein (S segment).1 Although there was some degree of cross-reaction among many of the viruses, they can be divided into three antigenic complexes: the Rift Valley fever complex consisting of RVFV; the Icoaraci complex consisting of ICOV, BELTV, and SLBOV; and the Frijoles complex consisting of FRIV and JOAV.
Table 4 summarizes results of an antigenic comparison of the six phleboviruses by HI test. The hemagglutinating antigens are associated with the envelope glycoproteins (M segment).1 The HI test is more scarcely cross-reactive than the CF test with the phleboviruses. By HI test, RVFV antigen reacted with all of the immune sera, but the RVFV immune serum (antibody) only reacted with the homologous (RVFV) antigen, indicating a one-way cross. Because FRIV did not produce a usable hemagglutinin, we were unable to complete that portion of the HI test.
Table 5 shows the results of previously reported13 90% plaque reduction neutralization tests comparing FRIV and JOAV and their respective immune sera. By this technique, the latter two viruses were distinct.
Amplification by PCR and sequencing of the partial S, M, and L segments genome.
As shown in Table 2, the two primer constructs PHLV-END (forward) and PH-S-DR-RVF (reverse) amplified partial S segment with the five viruses studied, with an expected product size of approximately 500 base-pairs (1–505 nucleotides). The partial sequence corresponds to the region of the open reading frame for the nucleocapsid protein. The nucleotide and deduced amino acid sequence identities ranged from 64.1% to 90.3% and 70.6% to 99.3%, respectively, among the five New World phleboviruses (Table 6). However, their identities were 51.2% and 62.2% or less, respectively, when compared with RVFV. For M and L segments, different primer pairs had to be used to amplify the five viruses (M: product length = 600 or 1,400 basepairs (1,737–3583 nucleotides; L: product length = 800 or 870 base-pairs (2,770–3,654 nucleotides). The partial M segment sequence was in the coding region for G2 glycoprotein (1,557–3,041 nucleotides for UUKV). The nucleotide and deduced amino acid sequence identities ranged from 54.8% to 78.6%, and 41.9% to 95.1%, respectively, among these five isolates (Table 7). When compared with RVFV, they ranged from 51.6% to 55.2% and 36.5% to 47.4%, respectively. For partial L segment sequence located in the RNA-dependent RNA polymerase open reading frame, the nucleotide and deduced amino acid sequence identities were from 67.5% to 86.5% and 72.4% to 97.3%, respectively, among the five isolates (Table 8). The identity between them and RVFV ranged from 69.3% to 71.6% and 76.2% to 77.8% for nucleotide and deduced amino acid sequences, respectively. In summary, the identities of partial S, M, and L segment sequences and the deduced amino acid sequences of these five isolates were higher than identities of other viruses used in this study.
Phylogenetic analyses.
Phylogenetic trees constructed according to the partial nucleotide acid and the deduced amino acid sequences of the S, M, and L segments of the studied phleboviruses using NJ, MP, ML, and Bayesian methodologies showed similar topology (Figures 1 and 2).
Analysis of the S segment nucleotide sequences showed two major phylogenetic groups (Figure 1A). Group I included SLBOV, BELTV, and ICOV, and group II included FRIV and JOAV. RVFV, TOSV, PTV, and SFSV were not clustered with the two groups. The outlying group was UUKV. When constructed using amino acid sequences, the same phylogenies of these viruses were obtained (Figure 2A).
The phylogenetic trees constructed by M segment sequences showed that these viruses belong to two major lineages (Figures 1B and 2B), similar to trees constructed using S segment sequences. Similarly, SLBOV, BELTV, and ICOV clustered together based on the nucleotide and amino acid sequences of the L segment (Figures 1C and 2C), and FRIV clustered with JOAV.
The reliability of these trees was examined by bootstrap analysis. For the S segment, according to amino acid and nucleotide sequences, SLBOV, BELTV, and ICOV clustered together with bootstrap values of 70% and 100%, respectively. JOAV and FRIV clustered together with bootstrap values of 79% and 100%, respectively (Figures 1A and 2A. For the M segment, SLBOV, BELTV, and ICOV clustered together with a bootstrap value of 100% by both the nucleotide and amino acid sequence analyses. FRIV and JOAV clustered together with a bootstrap value of 100%. These two clades clustered together with values of 92% and 86%, respectively. For the L segment, SLBOV, BELTV, and ICOV formed a lineage with bootstrap values of 94% and 100% for nucleotide and amino acid sequences, respectively. FRIV and JOAV clustered together with bootstrap values of 84% and 100%, respectively.
The positions of other viruses were less consistent among the trees because only a single member of each group was included in the analyses, which generally does not provide reliable phylogenetic implications, as shown by the low bootstrap values (< 50%). Nevertheless, these viruses were included as references for the analysis of the South American viruses. No significant level of genetic relationship was shown between RVFV and these viruses.
DISCUSSION
Like other viruses with multipartite genomes, viruses in the Phlebovirus genus probably exchange genomic segments to give rise to heterotypic viruses, likely by segment reassortment among very closely related viruses. This has been shown with other members of the Bunyaviridae family both in vivo and in vitro.14–16 Lowen and others17 reported that genetic rearrangement had an effect on viral virulence. Genetic reassortment, mutation, and recombination also contribute to the evolution of these viruses,18 yet little is known about mechanisms that generate virus biodiversity among them.19
As part of our overall effort to genetically characterize phleboviruses, this study focused on a group of South American isolates that showed limited antigenic relationship to RVFV in serologic tests. This is relevant because of the geographic separation of these viruses from RVFV, which was originally found in sub-Saharan Africa and more recently has spread to Egypt and to the Arabian Peninsula. Comparative sequence analysis could provide information on the mechanisms of genetic divergence and potential evolution of these viruses. As shown, there was one-way antigenic cross reactivity between antibodies to these viruses and RVFV antigen, by both HI and CF tests (Tables 3 and 4). These cross-reactions suggest that antigens share mimotopes, similar structural features, and are related to selective pressure and immune evolution.20
Sorting out the genetic and antigenic relationships for phleboviruses is complicated because of their high genetic diversity and the diversity of their gene products. Previous studies on the phylogenetic relationships among 26 phleboviruses based on partial M segment showed some geographic overlaps, at least between some members.7 This suggested that reassortment may occur among two related viruses circulating in the same region. As shown in Figures 1 and 2, the topologies obtained with each genome segment showed that the five isolates were similar, which suggested that these isolates had a dependent history during their evolutionary process. Cladistic analysis showed that regardless of the RNA segment analyzed, the Brazilian phleboviruses were placed together in the same clades, except for JOAV, isolated in Altamira, Para State, which was placed in the same subclade with FRIV from Panama. These five New World viruses always clustered together and showed high stability as demonstrated by the high bootstrap values. It suggests that the five viruses may have had a common ancestry. There was no close relationship between these five viruses and others in our study. The differences between the nucleic acid and amino acid trees suggest that there is functional change during genome translation. Other factors such as the arthropod vectors and dual heterologous infection of vertebrate or invertebrate hosts14,21 or passage history and exchange of genetic material between segmented RNA viruses from different geographic areas16,22 may also be involved in their evolution. BELTV, SLBOV, and ICOV did not group with RVFV in these phylogenetic analyses. This finding indicates that these viruses maybe pathogenically different from RVFV because these segments, especially M and S, encode proteins that have effects on viral tropism and virulence.23–25
According to the current ICTV classification, ICOV and BELTV are assigned to the Rift Valley fever species, and JOAV and FRIV are assigned to the Frijoles species. SLBOV is a new and previously undescribed member of the genus. Based on the results of the current study, we propose that the classification of these viruses be revised. RVFV would be the only member of the Rift Valley fever virus complex. JOAV and FRIV would remain as members of the Frijoles complex. ICOV, BELTV and SLBOV would be assigned to a new Icoaraci complex. Thus the total number of species (and the parallel antigenic complex) in the Phlebovirus genus would be 10.
In summary, topology of the phylogenic analysis, on the basis of the three segments, showed similar clustering. The serologic data and phylogenetic pattern confirmed that these five isolates constitute distinct antigenic and species complexes in the genus Phlebovirus. Their positions in the phylogenetic tree closely correlate with their geographic distributions. This study also demonstrates that sequence information can provide insight to the evolution of new viruses and to the relationship between newly isolated and previously recognized viruses. Because only a limited number of full-length genomic sequences are available for phleboviruses, further studies aimed at acquiring additional sequence information of these viruses are necessary, particularly for the purpose of understanding the evolution of them. In this regard, the current study provides valuable information that may serve as the basis for further phylogenetic studies.
Phleboviruses included in this study
| Virus name (strain) | Source | Geographic origin | Year isolated | GenBank accession no. |
|---|---|---|---|---|
| Rift Valley fever (ZH548) | Human | Nile Delta, Egypt | 1977 | S: X53771 |
| M: M25276 | ||||
| L: NC_002043 | ||||
| Sandfly fever Sicilian (Sabin) | Human | Sicily, Italy | 1943 | S: J04418 |
| M: U30500 | ||||
| S: X53794 | ||||
| Toscana (ISS. Phl.3) | Phlebotomus perniciosus | Toscana, Italy | 1971 | M: X89628 |
| L: X68414 | ||||
| S: M33551 | ||||
| Uukuniemi (S-23) | Ixodes ricinus | Finland | 1960 | M: M17417 |
| L: D10759 | ||||
| S: K02736 | ||||
| Punta Toro (Balliet) | Human | Panama | 1966 | M: M11156 |
| L: DQ363409 | ||||
| Frijoles (VP-161A) | Lutzomyia species | Panama | 1969 | |
| Joa (Be Ar 371637) | Lutzomyia species | Altamira, Para, Brazil | 1979 | |
| Belterra (Be An 356637) | Proechimys longicaudatus | Santarem, Para, Brazil | 1978 | |
| Icoaraci (Be An 24262) | Nectomys species | Belem, Para, Brazil | 1960 | |
| Salobo (Be An 578142) | Proechimys guyanensis | Para, Brazil | 1997 |
Primers (bold) and their components used for RT-PCR amplification of partial M, S, and L segments of the phleboviruses and expected product length (bp)*
| Name | Sequence (5′ → 3′) | Polarity | Position (nt) in correspondence with | Target length (bp) | |
|---|---|---|---|---|---|
| * RT-PCR = reverse transcription–polymerase chain reaction; M = medium; S = small; L = large; bp = basepairs; nt = nucleotide; RVF = Rift Valley fever; SFS = Sand fly fever Sicilian; UUK = Uukuniemi; PT = Punta Toro; TOS = Toscana. | |||||
| PHLV-END | GGGGGGGGGGACACAAAG | + | RVF | S 1-8 (cDNA) | |
| SFS | S 1-8 | ||||
| UUK | S 1-8 | ||||
| PH-S-DR-RVF | GCAAAGCTGGGGTGCATCAT | − | PT | S 480-461 | |
| RVF | S 487-468 (cDNA) | 500 | |||
| SFS | S 493-474 | ||||
| TOS | S 505-486 | ||||
| Ph-M-2FM | GGVMTSMTHAATTAYCAGTGYCA | + | |||
| Ph-M-2F-PT | GGCATCCTAAATTATCAGTGCCA | PT | M 2102-2124 | ||
| Ph-M-2F-RVF | GGCCTGATAAATTACCAGTGTCA | RVF | M 1737-1759 | ||
| Ph-M-2F-SFS | GGGATCATCAATTACCAGTGTCA | SFS | M 2170-2192 | ||
| Ph-M-2F-TOS | GGACTGCTTAATTACCAGTGCCA | TOS | M 2166-2188 | ||
| PH-M-3RM | CAYCTYCKNGARCTNARRCA | − | 600 | ||
| Ph-M-3R-PT | CACCTCCTAGAGCTAAGACA | PT | M 2703-2684 | ||
| Ph-M-3R-RVF | CATCTCCTTGAGCTCAAACA | RVF | M 2350-2331 | ||
| Ph-M-3R-SFS | CATCTTCTCGAACTTAGACA | SFS | M 2780-2761 | ||
| Ph-M-3R-TOS | CACCTTCGCGAACTTAGACA | TOS | M 2785-2766 | ||
| Ph-M-3R-ELB | CATCTTCTTGAGCTTAAGCA | ||||
| Ph-M-3R-27 | CACCTTCTGGAACTGAGGCA | ||||
| Ph-M-4R2M | KMATYRCADGARTARCARCC | − | 1,400 | ||
| Ph-M-4R2-PT | TAATCACAGGAGTAGCAACC | PT | M 3504-3485 | ||
| Ph-M-4R2-RVF | GCATTGCAAGAATAGCAACC | RVF | M 3151-3132 | ||
| Ph-M-4R2-SFS | TCATTGCAAGAATAGCAGCC | SFS | M 3581-3562 | ||
| Ph-M-4R2-TOS | TCATCACATGAATAACAGCC | TOS | M 3583-3564 | ||
| PH-L-2770F | AAGAAACAACAGCATGG | + | RVF | L 2770-2786 | 870 |
| TOS | L 2773-2789 | ||||
| UUK | L 2777-2793 | ||||
| PH-L-3625R | GCTGCAATCCACCTGAT | − | RVF | L 3641-3625 | |
| TOS | L 3644-3628 | ||||
| UUK | L 3654-3638 | ||||
| PH-L-2794F | AGAGAGATCTATGTGATGGG | + | RVF | L 2794-2813 | 800 |
| TOS | L 2797-2816 | ||||
| UUK | L 2801-2820 | ||||
| PH-L-3574R | AATTCAGAGTTGTACTCCAT | − | RVF | L 3593-3574 | |
| TOS | L 3596-3577 | ||||
| UUK | L 3606-3587 | ||||
Results of complement fixation tests with six phlebotomus fever group viruses*
Results of hemagglutination-inhibition tests comparing six phlebotomus fever group viruses*
Results of plaque reduction neutralization tests comparing Frijoles and Joa viruses (modified from Travassos da Rosa and others13)*
Identity of nucleotide and deduced amino acid sequences of the small segment of 10 phleboviruses*
Identity of the nucleotide and deduced amino acid sequence of partial Gc gene of 10 phleboviruses*
Identity of nucleotide and deduced amino acid sequences of the partial RNA polymerase gene of 10 phleboviruses*
Phylogenetic relationship of selected phleboviruses based on nucleic acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = 85 by the Hasegawa, Kishino and Yano formula. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on nucleotide sequences of the S segment. B, Phylogenetic tree based on nucleotide acid sequences of the M segment. C, Phylogenetic tree based on nucleotide acid sequences of L segment. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Phylogenetic relationship of selected phleboviruses based on nucleic acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = 85 by the Hasegawa, Kishino and Yano formula. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on nucleotide sequences of the S segment. B, Phylogenetic tree based on nucleotide acid sequences of the M segment. C, Phylogenetic tree based on nucleotide acid sequences of L segment. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Phylogenetic relationship of selected phleboviruses based on nucleic acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = 85 by the Hasegawa, Kishino and Yano formula. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on nucleotide sequences of the S segment. B, Phylogenetic tree based on nucleotide acid sequences of the M segment. C, Phylogenetic tree based on nucleotide acid sequences of L segment. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Phylogenetic relationship of selected phleboviruses based on deduced amino acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor-joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = mean character difference. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on deduced amino acid of S segments. B, Phylogenetic tree based on deduced amino acid of M segments. C, Phylogenetic tree based on deduced amino acid of L segments. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Phylogenetic relationship of selected phleboviruses based on deduced amino acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor-joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = mean character difference. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on deduced amino acid of S segments. B, Phylogenetic tree based on deduced amino acid of M segments. C, Phylogenetic tree based on deduced amino acid of L segments. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Phylogenetic relationship of selected phleboviruses based on deduced amino acid sequences of small (S), medium (M), and large (L) RNA segments. Phylogenetic analyses were carried out using neighbor-joining, maximum parsimony, maximum likelihood, and Bayesian methods, yielding identical topologies. Distance measure = mean character difference. Bootstrap method with neighbor-joining search was carried out with the same options. Groups with frequency > 50% were retained. Uukuniemi virus (UUKV) was set as outgroup to root the tree. A value of 0.1 substitutions per site is equivalent to a 10% change. Numbers adjacent to each branch represent the percentage bootstrap support calculated for 2,000 replicates. A, Phylogenetic tree based on deduced amino acid of S segments. B, Phylogenetic tree based on deduced amino acid of M segments. C, Phylogenetic tree based on deduced amino acid of L segments. PTV = Punta Toro virus; SFSV = Sand fly fever Sicilian virus; TOSV = Toscana virus; RVFV = Rift Valley fever virus.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1194
Address correspondence to Shu-Yuan Xiao, Department of Pathology, University of Texas Medical Branch, 301 University Boulevard, Galveston, TX 77555-0588. E-mail: syxiao@utmb.edu
Authors’ addresses: Fangling Xu, Amelia P.A. Travassos da Rosa, Robert B. Tesh, and Shu-Yuan Xiao, Department of Pathology and Center for Biodefense and Emerging Infectious Diseases, University of Texas Medical Branch, Galveston, TX 77555-0609, Telephone: 409-772-6546, Fax: 409-747-2429, E-mail: syxaio@utmb.edu. Dongying Liu, Department of Microbiology, Medical College of Wuhan University, Wuhan, Hubei Province 430071, People’s Republic of China. Marcio R.T. Nunes, Departamento de Arbovirologia e Febres Hemorragicas, Instituto Evandro Chagas, Ministerio da Saude, Belem, Para, Brazil.
Acknowledgments: The sequences obtained in this study have been deposited in GenBank under accession nos. EF076013–EF076027.
Financial support: This work was supported by National Institutes of Health contracts (NO1-AI25489 and NO1-AI30027).
REFERENCES
- 1↑
Nichol ST, Beaty BJ, Elliot RM, Goldbach R, Plyusin A, Schmaljohn CS, Tesh RB, 2005. Family Bunyaviridae. Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, eds. Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Virus. San Diego, London: Elsevier Academic Press, 695–716.
- 2↑
Tesh RB, 1989. Phlebotomus fevers. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Volume 4. Boca Raton, FL: CRC Press, 15–27.
- 3↑
Charrel RM, Gallian P, Navarro-Mari JM, Nicoletti L, Papa A, Sanchez-Seco MP, Tenorio A, de Lamballerie X, 2005. Emergence of Toscana virus in Europe. Emerg Infect Dis 11 :1657–1663.
- 4↑
Niklasson B, Peters CJ, Bengtsson E, Norrby E, 1985. Rift Valley fever vaccine trial: study of neutralizing antibody response in humans. Vaccine 3 :123–127.
- 5↑
Beaty BJ, Calisher CH, Shope RE, 1989. Arboviruses. Schmidt NJ, Emmons RW, eds. Diagnostic Procedures for Viral, Rickettsial and Chlamydial Infections. Washington DC: American Public Health Association, 797–55.
- 6↑
Clarke DH, Casals J, 1958. Techniques for hemagglutination and hemagglutination-inhibition with arthropod-borne viruses. Am J Trop Med Hyg 7 :561–573.
- 7↑
Liu DY, Tesh RB, Travassos da Rosa AP, Peters CJ, Yang Z, Guzman H, Xiao SY, 2003. Phylogenetic relationships among members of the genus Phlebovirus (Bunyaviridae) based on partial M segment sequence analyses. J Gen Virol 84 :465–473.
- 8↑
Swofford DL, 2002. PAUP* (Phylogenetic Analysis Using Parsimony) (*and other methods), version 4. Sunderland, MA: Sinauer Associates.
- 9↑
Kumar S, Gadagkar SR, 2000. Efficiency of the neighbor-joining method in reconstructing deep and shallow evolutionary relationships in large phylogenies. J Mol Evol 51 :544–553.
- 10↑
Felsenstein J, 1988. Phylogenies from molecular sequences: inference and reliability. Annu Rev Genet 22 :521–565.
- 11↑
Huelsenbeck PJ, Ronquist FR, 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics 17 :754–755.
- 12↑
Page RD, 1996. Treeview: An application to display phyloge netic trees on personal computers. Comput Appl Biosci 12 :357–358.
- 13↑
Travassos da Rosa AP, Tesh RB, Pinheiro FP, Travassos da Rosa JF, Peterson NE, 1983. Characterization of eight new phlebotomus fever serogroup arboviruses (Bunyaviridae: Phlebovirus) from the Amazon region of Brazil. Am J Trop Med Hyg 32 :1164–1171.
- 14↑
Beaty BJ, Sundin DR, Chandler LJ, Bishop DH, 1985. Evolution of bunyaviruses by genome reassortment in dually infected mosquitoes (Aedes triseriatus). Science 230 :548–550.
- 15
Pringle CR, 1996. Genetic and genome segment reassortment. Elliott RM, eds. The Bunyaviridae. New York: Plenum Press, 189–26.
- 16↑
Sall AA, Zanotto PM, Sene OK, Zeller HG, Digoutte JP, Thiongane Y, Bouloy M, 1999. Genetic reassortment of Rift Valley fever virus in nature. J Virol 73 :8196–8200.
- 17↑
Lowen AC, Boyd A, Fazakerley JK, Elliott RM, 2005. Attenuation of bunyavirus replication by rearrangement of viral coding and noncoding sequences. J Virol 79 :6940–6946.
- 18↑
de Filippis VR, Villareal LP, 2001. Virus evolution. Knipe DM, Howley PM, eds. Fields Virology. Volume 1. Fourth edition, Philadelphia: Lippincott Williams & Wilkins, 353–370.
- 19↑
Nunes MR, Travassos da Rosa AP, Weaver SC, Tesh RB, Vasconcelos PF, 2005. Molecular epidemiology of group C viruses (Bunyaviridae, Orthobunyavirus) isolated in the Americas. J Virol 79 :10561–10570.
- 20↑
Cohn M, 2005. Degeneracy, mimicry and crossreactivity in immune recognition. Mol Immunol 42 :651–655.
- 21↑
Accardi L, Prehaud C, Di Bonito P, Mochi S, Bouloy M, Giorgi C, 2001. Activity of Toscana and Rift Valley fever virus transcription complexes on heterologous templates. J Gen Virol 82 :781–785.
- 23↑
Vialat P, Billecocq A, Kohl A, Bouloy M, 2000. The S segment of Rift Valley fever Phlebovirus (Bunyaviridae) carries determinants for attenuation and virulence in mice. J Virol 74 :1538–1543.
- 24
Flick K, Katz A, Overby A, Feldmann H, Pettersson RF, Flick R, 2004. Functional analysis of the noncoding regions of the Uukuniemi virus (Bunyaviridae) RNA segments. J Virol 78 :11726–11738.
- 25↑
Ikegami T, Won S, Peters CJ, Makino S, 2005. Rift Valley fever virus NSs mRNA is transcribed from an incoming anti-viral-sense S RNA segment. J Virol 79 :12106–12111.