• View in gallery
    Figure 1.

    Representative IS200 profiles A, and PstI-ribotypes B, obtained from the 33 selected Typhi isolates and the 8 comparison strains under study. A, Lanes 1–9, IS1 type; lane 10, IS2 type. B, Image generated by BioNumerics. M, Riboprinter marker size (band sizes in kilobase pairs). Ribotype numbering according to BBPE-Unit database is indicated. Asterisks indicate the ribotypes observed in isolates from Son La province, 2002.

  • View in gallery
    Figure 2.

    A, Representative XbaI-PFGE profiles obtained from the 29 typed Typhi isolates and the 8 comparison strains under study. M, S. enterica serotype Braenderup H9812 used as the molecular size marker (band sizes in kilobase pairs). PFGE profile numbering is indicated. B, Dendrogram generated by BioNumerics showing the results of cluster analysis on the basis of PFGE fingerprinting. Similarity analysis was performed using the Dice coefficient, and clustering was by UPGMA. Numbers in parentheses refer to the number of isolates with the indicated PFGE profile.

  • View in gallery
    Figure 3.

    Minimal spanning tree of 38 strains based on DHPLC analysis of 52 polymorphic genes (Table 1). The tree shows 5 haplotypes (nodes) plus two hypothetical nodes (missing links) indicated by dashed lines. Size of circles reflects numbers of isolates. Each edge reflects a single mutation. The genes that bore the mutations, which also separate H68 from H1, are annotated (arrows) along three edges.

  • 1

    Crump JA, Luby SP, Mintz ED, 2004. The Global Burden of Typhoid Fever. Bull WHO 82 :346–353.

  • 2

    Wain J, Kidgell C, 2004. The emergence of multidrug resistance to antimicrobial agents for the treatment of typhoid fever. Trans R Soc Trop Med Hyg 98 :423–430.

    • Search Google Scholar
    • Export Citation
  • 3

    Rowe B, Ward LR, Threlfall EJ, 1990. Spread of multiresistant Salmonella typhi.Lancet 337 :1065.

  • 4

    Fica A, Fernandez-Beros ME, Aron-Hott L, Rivas A, D’Ottone K, Chumpitaz J, Guevara JM, Rodriguez M, Cabello F, 1997. Antibiotic-resistant Salmonella typhi from two outbreaks: few ribotypes and IS200 types harbor Inc HI1 plasmids. Microb Drug Resist 3 :339–343.

    • Search Google Scholar
    • Export Citation
  • 5

    Mirza S, Kariuki S, Mamun KZ, Beeching NJ, Hart CA, 2000. Analysis of plasmid and chromosomal DNA of multidrug-resistant Salmonella enterica serovar typhi from Asia. J Clin Microbiol 38 :1449–1452.

    • Search Google Scholar
    • Export Citation
  • 6

    Wain J, Diem Nga LT, Kidgell C, James K, Fortune S, Song Diep T, Ali T, O Gaora P, Parry C, Parkhill J, Farrar J, White NJ, Dougan G, 2003. Molecular analysis of Inc HI1 antimicrobial resistance plasmids from Salmonella serovar Typhi strains associated with typhoid fever. Antimicrob Agents Chemother 47 :2732–2739.

    • Search Google Scholar
    • Export Citation
  • 7

    Connerton P, Wain J, Hien TT, Ali T, Parry C, Chinh NT, Vinh H, Ho VA, Diep TS, Day NP, White NJ, Dougan G, Farrar JJ, 2000. Epidemic typhoid in Vietnam: molecular typing of multiple-antibiotic-resistant Salmonella enterica serotype Typhi from four outbreaks. J Clin Microbiol 38 :895–897.

    • Search Google Scholar
    • Export Citation
  • 8

    Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F, Scavizzi MR, 2004. Endemic, epidemic clone of Salmonella enterica serovar Typhi harboring a single multi-drug-resistant plasmid in Vietnam between 1995 and 2002. J Clin Microbiol 42 :3094–3099.

    • Search Google Scholar
    • Export Citation
  • 9

    Lee K, Yong D, Yum JH, Lim YS, Kim HS, Lee BK, Chong Y, 2004. Emergence of multidrug-resistant Salmonella enterica serovar Typhi in Korea. Antimicrob Agents Chemother 48 :4130–4135.

    • Search Google Scholar
    • Export Citation
  • 10

    Nguyen TA, Ha Ba K, Nguyen TD, 1993. La fièvre typhoïde au Sud Vietnam, 1990–1993. Bull Soc Pathol Exot 86 :476–478.

  • 11

    Van Duong D, Binns CW, Van Le T, 1997. Availability of antibiotics as over-the-counter drugs in pharmacies: a threat to public health in Vietnam. Trop Med Int Health 2 :1133–1139.

    • Search Google Scholar
    • Export Citation
  • 12

    Wain J, Hoa NT, Chinh NT, Vinh H, Everett MJ, Diep TS, Day NP, Solomon T, White NJ, Piddock LJ, Parry CM, 1997. Quinolone-resistant Salmonella typhi in Viet Nam: molecular basis of resistance and clinical response to treatment. Clin Infect Dis 25 :1404–1410.

    • Search Google Scholar
    • Export Citation
  • 13

    Mermin JH, Villar R, Carpenter J, Roberts L, Samaridden A, Gasanova L, Lomakina S, Bopp C, Hutwagner L, Mead P, Ross B, Mintz ED, 1999. A massive epidemic of multidrug-resistant typhoid fever in Tajikistan associated with consumption of municipal water. J Infect Dis 179 :1416–1422.

    • Search Google Scholar
    • Export Citation
  • 14

    Threlfall EJ, Ward LR, 2001. Decreased susceptibility to ciprofloxacin in Salmonella enterica serotype Typhi, United Kingdom. Emerg Infect Dis 7 :448–450.

    • Search Google Scholar
    • Export Citation
  • 15

    Hirose K, Hashimoto A, Tamura K, Kawamura Y, Ezaki T, Sagara H, Watanabe H, 2002. DNA sequence analysis of DNA gyrase and DNA topoisomerase IV quinolone resistance-determining regions of Salmonella enterica serovar Typhi and serovar Paratyphi A. Antimicrob Agents Chemother 46 :3249–3252.

    • Search Google Scholar
    • Export Citation
  • 16

    Madhulika U, Harish BN, Parija SC, 2004. Current pattern in antimicrobial susceptibility of Salmonella Typhi isolates in Pondicherry. Indian J Med Res 120 :111–114.

    • Search Google Scholar
    • Export Citation
  • 17

    Renuka K, Kapil A, Kabra SK, Wig N, Das BK, Prasad VV, Chaudhry R, Seth P, 2004. Reduced susceptibility to ciprofloxacin and gyrA gene mutation in North Indian strains of Salmonella enterica serotype Typhi and serotype Paratyphi A. Microb Drug Resist 10 :146–153.

    • Search Google Scholar
    • Export Citation
  • 18

    Threlfall EJ, Ward LR, Skinner JA, Smith HR, Lacey S, 1999. Ciprofloxacin-resistant S. typhi and treatment failure. Lancet 353 :1590–1591.

    • Search Google Scholar
    • Export Citation
  • 19

    Butt T, Ahmad RN, Mahmood A, Zaidi S, 2003. Ciprofloxacin treatment failure in typhoid fever case, Pakistan. Emerg Infect Dis 9 :1621–1622.

    • Search Google Scholar
    • Export Citation
  • 20

    Parry C, Wain J, Chinh NT, Vinh H, Farrar JJ, 1998. Quinolone-resistant Salmonella typhi in Vietnam. Lancet 351 :1289.

  • 21

    Parry CM, 1998. Untreatable infections? The challenge of the 21st century. Southeast Asia J Trop Med Public Health 29 :416–424.

  • 22

    Tran HH, Bjune G, Nguyen BM, Rottingen JA, Grais FR, Guerin PJ, 2005. Risk factors associated with typhoid fever in Son La province, northern Vietnam. Trans R Soc Trop Med Hyg 99 :819–826.

    • Search Google Scholar
    • Export Citation
  • 23

    Khai SH, 2003. Rational land use planning based on community in Northern hilly and mountainous region. United Nations Development Project reports. Available from: http://www.undp.org.vn/projects/vie96010/cemma/RAS93103/005.htm.

  • 24

    National Committee for Clinical Laboratory Standards, 2000. Performance standards for antimicrobial disk susceptibility tests. NCCLS Document M2-A7. National Committee for Clinical Laboratory Standards, Wayne, Pa.

  • 25

    National Committee for Clinical Laboratory Standards, 2002. Performance standards for antimicrobial disk susceptibility testing. Twelfth informational supplement. NCCLS Document MS100-S12. National Committee for Clinical Laboratory Standards. Wayne, Pa.

  • 26

    Weill FX, Fabre L, Grandry B, Grimont PAD, Casin I, 2005. Multiple antibiotic resistance in Salmonella enterica serotype Paratyphi B in France, 2000–2003, is mainly due to strains harboring Salmonella genomic islands 1, 1-B, and 1-C. Antimicrob Agents Chemother 43 :2567–2574.

    • Search Google Scholar
    • Export Citation
  • 27

    Weill FX, Demartin M, Tandé D, Espie E, Rakotoarivony I, Grimont PAD, 2004. SHV-12-like extended-spectrum-beta-lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J Clin Microbiol 42 :2432–2437.

    • Search Google Scholar
    • Export Citation
  • 28

    Hunter SB, Vauterin P, Lambert-Fair MA, Van Duyne MS, Kubota K, Graves L, Wrigley D, Barrett T, Ribot E, 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J Clin Microbiol 43 :1045–1050.

    • Search Google Scholar
    • Export Citation
  • 29

    Roumagnac P, Weill FX, Dolecek C, Baker S, Brisse S, Chinh NT, Le TAH, Acosta CJ, Farrar J, Dougan G, Achtman M, 2006. Evolutionary History of Salmonella Typhi. Science 31 :1301–1304.

    • Search Google Scholar
    • Export Citation
  • 30

    Sood S, Kapil A, Das B, Jain Y, Kabra SK, 1999. Re-emergence of chloramphenicol-sensitive Salmonella typhi.Lancet 353 :1241–1242.

  • 31

    Navarro F, Llovet T, Echeita MA, Coll P, Aladuena A, Usera MA, Prats G, 1996. Molecular typing of Salmonella enterica serovar Typhi. J Clin Microbiol 34 :2831–2834.

    • Search Google Scholar
    • Export Citation
  • 32

    Wain J, Hien TT, Connerton P, Ali T, Parry CM, Chinh NT, Vinh H, Phuong CX, Ho VA, Diep TS, Farrar JJ, White NJ, Dougan G, 1999. Molecular typing of multiple-antibiotic-resistant Salmonella enterica serovar Typhi from Vietnam: application to acute and relapse cases of typhoid fever. J Clin Microbiol 37 :2466–2472.

    • Search Google Scholar
    • Export Citation
  • 33

    Hampton MD, Ward LR, Rowe B, Threlfall EJ, 1998. Molecular fingerprinting of multidrug-resistant Salmonella enterica sero-type Typhi. Emerg Infect Dis 4 :317–320.

    • Search Google Scholar
    • Export Citation
  • 34

    Nair S, Poh CL, Lim YS, Tay L, Goh KT, 1994. Genome fingerprinting of Salmonella typhi by pulsed-field gel electrophoresis for subtyping common phage types. Epidemiol Infect 113 :391–402.

    • Search Google Scholar
    • Export Citation
  • 35

    Thong KL, Cheong YM, Puthucheary S, Koh CL, Pang T, 1994. Epidemiologic analysis of sporadic Salmonella typhi isolates and those from outbreaks by pulsed-field gel electrophoresis. J Clin Microbiol 32 :1135–1141.

    • Search Google Scholar
    • Export Citation
  • 36

    Thong KL, Puthucheary S, Yassin RM, Sudarmono P, Padmidewi M, Soewandojo E, Handojo I, Sarasombath S, Pang T, 1995. Analysis of Salmonella typhi isolates from Southeast Asia by pulsed-field gel electrophoresis. J Clin Microbiol 33 :1938–1941.

    • Search Google Scholar
    • Export Citation
  • 37

    Shanahan PM, Jesudason MV, Thomson CJ, Amyes SG, 1998. Molecular analysis of and identification of antibiotic resistance genes in clinical isolates of Salmonella typhi from India. J Clin Microbiol 36 :1595–1600.

    • Search Google Scholar
    • Export Citation
  • 38

    Tsen HY, Lin JS, Hu HH, Liu PR, Wang TK, 1999. Use of pulsed field gel electrophoresis as an epidemiological tool for analysis of sporadic associated strains of Salmonella typhi isolated in Taiwan. J Appl Microbiol 86 :761–768.

    • Search Google Scholar
    • Export Citation
  • 39

    Kubota K, Barrett TJ, Ackers ML, Brachman PS, Mintz ED, 2005. Analysis of Salmonella enterica serotype Typhi pulsed-field gel electrophoresis patterns associated with international travel. J Clin Microbiol 43 :1205–1209.

    • Search Google Scholar
    • Export Citation
  • 40

    Echeita MA, Usera MA, 1998. Chromosomal rearrangements in Salmonella enterica serotype Typhi affecting molecular typing in outbreak investigations. J Clin Microbiol 36 :2123–2126.

    • Search Google Scholar
    • Export Citation
  • 41

    Thong KL, Bhutta ZA, Pang T, 2000. Multidrug-resistant strains of Salmonella enterica serotype Typhi are genetically homogenous and coexist with antibiotic-sensitive strains as distinct, independent clones. Int J Infect Dis 4 :194–197.

    • Search Google Scholar
    • Export Citation
Past two years Past Year Past 30 Days
Abstract Views 0 0 0
Full Text Views 196 72 10
PDF Downloads 29 13 0
 
 
 
 
 
 
 
 
 
 
 
 
 
 

 

 

 

CLONAL RECONQUEST OF ANTIBIOTIC-SUSCEPTIBLE SALMONELLA ENTERICA SEROTYPE TYPHI IN SON LA PROVINCE, VIETNAM

FRANÇOIS-XAVIER WEILLCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by FRANÇOIS-XAVIER WEILL in
Current site
Google Scholar
PubMed
Close
,
HOANG HUY TRANCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by HOANG HUY TRAN in
Current site
Google Scholar
PubMed
Close
,
PHILIPPE ROUMAGNACCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by PHILIPPE ROUMAGNAC in
Current site
Google Scholar
PubMed
Close
,
LAËTITIA FABRECentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by LAËTITIA FABRE in
Current site
Google Scholar
PubMed
Close
,
NGUYEN BINH MINHCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by NGUYEN BINH MINH in
Current site
Google Scholar
PubMed
Close
,
TRINE LISE STAVNESCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by TRINE LISE STAVNES in
Current site
Google Scholar
PubMed
Close
,
JORGEN LASSENCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by JORGEN LASSEN in
Current site
Google Scholar
PubMed
Close
,
GUNNAR BJUNECentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by GUNNAR BJUNE in
Current site
Google Scholar
PubMed
Close
,
PATRICK A.D. GRIMONTCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by PATRICK A.D. GRIMONT in
Current site
Google Scholar
PubMed
Close
, and
PHILIPPE J. GUERINCentre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, INSERM U389, Institut Pasteur, Paris, France; National Reference Laboratory of Enteric Pathogens, Department of Bacteriology, National Institute of Hygiene and Epidemiology, Hanoi, Vietnam; Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, Norway; Max-Planck Institut für Infektionsbiologie, Berlin, Germany; Division of Infectious Disease Control, Norwegian Institute of Public Health, Oslo, Norway; Epicentre, Paris, France

Search for other papers by PHILIPPE J. GUERIN in
Current site
Google Scholar
PubMed
Close

In the last three decades, high rates of resistance to common first-line antimicrobial agents have been reported in Salmonella enterica serotype Typhi (Typhi), the causative organism of typhoid fever (TF), in many regions of the world, especially in South East Asia. Analysis of Typhi strains isolated from outbreaks and sporadic cases of TF in Son La province, northwest Vietnam, in 2002 revealed that 94.5% (85/90) of the isolates were fully susceptible to amoxicillin, chloramphenicol, cotrimoxazole, tetracycline, and nalidixic acid. There was a clear decline in the occurrence of multi-drug resistant (MDR) Typhi isolates collected in this province in 2002 (4.4%) compared with the period 1995–1999 in the same province (30.8–100%). By using molecular (IS200 profiling, PstI-ribotyping, XbaI-pulsed-field gel electrophoresis, and haplotyping) and phage-typing methods, we showed that the Typhi isolates from Son La province in 2002 were genetically related; however, they were unrelated to the previous MDR clones established in Vietnam.

INTRODUCTION

Typhoid fever (TF) remains a major health problem in the world, with an estimate of > 20 million cases resulting in > 200,000 deaths during 2000, mostly in developing countries.1 Treatment with appropriate antibiotics is essential for recovery. However, treatment has become progressively more problematic with the gradual emergence of antimicrobial resistance.2 In the last three decades, high rates of resistance to common first-line antimicrobial agents have been reported in Salmonella enterica serotype Typhi (hereafter referred to as Typhi) in many regions of the world.2 Multiple resistance to ampicillin, chloramphenicol, cotrimoxazole, and tetracycline (ACSxtTe resistance type) is encoded by large conjugative plasmids mostly belonging to the incompatibility complex group IncHI.36 The Indian subcontinent and Southeast Asian countries are particularly affected by multidrug resistant (MDR) Typhi strains.2,79 In Vietnam, the spread of MDR Typhi (ACSxtTe R-type) was first reported in 1992–1993 in the southern part of the country.10 In 1994, > 80% of Typhi isolates were MDR in southern Vietnam, but only 5% and 10% of MDRST strains were isolated in the center and the north, respectively.8 During the period 1995–2002, a study found that > 90% of sporadic and epidemic Typhi strains from the center and the north were MDR.8 The economic reforms in Vietnam in the early 1990s had resulted in a boom in private pharmacies and all first line antibiotics for TF could be bought as over-the-counter medicines without prescriptions, leading to misuse and abuse of these drugs.11 Because of the widespread occurrence of MDR Typhi strains, quinolones and fluoroquinolones, in particular, were used in the first-line treatment of adults in several countries, including Vietnam. However, the emergence of MDR Typhi isolates with an additional chromosomally encoded resistance to nalidixic acid (MDR-NalR) and with reduced susceptibility to ciprofloxacin has been increasingly reported since the beginning of the 1990s on the Indian subcontinent and afterwards in different Asian countries.1217 Several reports indicated that MDR-NalR Typhi strains were associated with slower clinical responses to fluoroquinolones or treatment failures.12,18,19 In Vietnam, MDR-NalR Typhi isolates were first reported in 1993 and increased dramatically in 1997 in the south of the country.12,20 As outbreaks of TF are reported every year in various parts of Vietnam, the emergence of MDR-NalR Typhi isolates is of great concern because TF caused by such isolates would require treatment with expensive, third-generation cephalosporins that are unaffordable for most people in Vietnam. Furthermore, the average cost of admission to Vietnamese hospitals (including bed fees, health care professionals, and cost of treatment) for a patient infected with MDR-NalR Typhi has been estimated to be USD 50 compared with USD 22 for a patient infected with a susceptible strain.21

In northern Vietnam, MDR Typhi strains were reported in most provinces: Lao Cai, Lai Chau, Thanh Hoa, and Son La, since the mid-1990s (H. Tran, unpublished results). From July to December 2002, a hospital-based study aiming at identifying risk factors associated with TF in Son La province was conducted by some of us (H.H.T., B.M.N., G.B., and P.J.G.).22 During the study period, three probable outbreaks were detected in three geographically distinct districts: Quynh Nhai district (23 cases, attack rate: 1.6%), in Phu Yen district (32 cases, attack rate: 2.9%), and in Thuan Chau district (28 cases, attack rate: 2.9%). Three risk factors were statistically associated with TF: no education (odds ratio [OR] = 2.0, 95% confidence interval [CI] 1.0–3.7), contact with typhoid case (OR = 3.3, 95% CI 1.7–6.2), and drinking untreated water from streams or wells (OR = 3.9, 95% CI 2.0–7.5).22 As only five cases had a history of travel to Son La, the provincial town, the sources of infection were attributed to carriers from each community. We present here a microbiological comparative study (antibiotyping, molecular, and phage typing) of S. enterica serotype Typhi isolates collected during the previous study to explore how this could help to understand the mode of acquisition of TF in Son La province in 2002.

MATERIALS AND METHODS

Study place.

The research was conducted in Son La province, in northwest Vietnam, 320 km from the capital Hanoi. This province, 80% covered by mountains, is difficult to access. Son La town is the main town of this province, subdivided into nine districts. The standard of living of the population is very low, and income per capita is among the poorest compared with other provinces in Vietnam (USD 130/person/ year).23 TF is of great concern in Son La province with outbreaks reported in several districts from 1998 to 2001.

Patients and sampling.

The patients in this study were recruited for a confirmed TF in provincial and district hospitals of Son La province between 1 July and 30 December 2002, as reported previously.22 One blood and one stool sample were obtained for each patient. Diagnosis of TF was made by isolation of Typhi from blood and/or from stool associated with clinical symptoms compatible with recent TF infection, i.e. fever over 38°C for more than 3 days with no other evident diagnosis to explain this fever.

Origin and identification of Typhi isolates.

Blood samples (5 mL for patients older than 5 years old, and at least 2 mL for children under 5 years old) were inoculated into Brain Heart Infusion broth (Difco, Detroit, MI) and incubated at 35–37°C for 10 days. Vials were checked for growth twice daily on the first 2 days, once on day 3 and day 4, and once on day 10. Positive vials were subcultured on blood, MacConkey, and SalmonellaShigella agar plates (SS agar, Difco). A stool sample was collected at the same time as the blood sample. Stool (3 g) was inoculated into selenite broth enrichment medium (Difco), incubated at 35–37°C for 18–24 hours and then subcultured on MacConkey and SS agar. Identification of Typhi was performed in Son La Health Center Microbiology Department using biochemical tests and agglutination with O, H, and Vi antisera (Difco). Suspected Typhi strains were sent for confirmation to the National Reference Laboratory of Enteric Pathogens, National Institute of Hygiene and Epidemiology (NIHE), Hanoi, Vietnam. Molecular and phage-typing studies were carried out at the French National Reference Center for Salmonella (NRC-Salm), Institut Pasteur, Paris, France. Typhi strains 162/95, 230/95, 14/96, 119/96, 339/ 98, 358/98, and CM2664 collected in Vietnam from 1995 to 2002 and used as comparison strains (CS) were from the NRC-Salm collection. Typhi reference strain Ty-2 was from the WHO Collaborating Center for Reference and Research on Salmonella, Institut Pasteur, Paris, France.

Antimicrobial susceptibility testing.

Antimicrobial susceptibility testing was performed on Typhi isolates from Son-La, 2002 using the Paper Disc Method (PDM-Biodisk, Stockholm, Sweden) at the National Reference Laboratory for Enteropathogenic Bacteria, Norwegian Institute of Public Health, Oslo, Norway, using Clinical and Laboratory Standards Institute (CLSI, formerly National Committee for Clinical Laboratory Standards) guidelines.24,25 The following disks were used: amoxicillin (10 μg), amoxicillin + clavulanic acid (20 μg + 10 μg), streptomycin (30 μg), tetracycline (30 μg), ceftriaxone (30 μg), azithromycin (15 μg), chloramphenicol (30 μg), sulfamethoxazole (23,8 μg), trimethoprim (5 μg), nalidixic acid (30 μg), norfloxacin (10 μg), and ciprofloxacin (10 μg). Escherichia coli ATCC 25922 was used as a control.

To assess temporal changes that may have occurred in the resistance profile of Typhi in Son La province, we also present the results of antimicrobial susceptibility testing of 116 Typhi strains collected during outbreaks or routine surveillance in this province between 1995 and 1999. Isolates were sent to NIHE for confirmation and antibiotic susceptibility testing using the Paper Disc Method (Bio-Rad) on Mueller-Hinton agar according to CLSI guidelines.24,25

Phage typing.

Vi-phage typing of the 90 Typhi isolates from Son La province, 2002 and of the eight CS followed a standardized methodology as described previously.8 Phage suspensions were kindly provided by the Health Protection Agency (Colindale, United Kingdom).

IS200 profiling.

IS200 profiling using PstI (Roche, Mannheim, Germany) for the cleavage of the genomic DNA was performed on 33 selected Typhi isolates from Son La province, 2002, and on eight CS, as described previously.26

Ribotyping.

The membranes used for IS200 profiling were reprobed with digoxigenin (DIG)-labeled OligoMix5 probe as described previously.26 Fifteen Typhi isolates, which exhibited different representative ribotypes, were subjected to the RiboPrinter microbial characterization system (Qualicon, Wilmington, DE), a fully automated and standardized ri-botyping method for creating a database. Ribotype numbering was generated by this system. Image normalization and construction of similarity matrices were carried out using BioNumerics 4.0 (Applied Maths, Sint-Martens-Latem, Belgium). Ribotype profiles were compared with the RiboPrinter database of the NRC-Salm (1997–2004, 339 PstI-ribotypes of Typhi).

Pulsed-field gel electrophoresis.

Pulsed-field gel electrophoresis (PFGE) of XbaI (Roche)-digested genomic DNA was carried out on a subset of 29 Typhi from Son La, 2002, and on eight CS, as described previously.27 The running conditions and the molecular size marker (XbaI-digested DNA from S. enterica serotype Braenderup H9812) were the same as described in the standardized PulseNet protocol.28 Image normalization and construction of similarity matrices were carried out using BioNumerics 4.0. Bands were assigned manually, and clustering was performed using the unweighted pair-group method with arithmetic averages (UPGMA) based on the Dice similarity index, utilizing an optimization parameter of 0.5% and a 1% band-position tolerance. Each profile that differed by one or more bands was assigned a type.

Haplotyping by denaturing high-performance liquid chromatography (DHPLC) analysis.

Fifty-two polymorphic coding gene fragments (Table 1) were amplified from 37 strains, including a subset of 31 Typhi from Son La and 6 CS, as described previously.29 PCR products were amplified over 25 cycles in 25 μL volumes, containing 15 ng of DNA from each of 4 test strains plus a reference strain (CT18), polymerase (1.25 units, Optimase, Transgenomic, Omaha, NE), as well as specific primers (320 nM, Table 1) and dNTPs (0.2 mM). Duplex obtained after the reannealing of denatured PCR fragments were analyzed by DHPLC with a DNA-SepR Cartridge (WaveR Nucleic Acid Fragment Analysis System, Transgenomic) at the temperatures indicated in Table 1. According to the DHPLC profiles, representative PCR products showing evidence of mutations were purified and sequenced from both strands by Agowa (Berlin, Germany).

RESULTS

Origin and antimicrobial susceptibility of Typhi isolates.

A total of 90 Typhi isolates (49 from blood culture only, 8 from both blood and stool culture, and 33 from stool culture only) were recovered from 90 patients with confirmed TF among the 617 patients who were admitted with a suspected TF in Son La province hospitals during the time of the study.22 None of the patients infected with Typhi reported any travel outside the province during the incubation period. The isolates were recovered from patients living in four different areas: Thuan Chau district (N = 28), Phu Yen district (N = 32), Quynh Nhai district (N = 23), and Son La town (N = 7). Isolates from Thuan Chau district were recovered from patients living in two villages: Lai Le Phong Lai (N = 9) and Lai Cang Phong Lai (N = 19) during an outbreak that occurred during weeks 40 and 41 (September–October). Isolates from Phu Yen district were recovered in patients from 11 communities of Yen Ha village during an outbreak that occurred in week 46 in November (N = 31) or afterward in December (N = 1). Isolates from Quynh Nhai district were recovered from patients living in the village of Pac Ma during an outbreak that occurred in weeks 31–34 (July–August, N = 19) or afterward in weeks 38 and 39 (September, N = 4). Isolates from Son La town were sporadically recovered from patients living in three villages—Nam Hua La (N = 2), Ne Nua (N = 3), and Hia Hua La (N = 2)—during weeks 36–40 (September–October).

Antimicrobial susceptibility testing revealed that 94.5% (85/90) of the Typhi isolates collected in 2002 were fully susceptible to amoxicillin, chloramphenicol, trimethoprim, tetracycline, and nalidixic acid (Table 2). Four isolates (4.4%) displayed single resistance to amoxicillin. One isolate displayed single resistance to sulfamethoxazole (1.1%). When compared with the data of 116 Typhi strains collected during routine surveillance in Son La province from 1995 to 1999, the results clearly indicate a decline in the occurrence of MDR and MDR-NalR Typhi isolates collected in this province in recent years (Table 2).

Molecular and phage typing of Typhi isolates.

Vi-phage typing was done for the 90 Typhi isolates from Son La province, 2002. All but five (94.4%) were of phage type A. Four isolates were degraded Vi-strain (DVS) and one was Vi-negative (Table 2).

For the molecular typing study, 33 Typhi isolates from Son La province were selected: 9 from Phu Yen (N = 32), 10 from Thuan Chau (N = 28), 7 from Quynh Nhai (N = 23), and 7 from Son La town (N = 7). We used four molecular methods to study the genotypic relationship among these isolates: PstI-IS200 typing, PstI-ribotyping, XbaI-PFGE (only 29 isolates were typed by PFGE), and the newly described haplotyping by DHPLC.

To compare the Typhi genotypes circulating in Son La province in 2002 to other genotypes previously observed in northern provinces or currently observed in southern Vietnam, we have also tested seven CS recovered from 1995 to 2002 in different provinces of Vietnam and displaying various antimicrobial-resistance phenotypes (Table 3).

Only two PstI-IS200 profiles were observed in our study: profile IS1 was present in the 33 selected Typhi isolates from Son La province, whereas profile IS2 was observed in the 8 CS (including reference strain Ty-2) (Table 3, Figure 1A).

Fifteen PstI-ribotypes were found: 10 (S007, 177, 340, 343–349) in Son La province isolates and 5 (03a, 26a, 187, 236 and 73/34/8) in CS (Table 3, Figure 1B). Ribotype 344 was the most frequently observed ribotype in Son La province isolates (19/33, 57.6%), whereas it was not found in CS.

By using XbaI-PFGE, 14 distinct profiles were found: 9 (X1–X9) in Son La province isolates and 5 (X10–X14) in CS (Table 3, Figure 2A). Profile X1 was the most frequently observed PFGE profile in PFGE-typed Son La province isolates (19/29, 65.5%), whereas it was not found in CS. Profile X2 differed from X1 by an additional low-molecular-weight band of ≈70 kb, possibly corresponding to a plasmid. Profiles X3–X9 differed from X1 by one to four bands > 100 kb. Clustering analysis performed by UPGMA revealed that Typhi isolates from Son La province clustered together (85% similarity) (Figure 2B). A significant genetic diversity was observed between the Son La province isolates and the CS.

Combination of the three classic molecular typing methods results indicated that IS1-344-X1 was the most frequently encountered combined profile in Son La province isolates (12/ 29, 41.4%). This combined profile was observed in outbreak or sporadic isolates collected from Son La town and from all the three districts of the study (Table 3).

By using the newly described haplotyping method, only one haplotype, H68 was obtained among the 31 isolates from Son La (Table 3). This haplotype was characterized by two synonymous single-nucleotide polymorphisms (sSNP) located in the genes HemD and fadD and by an insertion of 17 nucleotides in the gene STY2629, compared with the haplotype of reference CT18. Four additional haplotypes were found in the CS, the haplotype of 162/95 and 119/96 were unique whereas 230/95, 14/96, 358/98, and 339/98 harbored the same haplotype, H58.

DISCUSSION

The present study revealed that almost all of the Typhi isolates collected from four outbreaks and sporadic cases in Son La province, Vietnam, in 2002 were susceptible to classic first line antibiotics. It is an interesting finding because MDR and MDR-NalR Typhi isolates have been established in this province since at least 1995 and 1997, respectively. A decline of MDR Typhi isolates has been noted in India, whereas, in contrast to our study, isolates with a single resistance to nalidixic acid (and a decreased susceptibility to ciprofloxacin) were reported to increase.16,17,30 Throughout Vietnam, emergence of Typhi isolates that are resistant only to nalidixic acid has also been observed since 2002 (H. Le, unpublished data). The discrepancy between the trends of antimicrobial resistance in Son La province and other regions of Vietnam may be explained by differences in geography and access to health care. In Son La province, TF outbreaks were often restricted to small communities living in mountainous areas. Because of poor road quality (it can take 2 days to reach study sites from Son La town) and a very low average income, access to antibiotics is limited. In richer Vietnamese regions, antibiotics can be bought over the counter and self-medication is common.

The genetic relatedness of the Typhi strains isolated in Son La province in 2002 was assessed using phage typing and four molecular typing methods. All but four isolates from Son La in 2002 were of phage type A. The remaining isolates could not be typed (DVS and Vi negative). In a previous study, E1 (N = 38) and E3 (N = 24) were the most frequent phage types observed in 81 epidemiologically independent MDR Typhi isolates collected throughout Vietnam during 1995–2002.8 In another study, untypeable Vi (UVS) and E1 were the most frequent phage types found in four outbreaks caused by MDR or MDR-NalR Typhi isolates in Vietnam during 1993–1997.7

Haplotyping revealed that the strains isolated in Son La bore a unique haplotype, H68, which was characterized by combination of 2 sSNP located in the genes HemD and fadD and a 17-bp insertion located in the gene STY2629 (Figure 3). The HemD SNP was common among Vietnamese strains, whereas the 17-bp insertion was Son La-specific. This insertion was not present among 480 worldwide strains, including 149 susceptible MDR and MDR-NalR Typhi strains isolated from several Vietnamese regions.29 In addition, XbaI-PFGE, considered the method of choice for subtyping Typhi, revealed that the Son La isolates were highly related with profiles clustering into the same group with a similarity of 85%.5,7,9,3139 The ribotyping results were more difficult to interpret. One ribotype, 344, was found in 57.6% of the isolates. Seven isolates with a predominant PFGE profile, X1, showed ribotypes other than 344. For these isolates, we could have performed PFGE with another restriction enzyme to check if these isolates belonged to the same or to different clones. However, in studies involving Typhi, use of additional enzymes did not significantly enhance the discriminatory power of XbaI-PFGE alone.35,36,39 Rather than suggesting different clones, ribotyping results could be explained by possible homologous recombinations between rrn operons of related isolates, as previously described by Echeita and Usera.40 As these rearrangements can dramatically modify the ribotype and subsequently disturb cluster analysis, ribotyping should be used with caution and concomitantly with other methods like PFGE during epidemiologic investigations.

It remains difficult to define whether the Son La clone had emerged from a local strain or had been imported. Only a single earlier isolate from Son La province was available for the present study (other isolates were not stored). This MDR-NalR isolate (14/96) collected in 1996 was characterized by a different haplotype, IS200-type, and phage type in comparison with the 2002 clone. This 14/96 isolate was similar to 230/95, an MDR isolate collected in 1995 in Than Hoa province, located near Son La province. They both belong to the H58 haplotype, which is now found predominantly in Vietnam and South Asia in MDR and MDR-NalR Typhi strains.29 This suggests that the Son La susceptible clone did not emerge from a plasmid-purged MDR Typhi strain.

In the absence of earlier isolates collected in Son La province, we have no information on when exactly the clone emerged in this province. Molecular analysis performed in the past showed that, in contrast to MDR, susceptible Typhi strains displayed extensive genetic heterogeneity.35,41 The very weak genetic diversity of the Son La clone suggests that it might have emerged rather recently in Son La province. This susceptible clone could have been established in Son La province as early as 1997, when MDR isolates were reported to decrease, or as late as 2002. It could have been acquired before circulation of MDR or MDR-NalR Typhi isolates and maintained in chronic carrier(s) until favorable epidemiologic conditions associated with the disappearance of antibiotic selective pressure, leading to its dissemination in Son La province. In the first hypothesis, the circulation of this clone during the last decade might have resulted in a network of carriers harboring the same or a closely derived strain and being the source of small independent outbreaks in distinct communities. In the second hypothesis, the three outbreaks and the sporadic cases of 2002 were related. The previous epidemiologic study did not support this hypothesis. However, the possibility of a village-to-village dissemination during the 10-week period by healthy carriers was not investigated (only TF cases were investigated). Healthy carriers could have contaminated people through point source contaminated food or more probably through water from wells or streams. Drinking untreated water and poor hygiene habits were among the risk factors found to be associated with TF in the province (83/90 cases and 149/180 controls).22 Nevertheless, in the absence of earlier isolates, the cause(s) that should explain the Son La province scale replacement of the MDR/MDR-NalR Typhi strains by a single susceptible clone described herein remain(s) unclear. The Son La paradox sheds light on the possible shift from multiresistant populations to a susceptible population in one region where TF is already endemic. Understanding the epidemiologic situation that has led to this shift of populations in Son La would be very important for TF control.

The finding that four amoxicillin-resistant isolates have been detected among isolates belonging to the emerging or re-emerging clone(s) indicates that acquisition of resistance determinants is already started. Reasons for emergence of resistance are well documented and are most probably preventable. A resurgence of MDR and MDR-NalR Typhi isolates in Son La province, whatever their clonal lineage, should be prevented by the use of classic first-line antibiotics adapted to the results of the monitoring of antimicrobial susceptibility when feasible. Education of health professionals to ensure appropriate antibiotic prescriptions and education of patients to avoid self-medication should be emphasized.

Table 1

Polymorphic gene fragments tested by denaturing HPLC analysis on Typhi strains isolated from Son La province, Vietnam, 1995–2002

GeneFragment length (bp)DHPLC temp (°C)5′–3′ Forward/reverse primers
STY000648360.7CAGTTTCCGTTGTCGCAG/TCGTATCCCCCTCACCCT
STY013549760.8TACGTGACGTCCGATGTAGG/GGATAGACATGCTCGCTGC
STY017542861.4CACATCTCTCCGGGCATCTA/CCTGCAAAGATGCCTTCC
STY021448263.2TGGGACGTCATGAATGGC/CGCCTGAGTCACATTCAGAG
STY032144064.0GTTACTGCACCGCACACAGA/CAGGGAAGTGGTCTTCGTTG
STY033646260.0CCAGGGACTTATCGAGTGGA/GACACGCCACGCACCTATAT
STY057342962.9GATAACCCGTTGGTGGGG/ACCGTGACGATGGACCAC
STY083143662.9CCCGGCAACTATGAGCTG/GCCCTATGGTCTGAATCAGG
STY096143461.4CTGTATGGCACCGGTCAAC/GGAACCCAGACTTCGAGGT
STY096250060.5GACGCAAGAAGAGTGGATGC/CGATATGAACTTCGCCGC
STY109746762.1TACCCGTGAACACGTTCG/GGAACGTACGGGCAGTAATC
STY112143559.6CGCATTTGATCCTCGACC/ACTCACGCATAACGGGCA
STY128641562.9GAACTCCTGGCAGCTTGC/CACCGACTCTCACACCCAA
STY132741162.4CTCCAGAATTGGCTGTAGGG/GAGCTGCTGACCCGACTA
STY155643261.9GGTTTTCATCCCCGGAAC/GGGCGTAACTTCGTCACCTT
STY169343060.7CAGCTCAGGGTCCCCATA/AACTGCACCGTGTGCCTT
STY172041159.3CCTGCGGCCATATAAGCTAC/TCAGGAGGCAAGCAATGC
STY180843561.2GCATGGTCCTGACATTCCC/CGAGTATGGTTCGGCAGG
STY191943663.4ACAGTTCGGCCTACGAGGT/GCCACCTGAGGAATAGCG
STY194745462.7GACCGCCCACAGGTTTTC/GCCGGAACCTCTGATTGA
STY194841861.0CGACAACCTCGGGTTTGAC/CAACAAGGGCTGGGACTC
STY209341661.3GTTAACTCACCTGTCTGCCC/CCTCACGGCGGTACTAAGGT
STY221146261.7CTCGTAACCCTCCACAGTGC/AGACGGCAGACGGTCTGTT
STY228165165GTCGGTCTGTATATTCCCGG/GGTAATCGCATCCACCAAATC
STY238950060.7CGAGCCGAGTTTACACTGC/CGGGAGCAATTACGTGTG
STY244147662.9CGTATGTTCGCTGGACTCG/CAGACTGGGAACGCTTTG
STY251340864.1CCTGTCATGGCGAAGACAC/TTCACAGACCAGGCTACGGT
STY257543961.5ACAAGAGGAGAAGCTGCTCG/CAGCTCATCCGATACGCA
STY262145864.1GCGGCACATAGGTCGTCA/TGTGCTGGGTACGGGAAT
STY262943555.6GGAGAACTACTCCGTGGAGG/CGGGACTGGTCCAATGAA
STY271140762.1CCCGGAGATTGGCTATACG/CTTTTACGCTCTGGGCTTCC
STY278547463.4AGTACATGCAGGCCTGCC/GGGCATCGACTTAGGCACT
STY283447961.3GTTTCATCCCACTGCCCT/CGGACCAGCCGTACACTAAG
STY287743462.3AATGGCTAACCTGTGCGG/GCGTCAGGTTCTCTCGTAGG
STY294842363.2AGACGTCCGCCGTTAGATC/GCTCCACCGATTTGGGTA
STY297146863.2ATATTCGGCGTGCTCAGC/GTTCTACGTCCACCGTGGTA
STY303340962.3ATCGGCAGTTACGTTCCG/CATAGCTCTTACTTGCCGCG
STY308241362.9CGGAGTGCTGAGTCGGTT/CGGGGAAGTGTTCGTTACTG
STY319641061.0CCAGACCCCAGCTCTTCTC/GGACATGTACCTGCGTATCG
STY344441361.0ACGTCCCTTACCACAACTGC/GAAAGGCGTGTAAGCCCAC
STY349944462.1CAGGTTGAGCTAACGCCC/CGGGATAACGTACTCCGG
STY350744860.0CTGTTCGTAGGTCAGGGAGA/AGAGTCAAGGCAGCGACTG
STY361445861.3GATGGACTATCACGTTCCGG/GAGCCTCGCAATGTATAGCC
STY362256763.8GTGGCCTGGAGTTTTCCACT/GACCAATAGCCGACAGCGTAG
STY387641862.1GCGAGCGATTAGCCACTATC/CACGCGTAACAGACGAGTCT
STY394040460.1CGTGTATATGCACTCCGAGC/CGTTAGAGCGTAGACGCTTG
STY441743161.8CGAGTTCTGGGACTGGGTC/CGATAAAGTCACACGGCACC
STY449943663.2CGCGACCTACGATAATGG/AGCACCCACTATTACGACGC
STY454546762.1GTGACCGAACCCCAGTTCTA/TCGAGACGTAACGCTGAGGT
STY456249958.5CAACAGGCTCCGGAGTTGT/GTAACCGCTGGCTACTCCCT
STY479344461.1TGGATGCCACTCCTGACAC/GGCATGACCAACCCACAC
STY485140458.3AACATACCCCCAGCTCTCG/CATCCTAAGTGGCGTGACAG
Table 2

Antibiotic susceptibility of Typhi strains isolated from Son La province, Vietnam, 1995–2002

% Resistance
Antibiotic1995 (n = 15)1996 (n = 27)1997 (n = 28)1998 (n = 33)1999 (n = 13)2002 (n = 90)
ND, not determined.
Amoxicillin10063.092.972.730.84.4
Ceftriaxone000000
Tetracycline10066.792.963.630.80
Cotrimoxazole93.363.092.972.730.80
Chloramphenicol066.792.972.730.80
Nalidixic acid003.627.37.70
Norfloxacin000000
CiprofloxacinNDNDNDNDND0
Table 3

Characteristics of 33 selected Typhi isolates from Son La province, Vietnam, 2002, and of 8 Typhi comparison strains*

Geographic origin
IsolateDateOriginSex/age group†ProvinceDistrictVillageAntimicrobial resistance pattern‡Phage typeIS200 typeRibo-typePFGE typeHaplo-type
* Abbreviations: ND, not determined; DVS, degraded Vi strain.
† Age group I, < 1 year; II, 1–5 years; III, 6–14 years; IV, 15–64 years; V, > 65 years.
‡ Antimicrobial resistance patterns: A, amoxicillin; C, chloramphenicol; Sul, sulfonamides, Tp, trimethoprim; Te, tetracycline; Nal, nalidixic acid.
§ Ha Bac, Ha Tay, and Than Hoa are northern provinces of Vietnam. HCM, Ho Chin Minh City (HCMC) is in southern Vietnam.
Outbreak 1 (23 cases)
    114/08BloodF/IVSon LaQuynh NhaiPac MaSusceptibleAIS1349X9H68
    311/08BloodF/IIISon LaQuynh NhaiPac MaSusceptibleAIS1343X1H68
    710/08BloodM/IVSon LaQuynh NhaiPac MaSusceptibleAIS1344X1H68
    910/08BloodM/IVSon LaQuynh NhaiPac MaSusceptibleAIS1S007X1H68
    1324/09BloodM/IVSon LaQuynh NhaiPac MaSusceptibleAIS1344X1H68
    1511/08BloodM/IVSon LaQuynh NhaiPac MaSusceptibleAIS1344X1H68
    1922/09StoolsM/IVSon LaQuynh NhaiPac MaSusceptibleAIS1348X6H68
Sporadic cases (7 cases)
    2304/08BloodF/IVSon LaSon La townNamAAIS1S007X5H68
    2418/09StoolsF/IVSon LaSon La townNamSusceptibleAIS1344X1H68
    2520/09BloodM/IVSon LaSon La townNe NuaSusceptibleAIS1344X1H68
    2608/09BloodM/IVSon LaSon La townNe NuaADVSIS1345X1H68
    2709/09StoolsM/IVSon LaSon La townHiaSusceptibleAIS1344X9H68
    2823/09BloodF/IVSon LaSon La townHiaSusceptibleAIS1340X4H68
    3010/09BloodM/IVSon LaSon La townNe NuaSusceptibleAIS1344NDH68
Outbreak 2 (28 cases)
    3101/10StoolsM/IVSon LaThuan ChauLai LeSusceptibleAIS1344NDH68
    3301/10StoolsF/IVSon LaThuan ChauLai LeSusceptibleAIS1345X1H68
    3601/10StoolsF/IVSon LaThuan ChauLai LeSusceptibleAIS1344X1H68
    3910/10BloodF/IVSon LaThuan ChauLai LeSusceptibleDVSIS1344X1H68
    4001/10StoolsM/IVSon LaThuan ChauLai CangAAIS1344X2H68
    4101/10BloodF/IVSon LaThuan ChauLai CangSusceptibleAIS1344NDH68
    4601/10StoolsF/IVSon LaThuan ChauLai CangSulAIS1347X1H68
    4802/10BloodF/IVSon LaThuan ChauLai CangSusceptibleAIS1344X1H68
    5204/10StoolsF/IVSon LaThuan ChauLai CangSusceptibleAIS1344X1H68
    5510/10StoolsF/IVSon LaThuan ChauLai CangSusceptibleAIS1346X3H68
Outbreak 3 (32 cases)
    5913/10BloodM/IVSon LaPhu YenYen HaSusceptibleAIS1344X1H68
    6113/10StoolsM/IVSon LaPhu YenYen HaSusceptibleAIS1S007X1H68
    6513/10BloodM/IVSon LaPhu YenYen HaSusceptibleAIS1344X1H68
    6813/10BloodM/IVSon LaPhu YenYen HaSusceptibleAIS1177X8H68
    7213/10BloodM/IVSon LaPhu YenYen HaSusceptibleAIS1177X8H68
    7413/10BloodM/IVSon LaPhu YenYen HaSusceptibleAIS1344X7H68
    7813/10StoolsM/IVSon LaPhu YenYen HaSusceptibleAIS1S007X1H68
    8512/10StoolsM/IVSon LaPhu YenYen HaSusceptibleAIS1344X1H68
    8912/10StoolsM/IVSon LaPhu YenYen HaSusceptibleAIS1344NDH68
Comparison strains
    162/95Sep 95Ha Bac§SusceptibleAIS2187X12H75
    119/96Jan 96Ha Tay§SusceptibleM3IS226aX13H50
    230/95Oct 95Than Hoa§ACSulTpTeE1IS2236X10H58
    14/96Jan 96Son LaACSulTpTeE1IS2236X10H58
    339/981998Ha TayACSulTpTeNalE1IS203aX11H58
    358/98Jan 98Than HoaACSulTpTeNalE1IS203aX11H58
CM2664Jun 02HCMC§ACSulTpTeNalE1IS203aX11ND
Ty-2Reference strainNDNDIS273/34/8X14H10
Figure 1.
Figure 1.

Representative IS200 profiles A, and PstI-ribotypes B, obtained from the 33 selected Typhi isolates and the 8 comparison strains under study. A, Lanes 1–9, IS1 type; lane 10, IS2 type. B, Image generated by BioNumerics. M, Riboprinter marker size (band sizes in kilobase pairs). Ribotype numbering according to BBPE-Unit database is indicated. Asterisks indicate the ribotypes observed in isolates from Son La province, 2002.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1174

Figure 2.
Figure 2.

A, Representative XbaI-PFGE profiles obtained from the 29 typed Typhi isolates and the 8 comparison strains under study. M, S. enterica serotype Braenderup H9812 used as the molecular size marker (band sizes in kilobase pairs). PFGE profile numbering is indicated. B, Dendrogram generated by BioNumerics showing the results of cluster analysis on the basis of PFGE fingerprinting. Similarity analysis was performed using the Dice coefficient, and clustering was by UPGMA. Numbers in parentheses refer to the number of isolates with the indicated PFGE profile.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1174

Figure 3.
Figure 3.

Minimal spanning tree of 38 strains based on DHPLC analysis of 52 polymorphic genes (Table 1). The tree shows 5 haplotypes (nodes) plus two hypothetical nodes (missing links) indicated by dashed lines. Size of circles reflects numbers of isolates. Each edge reflects a single mutation. The genes that bore the mutations, which also separate H68 from H1, are annotated (arrows) along three edges.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 6; 10.4269/ajtmh.2007.76.1174

*

Address correspondence to François-Xavier Weill, Centre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France. E-mail: fxweill@pasteur.fr

Authors’ addresses: François-Xavier Weill, Laëtitia Fabre, and Patrick A.D. Grimont, Centre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris cedex 15, France, Telephone: +33 (0)1 45 68 83 45, Fax: +33 (0)1 45 68 88 37, E-mails: fxweill@pasteur.fr, lberland@pasteur.fr, and pgrimont@pasteur.fr. Hoang Huy Tran and Nguyen Binh Minh, Enteric Pathogens Laboratory, Microbiology Department, National Institute of Hygiene and Epidemiology (NIHE), Hanoi, Vietnam, Telephone: +844 821 24 17 or +844 858 91 55, E-mails: H.H.Tran@rhul.ac.uk and binhminh@fpt.vn. Philippe Roumagnac, Max-Planck Institut für Infektionsbiologie, Schumannstr. 21/22, 10117 Berlin, Germany. Telephone: +49 30 28460202, Fax: +49 30 28460111, E-mail: roumagnac@mpiib-berlin.mpg.de. Trine Lise Stavnes and Jorgen Lassen, Division of Infectious Disease Control, Norwegian Institute of Public Health, P.O. Box 4404, Nydalen, N-0403, Oslo, Norway, Telephone: +47 22 04 22 00, Fax: +47 22 35 36 05, E-mails: Trine-Lise.Stavnes@fhi.no and Jorgen.Lassen@fhi.no. Gunnar Bjune, Department of International Health, Institute of General Practice and Community Medicine, University of Oslo, P.B. 1130, Blindern, 0318, Oslo, Norway, Telephone: +47 22 85 06 40, Fax: +47 22 85 06 72, E-mail: g.a.bjune@medisin.uio.no. Philippe J. Guerin, Norwegian Institute of Public Health, Oslo, Norway, and Epicentre, 8 rue Saint Sabin, 75011 Paris, France, Telephone: +33 (0)1 40 21 28 48, Fax: +33 (0)1 40 21 28 03, E-mail: philippe.guerin@epicentre.msf.org.

Acknowledgments: The authors thank Mark Achtman for his support, the director and staff of the Son La Health Centre for their work and support, and Rebecca Smith for English corrections.

Financial support: The study was supported by the Norwegian Government (Quota Programme); the Department for International Health, Institute for General Practice and Community Medicine, University of Oslo, Norway. The Norwegian Institute of Public Health, Oslo, the National Institute of Hygiene and Epidemiology, Hanoi, Vietnam, and the Institut Pasteur, Paris, France, provided the support to perform the different laboratory exams.

REFERENCES

  • 1

    Crump JA, Luby SP, Mintz ED, 2004. The Global Burden of Typhoid Fever. Bull WHO 82 :346–353.

  • 2

    Wain J, Kidgell C, 2004. The emergence of multidrug resistance to antimicrobial agents for the treatment of typhoid fever. Trans R Soc Trop Med Hyg 98 :423–430.

    • Search Google Scholar
    • Export Citation
  • 3

    Rowe B, Ward LR, Threlfall EJ, 1990. Spread of multiresistant Salmonella typhi.Lancet 337 :1065.

  • 4

    Fica A, Fernandez-Beros ME, Aron-Hott L, Rivas A, D’Ottone K, Chumpitaz J, Guevara JM, Rodriguez M, Cabello F, 1997. Antibiotic-resistant Salmonella typhi from two outbreaks: few ribotypes and IS200 types harbor Inc HI1 plasmids. Microb Drug Resist 3 :339–343.

    • Search Google Scholar
    • Export Citation
  • 5

    Mirza S, Kariuki S, Mamun KZ, Beeching NJ, Hart CA, 2000. Analysis of plasmid and chromosomal DNA of multidrug-resistant Salmonella enterica serovar typhi from Asia. J Clin Microbiol 38 :1449–1452.

    • Search Google Scholar
    • Export Citation
  • 6

    Wain J, Diem Nga LT, Kidgell C, James K, Fortune S, Song Diep T, Ali T, O Gaora P, Parry C, Parkhill J, Farrar J, White NJ, Dougan G, 2003. Molecular analysis of Inc HI1 antimicrobial resistance plasmids from Salmonella serovar Typhi strains associated with typhoid fever. Antimicrob Agents Chemother 47 :2732–2739.

    • Search Google Scholar
    • Export Citation
  • 7

    Connerton P, Wain J, Hien TT, Ali T, Parry C, Chinh NT, Vinh H, Ho VA, Diep TS, Day NP, White NJ, Dougan G, Farrar JJ, 2000. Epidemic typhoid in Vietnam: molecular typing of multiple-antibiotic-resistant Salmonella enterica serotype Typhi from four outbreaks. J Clin Microbiol 38 :895–897.

    • Search Google Scholar
    • Export Citation
  • 8

    Le TA, Lejay-Collin M, Grimont PA, Hoang TL, Nguyen TV, Grimont F, Scavizzi MR, 2004. Endemic, epidemic clone of Salmonella enterica serovar Typhi harboring a single multi-drug-resistant plasmid in Vietnam between 1995 and 2002. J Clin Microbiol 42 :3094–3099.

    • Search Google Scholar
    • Export Citation
  • 9

    Lee K, Yong D, Yum JH, Lim YS, Kim HS, Lee BK, Chong Y, 2004. Emergence of multidrug-resistant Salmonella enterica serovar Typhi in Korea. Antimicrob Agents Chemother 48 :4130–4135.

    • Search Google Scholar
    • Export Citation
  • 10

    Nguyen TA, Ha Ba K, Nguyen TD, 1993. La fièvre typhoïde au Sud Vietnam, 1990–1993. Bull Soc Pathol Exot 86 :476–478.

  • 11

    Van Duong D, Binns CW, Van Le T, 1997. Availability of antibiotics as over-the-counter drugs in pharmacies: a threat to public health in Vietnam. Trop Med Int Health 2 :1133–1139.

    • Search Google Scholar
    • Export Citation
  • 12

    Wain J, Hoa NT, Chinh NT, Vinh H, Everett MJ, Diep TS, Day NP, Solomon T, White NJ, Piddock LJ, Parry CM, 1997. Quinolone-resistant Salmonella typhi in Viet Nam: molecular basis of resistance and clinical response to treatment. Clin Infect Dis 25 :1404–1410.

    • Search Google Scholar
    • Export Citation
  • 13

    Mermin JH, Villar R, Carpenter J, Roberts L, Samaridden A, Gasanova L, Lomakina S, Bopp C, Hutwagner L, Mead P, Ross B, Mintz ED, 1999. A massive epidemic of multidrug-resistant typhoid fever in Tajikistan associated with consumption of municipal water. J Infect Dis 179 :1416–1422.

    • Search Google Scholar
    • Export Citation
  • 14

    Threlfall EJ, Ward LR, 2001. Decreased susceptibility to ciprofloxacin in Salmonella enterica serotype Typhi, United Kingdom. Emerg Infect Dis 7 :448–450.

    • Search Google Scholar
    • Export Citation
  • 15

    Hirose K, Hashimoto A, Tamura K, Kawamura Y, Ezaki T, Sagara H, Watanabe H, 2002. DNA sequence analysis of DNA gyrase and DNA topoisomerase IV quinolone resistance-determining regions of Salmonella enterica serovar Typhi and serovar Paratyphi A. Antimicrob Agents Chemother 46 :3249–3252.

    • Search Google Scholar
    • Export Citation
  • 16

    Madhulika U, Harish BN, Parija SC, 2004. Current pattern in antimicrobial susceptibility of Salmonella Typhi isolates in Pondicherry. Indian J Med Res 120 :111–114.

    • Search Google Scholar
    • Export Citation
  • 17

    Renuka K, Kapil A, Kabra SK, Wig N, Das BK, Prasad VV, Chaudhry R, Seth P, 2004. Reduced susceptibility to ciprofloxacin and gyrA gene mutation in North Indian strains of Salmonella enterica serotype Typhi and serotype Paratyphi A. Microb Drug Resist 10 :146–153.

    • Search Google Scholar
    • Export Citation
  • 18

    Threlfall EJ, Ward LR, Skinner JA, Smith HR, Lacey S, 1999. Ciprofloxacin-resistant S. typhi and treatment failure. Lancet 353 :1590–1591.

    • Search Google Scholar
    • Export Citation
  • 19

    Butt T, Ahmad RN, Mahmood A, Zaidi S, 2003. Ciprofloxacin treatment failure in typhoid fever case, Pakistan. Emerg Infect Dis 9 :1621–1622.

    • Search Google Scholar
    • Export Citation
  • 20

    Parry C, Wain J, Chinh NT, Vinh H, Farrar JJ, 1998. Quinolone-resistant Salmonella typhi in Vietnam. Lancet 351 :1289.

  • 21

    Parry CM, 1998. Untreatable infections? The challenge of the 21st century. Southeast Asia J Trop Med Public Health 29 :416–424.

  • 22

    Tran HH, Bjune G, Nguyen BM, Rottingen JA, Grais FR, Guerin PJ, 2005. Risk factors associated with typhoid fever in Son La province, northern Vietnam. Trans R Soc Trop Med Hyg 99 :819–826.

    • Search Google Scholar
    • Export Citation
  • 23

    Khai SH, 2003. Rational land use planning based on community in Northern hilly and mountainous region. United Nations Development Project reports. Available from: http://www.undp.org.vn/projects/vie96010/cemma/RAS93103/005.htm.

  • 24

    National Committee for Clinical Laboratory Standards, 2000. Performance standards for antimicrobial disk susceptibility tests. NCCLS Document M2-A7. National Committee for Clinical Laboratory Standards, Wayne, Pa.

  • 25

    National Committee for Clinical Laboratory Standards, 2002. Performance standards for antimicrobial disk susceptibility testing. Twelfth informational supplement. NCCLS Document MS100-S12. National Committee for Clinical Laboratory Standards. Wayne, Pa.

  • 26

    Weill FX, Fabre L, Grandry B, Grimont PAD, Casin I, 2005. Multiple antibiotic resistance in Salmonella enterica serotype Paratyphi B in France, 2000–2003, is mainly due to strains harboring Salmonella genomic islands 1, 1-B, and 1-C. Antimicrob Agents Chemother 43 :2567–2574.

    • Search Google Scholar
    • Export Citation
  • 27

    Weill FX, Demartin M, Tandé D, Espie E, Rakotoarivony I, Grimont PAD, 2004. SHV-12-like extended-spectrum-beta-lactamase-producing strains of Salmonella enterica serotypes Babelsberg and Enteritidis isolated in France among infants adopted from Mali. J Clin Microbiol 42 :2432–2437.

    • Search Google Scholar
    • Export Citation
  • 28

    Hunter SB, Vauterin P, Lambert-Fair MA, Van Duyne MS, Kubota K, Graves L, Wrigley D, Barrett T, Ribot E, 2005. Establishment of a universal size standard strain for use with the PulseNet standardized pulsed-field gel electrophoresis protocols: converting the national databases to the new size standard. J Clin Microbiol 43 :1045–1050.

    • Search Google Scholar
    • Export Citation
  • 29

    Roumagnac P, Weill FX, Dolecek C, Baker S, Brisse S, Chinh NT, Le TAH, Acosta CJ, Farrar J, Dougan G, Achtman M, 2006. Evolutionary History of Salmonella Typhi. Science 31 :1301–1304.

    • Search Google Scholar
    • Export Citation
  • 30

    Sood S, Kapil A, Das B, Jain Y, Kabra SK, 1999. Re-emergence of chloramphenicol-sensitive Salmonella typhi.Lancet 353 :1241–1242.

  • 31

    Navarro F, Llovet T, Echeita MA, Coll P, Aladuena A, Usera MA, Prats G, 1996. Molecular typing of Salmonella enterica serovar Typhi. J Clin Microbiol 34 :2831–2834.

    • Search Google Scholar
    • Export Citation
  • 32

    Wain J, Hien TT, Connerton P, Ali T, Parry CM, Chinh NT, Vinh H, Phuong CX, Ho VA, Diep TS, Farrar JJ, White NJ, Dougan G, 1999. Molecular typing of multiple-antibiotic-resistant Salmonella enterica serovar Typhi from Vietnam: application to acute and relapse cases of typhoid fever. J Clin Microbiol 37 :2466–2472.

    • Search Google Scholar
    • Export Citation
  • 33

    Hampton MD, Ward LR, Rowe B, Threlfall EJ, 1998. Molecular fingerprinting of multidrug-resistant Salmonella enterica sero-type Typhi. Emerg Infect Dis 4 :317–320.

    • Search Google Scholar
    • Export Citation
  • 34

    Nair S, Poh CL, Lim YS, Tay L, Goh KT, 1994. Genome fingerprinting of Salmonella typhi by pulsed-field gel electrophoresis for subtyping common phage types. Epidemiol Infect 113 :391–402.

    • Search Google Scholar
    • Export Citation
  • 35

    Thong KL, Cheong YM, Puthucheary S, Koh CL, Pang T, 1994. Epidemiologic analysis of sporadic Salmonella typhi isolates and those from outbreaks by pulsed-field gel electrophoresis. J Clin Microbiol 32 :1135–1141.

    • Search Google Scholar
    • Export Citation
  • 36

    Thong KL, Puthucheary S, Yassin RM, Sudarmono P, Padmidewi M, Soewandojo E, Handojo I, Sarasombath S, Pang T, 1995. Analysis of Salmonella typhi isolates from Southeast Asia by pulsed-field gel electrophoresis. J Clin Microbiol 33 :1938–1941.

    • Search Google Scholar
    • Export Citation
  • 37

    Shanahan PM, Jesudason MV, Thomson CJ, Amyes SG, 1998. Molecular analysis of and identification of antibiotic resistance genes in clinical isolates of Salmonella typhi from India. J Clin Microbiol 36 :1595–1600.

    • Search Google Scholar
    • Export Citation
  • 38

    Tsen HY, Lin JS, Hu HH, Liu PR, Wang TK, 1999. Use of pulsed field gel electrophoresis as an epidemiological tool for analysis of sporadic associated strains of Salmonella typhi isolated in Taiwan. J Appl Microbiol 86 :761–768.

    • Search Google Scholar
    • Export Citation
  • 39

    Kubota K, Barrett TJ, Ackers ML, Brachman PS, Mintz ED, 2005. Analysis of Salmonella enterica serotype Typhi pulsed-field gel electrophoresis patterns associated with international travel. J Clin Microbiol 43 :1205–1209.

    • Search Google Scholar
    • Export Citation
  • 40

    Echeita MA, Usera MA, 1998. Chromosomal rearrangements in Salmonella enterica serotype Typhi affecting molecular typing in outbreak investigations. J Clin Microbiol 36 :2123–2126.

    • Search Google Scholar
    • Export Citation
  • 41

    Thong KL, Bhutta ZA, Pang T, 2000. Multidrug-resistant strains of Salmonella enterica serotype Typhi are genetically homogenous and coexist with antibiotic-sensitive strains as distinct, independent clones. Int J Infect Dis 4 :194–197.

    • Search Google Scholar
    • Export Citation

Author Notes

Reprint requests: François-Xavier Weill, Centre National de Référence des Salmonella, Centre Collaborateur OMS de Référence et de Recherche pour les Salmonella, Unité de Biodiversité des Bactéries Pathogènes Emergentes, Institut Pasteur, 28 rue du Docteur Roux, 75724 Paris Cedex 15, France, Telephone: +33 (0)1 45 68 83 45, Fax: +33 (0)1 45 68 88 37, E-mail: fxweill@pasteur.fr.
Save