INTRODUCTION
Identifying arthropod-borne viruses present in field-collected specimens can be problematic and may require extensive amounts of time, particularly when the samples are from regions of the world where diverse assortments of arthropods and viruses co-circulate (e.g., the Amazon Basin region of Peru in South America). For traditional virus identification, antibody must be prepared against the new virus isolate and then that virus and antibody combination must be tested against other known, closely related viruses and antibody preparations to determine the relative relationship of the new virus isolate with the known viruses and antibodies used in the detection-characterization assay. Not only is this time-consuming and expensive, but if the actual virus is not included in the characterization assay, then the virus isolate might mistakenly be declared a new virus (e.g., Zinga is really Rift Valley fever virus).1 The advent of molecular diagnostic tools has allowed the development of rapid and specific assays for numerous viruses across many virus families. Once a virus has been isolated and generically characterized by using a broadly cross-reactive test (e.g., an immunofluorescence assay [IFA] using polyclonal sera), a series of polymerase chain reaction (PCR) primers can be designed and used to confirm the identity of the virus. In many cases, the sequence determined from the PCR amplicon can be used for determining the genetic relationship of the new virus isolate with other viruses isolated from the same region or from different regions of the world. This in turn may provide clues as to virus maintenance mechanisms and the sources of virus infections in the local population.
During our examination of more than 160 virus isolates from the Amazon Basin region of Peru,2 we developed an approach that allowed us to rapidly identify members of the Alphavirus and Flavivirus genera and to obtain sequence information that allowed us to compare directly the relationship between these viruses and to other viruses isolated in the same region. Over the five years of the study, eastern equine encephalomyelitis virus (EEEV) was the most commonly isolated virus. Infection with EEEV in either humans or equines can result in a serious, often fatal disease3 and is an important public health concern in North and South America. Although EEEV is transmitted by mosquitoes in North America (primarily east of the Mississippi River) and in South America, the strains of virus circulating in these two regions differ significantly.4 Eastern equine encephalomyelitis virus can be separated into four subtypes, based on genetic information.4,5 These include one subtype found in North America, Lineage I (isolates from North America), and three subtypes found in South America, Lineage II (Brazil-Peru) (isolates found in Brazil, Guatemala, and Peru), Lineage III (Argentina-Panama) (isolates found in Argentina, Brazil, Colombia, Ecuador, Guiana, Panama, Peru, Trinidad, and Venezuela), and Lineage IV (a single isolate from Brazil).5 This report will examine the genetic relationship of 38 isolates of EEEV made from mosquitoes captured in the Amazon Basin region of Peru from 1996 until 2001 and will compare these results with published data for other South American isolates of EEEV.
METHODS
Virus isolation and identification.
Table 1 lists the South America EEEV isolates that were identified and for which the sequences of the nonstructural protein 3 (nsP3) and envelope 2 (E2) genes were determined. Viruses were isolated from mosquitoes collected at several sites near Iquitos, Loreto Department, in the Amazon Basin in northeastern Peru. Iquitos (population approximately 300,000) is approximately 125 meters above sea level and is bordered by the Amazon, Itaya, and Nanay Rivers (3°51′S, 73°13′W). Methods for mosquito collection, virus isolation, and initial identification were as previously described.2 Briefly, mosquitoes were captured in dry ice-baited miniature light traps (John W. Hock Co., Gainesville, FL), sorted to species, placed in pools, and frozen at −70°C until tested for infectious virus by plaque assay on Vero (African green monkey kidney) cells. Viruses that grew rapidly and produced plaques by day 2 were broadly categorized as alphaviruses (however, this group also included some of the more rapidly growing bunyaviruses), and viruses that grew more slowly and produced plaques by day 5 were broadly categorized as flaviviruses (however, this group also included some of the more slowly growing bunyaviruses). Viruses were amplified in Vero cell cultures and were initially screened by IFA for reactivity against Alphavirus and Flavivirus genus-specific monoclonal antibodies (U.S. Army Medical Research Institute of Infectious Diseases, Fort Detrick, MD). Follow-up IFA tests were performed using available antisera to complex or virus-specific members according to standard procedures.6 Based on these results, the identification of viral isolates as members of the genera Flavivirus and Alphavirus was confirmed by reverse transcription–PCR (RT-PCR) and sequencing of the PCR amplicons.
RNA extraction and PCR amplification.
Viral RNA was isolated from virus-infected cell culture supernatant using TRIzol-LS Reagent (Invitrogen, Carlsbad, CA) according to the manufacturer’s protocol. The viral RNA was converted into cDNA using SuperScript™ II and primed with either oligo-dT or with random hexamers according to the manufacturer’s instructions (Invitrogen). These cDNAs served as templates in subsequent PCRs containing virus-specific oligonucleotide primers (Table 2). The PCR amplifications were typically conducted in a PerkinElmer 2400 thermocycler (PerkinElmer Life and Analytical Sciences, Inc. Boston, MA,) in a total volume of 36 μL that contained 30 μL of high-fidelity PCR supermix (Invitrogen), 100 ng of cDNA template, and 50 pmol of each primer. The PCR amplicons were purified by using a QIAquick PCR purification kit (Qiagen, Valencia, CA) and 8 μL of the purified amplicon was added directly to the sequencing reaction.
To confirm the preliminary IFA identifications, cDNAs were tested by PCR using Alphavirus or Flavivirus genus-specific primers (Table 2) and then tested in a separate PCR assay using South American EEEV-specific primers (Table 2). To further characterize the EEEV isolates, we PCR-amplified the entire nsP3 and E2 genes, using gene-specific primers (Table 2) that were based on the complete genome sequence of individual Brazil-Peru (Lineage II) and Argentina-Panama (Lineage III) South American EEEV published in GenBank. Most of the nsP3 amplicons were obtained using the primers nsP2F and nsP4R. The nsP3 amplicons for the remaining isolates were obtained using either primers nsP2A-F or nsP2B-F paired with primer nsP4B-R, or primers nsP2B-F or nsP2F paired with primer nsP4A-R. Primers CAP-AF and E1A-R or CAP-BF and E1B-R were used to amplify the E2 gene.
Sequence analysis.
Sequencing was performed with Big Dye™ (Applied Biosystem, Inc., Foster City, CA) reagents according to the manufacturer’s instructions on an Applied Biosystems 3100 ABI PRISM automated DNA sequencer (Applied Biosystems) and the sequence data were analyzed by the programs contained in the Lasergene suite of programs (Lasergene analysis software; DNASTAR, Inc., Madison, WI). Consensus sequences were determined by the SeqMan program (DNASTAR, Inc.). Alignment analysis of the consensus sequences were performed with the MegaAlign program (DNASTAR) using the default settings (gap penalty = 15, gap length penalty = 6.66, delay divergent sequences = % 30, DNA transition weight = 0.50, and DNA matrix Clustal W) of the Clustal W method.7 The current version of Clustal W both aligns the sequences and also produces phylogenetic trees by the neighbor-joining method with the Kimura two-parameter distance formula as the default setting.8,9 In addition, we used the Clustal W program to calculate bootstrap values with a default setting of 1,000 trials (iterations) and a seed value of 111. To reduce clutter in the figures, we only present bootstrap values ≥75 at the respective nodes. If bootstrap values were < 75, no value was indicated.
RESULTS
Using a two-step procedure, IFA and/or plaquing behavior to make a preliminary group identification, followed by RT-PCR with specific primers, we were able to identify rapidly > 75 of the virus isolations made from mosquitoes captured in the Amazon Basin region of Peru. These included members of the genus Alphavirus (EEE, Una, Venezuelan equine encephalomyelitis, and western equine encephalomyelitis [WEE] viruses) and the genus Flavivirus (Ilheus and St. Louis encephalitis viruses).2 The genus- and virus-specific primers used are listed in Table 2. The genus-specific primers detected various members of that genus, but not members of other genera, and the EEEV primers detected South American EEEV.
The isolation of EEEV from 37 pools of mosquitoes and one hamster collected during this five-year study allowed us to examine the diversity of EEEV strains circulating in this region. Interestingly, 33 of the 37 EEEV isolations from mosquitoes were made from Culex (Melanoconion) pedroi. In addition, this species is a competent laboratory vector of EEEV (Turell MJ, unpublished data), indicating that this species is the principal vector of EEEV in this region of Peru. Phylogenetic analysis of the 38 isolates showed that they equally represented lineage II and III viruses (Table 1). The even distribution of the two lineages remained when the EEEV strains were compared by season; seven isolations from each lineage were made between August and September and 12 isolations from each lineage between December and February. Because mosquitoes infected with either a lineage II or III virus were co-captured in a single light trap on January 26, 1996 and on December 10, 1996, viruses in both clades were co-circulating in nature (Table 2).
Phylogenetic relationships for both the nsP3 and E2 genes for lineage II and III are shown in Figures 1 and 2. Evaluation of nsP3 and E2 lineage II genes showed a distinct group composed of six isolates (PE-4.0661, PE-10.0170, PE-11.0207, PE-18.1150, PE-22.0263, and PE-22.0678) (Figures 3A and 4A). Although, the bootstrap values were only 51 (nsP3) and 24 (E2) for this group being distinct, the fact that these same six viruses formed a separate group based on both the nsP3 and E2 genes indicates that despite the low bootstrap values, the grouping may be real. The six isolates shared common nucleotide substitutions not found within the nsP3 and E2 genes of the other isolates. The nucleotide substitutions represented silent changes except at nucleotide position 9356 (genomic numbering) of isolate PE 3.0815, which resulted in a conservative change between valine and isoleucine. A single isolate, PE-24.0111, was distinct from all of the other isolates in both nsP3 and E2 analyses. Interestingly, PE-24.0111 and another clade II virus were isolated from mosquitoes caught in the same location on the same night (Table 2), indicating that distinct strains were co-circulating.
Evaluation of the nsP3 and E2 genes from lineage III showed two discrete subclades based on both the nsP3 and E2 genes (Figures 3B and 4B). The seven isolates (PE-3.0391, PE-3.0803, PE-3.0869, PE-16.0050, PE-16.0140, PE-22.0110, and PE-22.0552) formed a distinct subclade within the nsP3 gene alignment of lineage III with the Clustal W program (bootstrap value = 100). These seven isolates shared three unique characteristics in the nsP3 gene: 1) a deletion of three nucleotides at nucleotides 5299–5301 (PE-0.0155 genome numbering) that resulted in the deletion of a leucine residue; 2) a mutation at nucleotide 5296 resulting in either a proline or a serine; and 3) a mutation at nucleotide 5477 resulting in either a isoleucine or a threonine. All other shared nucleotide substitutions resulted in silent changes. Examination of the E2 gene from the seven nsP3-related isolates indicated that they also formed a separate subclade based on the E2 gene. However, this subclade was not as distinct (bootstrap = 92) because they contained shared changes at only two positions, nucleotide 8920 and nucleotide 9124 (PE-0.0155 genome numbering), but only at nucleotide 9124 was there an amino acid change, between a glutamine and a histidine (Figure 4B). There were three additional changes, but these were not all shared and unique to the subclade. An additional four isolates (PE-1.0999, PE-5.0151, PE-5.0183, and PE-5.0519) in lineage III appeared to form a separate subclade, but in all cases, the shared nucleotide changes resulted in silent mutations in the nsP3 and E2 genes. Overall, 80–90% of the nucleotide changes resulted in silent substitutions, depending on the gene analyzed.
One characteristic shared by both lineage II and III viruses that differed from lineage I viruses (i.e., GA97) was the length of the nsP3 gene. A total of 60 nucleotides was deleted in lineage II, 69 nucleotides in lineage III, and 72 nucleotides in lineage IIIA (our designation) (Table 3). The distribution of deletions was consistent among all isolates of a specific lineage relative to lineage I. In all cases, the deletions/ insertions-substitutions occurred near the 3′ end of the nsP3 gene, after nucleotide 4999 (GA97 genome numbering).
We compared the identity of the two viruses for which we sequenced the entire genome, PE-3.0815 (Lineage II), and PE-0.0155 (Lineage III) with each other and with that of a lineage I isolate (GA97). All three viruses are distinct, with no more than 81.8% identity on the entire genome or 82.1% and 67.5% identity on the E2 or nsP3 genes, respectively (Table 4).
DISCUSSION
An arbovirology study conducted in the Amazon Basin region of Peru afforded us a unique opportunity to study the diversity of members of the genera Alphavirus. In particular, the multiple isolations of EEEV allowed us to examine the genomic diversity of these viruses and to compare their relationship with other known virus isolates made at different times and at different geographic locations.
The nsP3 and the E2 genes were selected for sequence and phylogenetic analysis for three reasons. First, sequencing a gene from both the non-structural and the structural regions allowed us to look for possible recombinant viruses, e.g., WEE-like viruses.10 Although no recombinants were detected, it was possible to identify other unique features within each lineage for the genes selected. Second, the nsP3 gene was chosen because it is comprised of an N-terminal portion that is highly conserved among alphaviruses and a C-terminal portion that is not conserved and varies in both sequence and length.11 It was a fortuitous choice because the analysis of the nsP3 gene for lineage III strongly suggested (bootstrap values = 100) that the 19 isolations represented in the lineage could be divided into two subclades. And third, the E2 gene was selected because changes in the E2 glycoprotein could result in immunologic differences between the virus isolates. Analysis of the E2 gene also indicated that the lineage III viruses could be divided into the same two subclades (bootstrap values = 85).
The results of the sequencing and phylogenetic analysis of the 38 EEEV isolations suggest that the Lineage II and III viruses co-circulate throughout the year in Peru. Members of both Lineages II and III were collected on the same night at the same study site on several occasions.2,12 The data also indicate that the distribution between Lineage II and III may vary within a narrow sampling period; more Lineage III virus isolations were obtained during February 1997 compared with more Lineage II virus isolations from February 2000. However, this difference may be an artifact of the relative small number of isolates made during each time period. The data suggest that the best representation of the presence of the two lineages within an area requires sampling throughout the year and over several years.
Because our EEEV isolations were conducted between 1996 and 2001, we were interested in understanding the relationship between these relatively new isolates and those collected during past studies from other regions of South America. To examine the relationship between the EEEV isolates, we conducted a phylogenetic analysis using the sequence data we determined for our virus isolations with those previously published.5 To accomplish this, we identified and compared a 122-basepair fragment from the E2 gene of our isolates to a corresponding 122-basepair fragment from various South America EEEV published in GenBank.5 Figure 5 shows a phylogenetic tree that represents the relationship of our current isolates with those analyzed by Brault and others5 for lineage I, II, III, and IV viruses. One of the results from this comparison is that the samples isolated from Peru in 1970 (Lineage II) and 1975 (Lineage III) were nearly identical to the ones we collected from the same region of Peru, but more than 25 years later, and yet these sequences are distinct from the sequences obtained from viruses isolated from other geographic locations. This suggests, at least for this 122-basepair fragment, that the E2 gene is somewhat conserved in both lineages found in Peru.
Our data suggest that because of the highly conserved nature of EEEV, determining additional sequence data for other regions of the E2 gene, outside the 122-basepair fragment, for the older isolates would enable a better phylogenetic comparison of the viruses. The data in this study also suggest that more than one gene or portion of a gene needs to be sequenced to demonstrate subtle differences in viral structure and thus evolutionary change. The best approach to researching virus evolution would be to sequence the complete genome. Despite the need to sequence more than this 122-basepair fragment, this fragment was able to distinguish between the four lineages and it might be useful in a real-time RT-PCR coupled with microarray technology to not only identify EEEV, but also identify the lineage. The phylogenetic analyses presented here establish a baseline for future work involving the characterization of EEEV isolated from other regions of South and Central America. In addition, the sequence data reported here for the nsP3 and E2 genes may help in understanding the enzootic and epizootic cycles observed for South American and North American EEEV.
Strains of eastern equine encephalitis virus examined in the study
| Accession no.‡ | ||||||
|---|---|---|---|---|---|---|
| Isolate no. | Mosquito species* | Location collected† | Date collected | Lineage | E2 | nsP3 |
| *Cx. = Culex; Mel. = Melanoconian; Ps. = Psorophora; Oc. = Ochlerotatus. | ||||||
| † Locations: PA Forest = Puerto Almendras Forest (approximately 20 km west-southwest of Iquitos); Casa Juan = private home about 4 km northeast of PA Forest; Otorongo- Peruvian military training base 15 km southwest of PA Forest, Eng = Peruvian army engineering base located about 20 km southwest of PA Forest; ACEER = Amazon Center for Environmental Education and Research located on the Napo River about 180 km north of PA Forest. | ||||||
| ‡ Accession numbers for GenBank for the sequence of the envelope 2 (E2) and nonstructural protein 3 (nsP3) regions. | ||||||
| § Accession numbers for GenBank for the complete genome sequence. | ||||||
| PE-0.0155 | Cx. pedroi | PA Forest | 8/2/96 | III | DQ241304‡ | |
| PE-1.0643 | Cx. pedroi | PA Forest | 9/20/96 | III | DQ280382 | DQ307803 |
| PE-2.0010 | Cx. pedroi | PA Forest | 10/23/95 | II | DQ280417 | DQ307838 |
| PE-3.0041 | Cx. pedroi | PA Forest | 12/3/96 | III | DQ280384 | DQ307805 |
| PE-3.0391 | Cx. pedroi | PA Forest | 12/5/96 | III | DQ280385 | DQ307806 |
| PE-3.0803 | Cx. pedroi | PA Forest | 12/10/96 | III | DQ280386 | DQ307807 |
| PE-3.0815 | Cx. pedroi | PA Forest | 12/10/96 | II | DQ241303§ | |
| PE-3.0869 | Cx. pedroi | PA Forest | 12/10/96 | III | DQ280387 | DQ307808 |
| PE-4.0661 | Cx. pedroi | Casa Juan | 11/22/97 | II | DQ280416 | DQ307837 |
| PE-4.0775 | Cx. pedroi | PA Forest | 1/26/97 | III | DQ280388 | DQ307809 |
| PE-4.0807 | Cx. pedroi | PA Forest | 1/26/97 | II | DQ280415 | DQ307836 |
| PE-4.0808 | Cx. pedroi | PA Forest | 1/26/97 | II | DQ280414 | DQ307835 |
| PE-5.0151 | Cx. (Mel.) spp. | PA Forest | 2/26/97 | III | DQ280389 | DQ307810 |
| PE-5.0183 | Ps. albigenu | PA Forest | 2/26/97 | III | DQ280390 | DQ307811 |
| PE-5.0519 | Oc. fulvus | PA Forest | 2/26/97 | III | DQ280391 | DQ307812 |
| PE-10.0046 | Cx. pedroi | PA Forest | 8/13/97 | II | DQ280413 | DQ307834 |
| PE-10.0170 | Cx. pedroi | PA Forest | 8/25/97 | II | DQ280412 | DQ307833 |
| PE-11.0042 | Cx. pedroi | PA Forest | 9/18/97 | III | DQ280392 | DQ307813 |
| PE-11.0207 | Cx. pedroi | Mixed | 9/22/97 | II | DQ280411 | DQ307832 |
| PE-11.0331 | Cx. pedroi | PA Forest | 9/29/97 | III | DQ280393 | DQ307814 |
| PE-11.0352 | Cx. pedroi | PA Forest | 9/29/97 | III | DQ280394 | DQ307815 |
| PE-15.0058 | Cs. pedroi | PA Forest | 8/98 | II | DQ280410 | DQ307831 |
| PE-16.0050 | Cx. pedroi | PA Forest | 9/23/98 | III | DQ280395 | DQ307816 |
| PE-16.0140 | Cx. pedroi | Otorongo | 10/4/98 | III | DQ280396 | DQ307817 |
| PE-1.0999 | Hamster | PA area | 2/28/98 | III | DQ280383 | DQ307804 |
| PE-17.0547 | Cx. pedroi | Otorongo | 12/8/98 | III | DQ280397 | DQ307818 |
| PE-18.0140 | Cx. pedroi | PA Forest | 2/17/99 | II | DQ280409 | DQ307830 |
| PE-18.0169 | Cx. pedroi | PA Forest | 2/17/99 | II | DQ280408 | DQ307829 |
| PE-18.1150 | Cx. pedroi | Eng | 2/25/99 | II | DQ280407 | DQ307828 |
| PE-22.0110 | Cx. pedroi | PA Forest | 2/9/00 | III | DQ280398 | DQ307819 |
| PE-22.0263 | Cx. pedroi | PA Forest | 10/2/00 | II | DQ280406 | DQ307827 |
| PE-22.0285 | Cx. gnomatos | PA Forest | 10/2/00 | II | DQ280405 | DQ307826 |
| PE-22.0526 | Cx. pedroi | ACEER | 2/00 | II | DQ280404 | DQ307825 |
| PE-22.0534 | Cx. pedroi | ACEER | 2/15/00 | II | DQ280403 | DQ307824 |
| PE-22.0552 | Cx. pedroi | ACEER | 2/15/00 | III | DQ280399 | DQ307820 |
| PE-22.0678 | Cx. pedroi | Otorongo | 2/20/00 | II | DQ280402 | DQ307823 |
| PE-24.0111 | Cx. pedroi | ACEER | 9/6/00 | II | DQ280401 | DQ307822 |
| PE-24.0132 | Cx. pedroi | ACEER | 9/6/00 | II | DQ280400 | DQ307821 |
Primers used in the studies
| Name | Use | Nucleotide sequence (5′ → 3′) | Reference |
|---|---|---|---|
| Genus-specific primers | |||
| 0092-F | Alphavirus | GATGAAATCNGGVATGTT | 12 |
| 0091-R | Alphavirus | ATTCAGGTTAGCCGTAGA | 12 |
| MA-F | Flavivirus | CATGATGGGRAARAGRGARRAG | 13 |
| cFD2-R | Flavivirus | GTGTCCCAGCCGGCGGTGTCATCAGC | 13 |
| Primers used to amplify the EEEV nsP3 and E2 genes* | ||||
|---|---|---|---|---|
| Lineage† | ||||
| Primer | II | III | Nucleotide sequence (5′ → 3′) | Gene |
| * EEEV = eastern equine encephalomyelitis virus; nsP3 = nonstructural protein 3; E2 = envelope 2; NA = not applicable. | ||||
| † Numbers correspond to complete genome sequence of either Lineage II or III. | ||||
| nsP2A-F | 3,554 | NA | TAGGAACCCCAATTTCCG | nsP3 |
| nsP2B-F | 3,725 | NA | AAGACCATGCCATTCACCACA | nsP3 |
| nsP2F | 3,931 | 3,931 | GGCAAGGAYAATGGKAAC | nsP3 |
| nsP4R | 5,765 | 5,765 | TCGAGGCGCGGGGCGTAG | nsP3 |
| nsP4A-R | NA | 5,798 | CATAGTTGTAGCTTTCTCTGCAG | nsP3 |
| nsP4B-R | 6,244 | NA | CCGCTAAAACGTTCTGAA | nsP3 |
| CAP-AF | 8,036 | 8,030 | GATGTTCCACAATGTATG | E2 |
| CAP-BF | 8,274 | 8,268 | GGAACCAGAAAGGRGTTA | E2 |
| E1A-R | 9,986 | 9,980 | GGATCCCCACCTTGTTCGGCA | E2 |
| E1B-R | 10,275 | 10,269 | CGTTCAATGTACRCTTCG | E2 |
Length of the nsP3 and E2 genes in selected clades of eastern equine encephalitis virus*
| Nucleotide length | |||
|---|---|---|---|
| Lineage | Clade† | nsP3 | E2 |
| * nsP3 = nonstructural protein 3; E2 = envelope 2. | |||
| † GA97 = Georgia, North America; PB = Peru-Brazil; PA = Panama-Argentina. | |||
| I | GA97 | 1,677 | 1,260 |
| II | PB | 1,617 | 1,260 |
| III | PA | 1,608 | 1,260 |
| IIIA | PA | 1,605 | 1,260 |
Relative identity of lineage I, II, and III viruses*
| Lineages compared† | |||
|---|---|---|---|
| Gene | I vs. II | II vs. III | I vs. III |
| * Genetic sequences were aligned and compared by the Martinez-NW Method. It uses two alignment methods in succession. Regions of perfect match are identified as described by Martinez14 and the Needleman-Wunsch method15 was then used to optimize the fit in between perfect matches. E2 = envelope 2; nsP3 = nonstructural protein 3. | |||
| †Lineage I = GA97; Lineage II = PE-3.0815; Lineage III = PE-0.0155. | |||
| Entire genome | 66.4 | 81.8 | 71.6 |
| E2 gene | 67.1 | 82.1 | 66.1 |
| nsP3 gene | 61.9 | 67.5 | 62.8 |
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from a complete nonstructural protein 3 (nsP3) gene sequence for all viruses tested. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from a complete nonstructural protein 3 (nsP3) gene sequence for all viruses tested. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from a complete nonstructural protein 3 (nsP3) gene sequence for all viruses tested. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from complete envelope 2 (E2) protein gene sequences. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from complete envelope 2 (E2) protein gene sequences. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of South American eastern equine encephalomyelitis virus isolates generated from complete envelope 2 (E2) protein gene sequences. The viruses in clade III and a subclade in lineage II are shown in regular type, and the remaining viruses in these two lineages are shown in italics. The single outlier in lineage II, PE-24.0111, is shown in bold. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the nonstructural protein 3 (nsP3) genes for viruses in lineage II from Figure 1. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the nsP3 genes for viruses in lineage III from Figure 1. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the nonstructural protein 3 (nsP3) genes for viruses in lineage II from Figure 1. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the nsP3 genes for viruses in lineage III from Figure 1. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the nonstructural protein 3 (nsP3) genes for viruses in lineage II from Figure 1. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the nsP3 genes for viruses in lineage III from Figure 1. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the E2 genes for viruses in lineage II from Figure 3. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the E2 genes for viruses in lineage III from Figure 2. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the E2 genes for viruses in lineage II from Figure 3. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the E2 genes for viruses in lineage III from Figure 2. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
A, Expanded view of the E2 genes for viruses in lineage II from Figure 3. Bootstrap values ≥ 75 are shown at nodes. B, Expanded view of the E2 genes for viruses in lineage III from Figure 2. Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of eastern equine encephalomyelitis virus isolates based on a 122-basepair fragment of the envelope 2 (E2) protein gene. Isolates in bold and not preceded by letters are from the current study and were isolated in Peru from 1996 to 2000. The remaining viruses are from Brault and others.5 Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of eastern equine encephalomyelitis virus isolates based on a 122-basepair fragment of the envelope 2 (E2) protein gene. Isolates in bold and not preceded by letters are from the current study and were isolated in Peru from 1996 to 2000. The remaining viruses are from Brault and others.5 Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Phylogenetic tree of eastern equine encephalomyelitis virus isolates based on a 122-basepair fragment of the envelope 2 (E2) protein gene. Isolates in bold and not preceded by letters are from the current study and were isolated in Peru from 1996 to 2000. The remaining viruses are from Brault and others.5 Bootstrap values ≥ 75 are shown at nodes.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 76, 3; 10.4269/ajtmh.2007.76.408
Address correspondence to Michael J. Turell, Department of Cell Biology, Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, MD 21702-5011. E-mail: michael.turell@det.amedd.army.mil
Authors’ addresses: John P. Kondig and Leonard P. Wasieloski Jr, Diagnostics Systems Division, U.S. Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, MD 21702-5011, E-mail: John.Kondig@det.amedd.army.mil. Michael J. Turell, John S. Lee, and Monica L. O’Guinn, Virology Division, U.S. Army Medical Research Institute of Infectious Diseases, 1425 Porter Street, Fort Detrick, MD 21702-5011.
Acknowledgments: We thank Mark Wooster, Faustino Carbajal, Roberto Fernandez, Karla Block, and Helvio Astete (Naval Medical Research Center and Detachment-Peru) for technical support. We also thank the Peruvian Ministry of Health for their assistance; James Pecor, Richard Wilkerson, and E. L. Peyton (Walter Reed Army Medical Institute of Research) for providing taxonomic assistance; Katheryn Kenyon for expert editorial assistance; Lorraine Farinick for providing the illustrations; George Korch for his support and helpful suggestions; and the Amazon Center for Environmental Education and Research for the use of their facilities and assistance.
Financial support: This work was supported by work unit number 62787A 870 U 8517 of the U.S. Navy and by Defense Threat Reduction Agency project G0015 04 RD B.
Disclaimer: The use of trade names or commercial products does not constitute endorsement or recommendation for use by the Department of Defense. The views of the authors do not necessarily reflect the position of the Department of Defense or the Department of the Army.
REFERENCES
- 1↑
Meegan JM, Digoutte JP, Peters CJ, Shope RE, 1983. Monoclonal antibodies to identify Zinga virus as Rift Valley fever virus. Lancet 1 :641.
- 2↑
Turell MJ, O’Guinn ML, Jones JW, Sardelis MR, Dohm DJ, Watts DM, Fernandez R, Travassos Da Rosa A, Guzman H, Tesh R, Rossi CA, Ludwig GV, Mangiafico JA, Kondig J, Wasieloski LP Jr, Pecor J, Zyzak M, Schoeler G, Mores CN, Calampa C, Lee JS, Klein TA, 2005. Isolation of viruses from mosquitoes collected in the Amazon Basin region of Peru. J Med Entomol 42 :891–898.
- 3↑
Morris CD, 1989. Eastern equine encephalitis. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Volume III. Boca Raton, FL: CRC Press, 1–20.
- 4↑
Weaver SC, Hagenbaugh A, Bellew LA, Gousset L, Mallampalli V, Holland JJ, Scott TW, 1994. Evolution of alphaviruses in the eastern equine encephalomyelitis complex. J Virol 68 :158–169.
- 5↑
Brault AC, Powers AM, Chavez CL, Lopez RN, Cachon MF, Gutierrez LF, Kang W, Tesh RB, Shope RE, Weaver SC, 1999. Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America. Am J Trop Med Hyg 61 :579–586.
- 6↑
Lennette EH, Schmidt NJ, eds, 1964. Diagnostic Procedures for Viral and Rickettsial Diseases: Fluorescent Antibody Techniques. New York: American Public Health Association, Inc., 177–193.
- 7↑
Thompson JD, Higgins DG, Gibson TJ, 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res 22 :4673–4680.
- 8↑
Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD, 2003. Multiple sequence alignment with the Clustal series of programs. Nucleic Acids Res 31 :3497–3500.
- 9↑
Howe K, Bateman A, Durbin R, 2002. QuickTree: building huge neighbor-joining trees of protein sequences. Bioinformatics 18 :1546–1547.
- 10↑
Hahn CS, Lustig S, Strauss EG, Strauss JH, 1988. Western equine encephalitis virus is a recombinant virus. Proc Natl Acad Sci USA 85 :5997–6001.
- 11↑
LaStarza MW, Lemm JA, Rice CM, 1994. Genetic analysis of the nsP3 region of Sindbis virus: evidence for roles in minus-strand and subgenomic RNA synthesis. J Virol 68 :5781–5791.
- 12↑
O’Guinn ML, Lee JS, Kondig JP, Fernandez R, Carbajal F, 2004. Field detection of eastern equine encephalitis virus in the Amazon Basin region of Peru using reverse transcription-polymerase chain reaction adapted for field identification of arthropod-borne pathogens. Am J Trop Med Hyg 70 :164–171.
- 14↑
Martinez HM, 1983. An efficient method for finding repeats in molecular sequences. Nucleic Acids Res 11 :4629–4634.
- 15↑
Needleman SB, Wunsch CD, 1970. A general method applicable to the search for similarities in the amino acid sequence of two proteins. J Mol Biol 48 :443–453.