• View in gallery

    The conventional PCR results of the first- and sixth-day larvae after hatching infected with C6/36DNV for 24 hours. M: wide range DNA ladder marker; 1: the first-day sample (20 larvae) of first-day larvae infected with C6/36DNV; 2: the fourth-day sample (20 larvae) of first-day larvae infected with C6/36DNV; 3: the first-day sample (20 larvae) of sixth-day larvae infected with C6/36DNV; 4: the fourth-day sample (20 larvae) of sixth-day larvae infected with C6/ 36DNV; 5: chronically C6/36DNV-infected C6/36 cell lines as positive control; 6: C6/36DNV-free mosquitoes (20 adults) as negative control.

  • View in gallery

    The conventional PCR results of sixth-day larvae after hatching infected with C6/36DNV. M: wide range DNA ladder marker; 1: the first-day sample (20 larvae) of sixth-day larvae infected with a lower dose of virus for 72 hours; 2: the fourth-day sample (20 larvae) of sixth-day larvae infected with a lower dose of virus for 72 hours; 3: the first-day sample (20 larvae) of sixth-day larvae infected with a higher dose of virus for 24 hours; 4: the fourth-day sample (20 larvae) of sixth-day larvae infected with a higher dose of virus for 24 hours; 5: chronically C6/36DNV-infected C6/36 cell lines as positive control; 6: C6/36DNV-free mosquitoes (20 adults) as negative control.

  • View in gallery

    The conventional PCR results of C6/36DNV-latent adults and their offspring. M: wide range DNA ladder marker; 1: survival adults (20 adults) from the C6/36DNV-positive larvae; 2:G1 larvae (20 larvae) from survival C6/36DNV-positive adults; 3: G1 adults (20 adults) from G1 C6/36DNV-positive larvae; 4: chronically C6/36DNV-infected C6/36 cell lines as positive control; 5: C6/36DNV-free mosquitoes (20 adults) as negative control.

  • View in gallery

    The curvilinear trend of the mortality for larvae infected with C6/36DNV at the first day after hatching.

  • View in gallery

    The absolute real-time qPCR results of the quantity of C6/36DNV genomes in larvae and survival adults (20 larvae or adults per sample) after C6/36DNV infected the first-day larvae after hatching. Larvae were sampled from the first day to the sixteenth day. In the twentieth day, adults were sampled.

  • View in gallery

    On the fourth day after C6/36DNV infected the first-day larvae after hatching, there were virus paracrystalline structures in nuclei of fat body cells. N: nuclei; C: cytoplasm.

  • 1

    Chen S, Cheng L, Zhang Q, Lin W, Lu X, Brannan J, Zhou ZH, Zhang J, 2004. Genetic, biochemical, and structural characterization of a new densovirus isolated from a chronically infected Aedes albopictus C6/36 cell line. Virology 318 :123–133.

    • Search Google Scholar
    • Export Citation
  • 2

    Jousset FX, Barreau C, Boublik Y, Cornet M, 1993. A Parvo-like virus persistently infecting a C6/36 clone of Aedes albopictus mosquito cell line and pathogenic for Aedes aegypti larvae. Virus Res 29 :99–114.

    • Search Google Scholar
    • Export Citation
  • 3

    Lebedeva OP, Kuznetsova MA, Zelenko AP, Gudz-Gor-bana AP, 1973. Investigation of a virus disease of the densonucleosis type in a laboratory culture of Aedes aegypti. Acta Virol 17 :253–256.

    • Search Google Scholar
    • Export Citation
  • 4

    O’Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76 :2067–2074.

    • Search Google Scholar
    • Export Citation
  • 5

    Ward TW, Jenkins MS, Afanasiev BN, Edwards M, Duda BA, Suchman E, Jacobs-Lorena M, Beaty BJ, Carlson JO, 2001. Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae. Insect Mol Biol 10 :397–405.

    • Search Google Scholar
    • Export Citation
  • 6

    Barreau C, Jousset F-X, Bergoin M, 1996. Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes. J Invertebr Pathol 68 :299–309.

    • Search Google Scholar
    • Export Citation
  • 7

    Barreau C, Jousset F-X, Bergoin M, 1997. Venereal and vertical transmission of the Aedes albopictus parvovirus in Aedes albopictus mosquitoes. Am J Trop Med Hyg 57 :126–131.

    • Search Google Scholar
    • Export Citation
  • 8

    Kittayapong P, Baisley KJ, O’Neill SL, 1999. A mosquito densovirus infecting Aedes aegypti and Aedes albopictus from Thailand. Am J Trop Med Hyg 61 :612–617.

    • Search Google Scholar
    • Export Citation
  • 9

    Jousset FX, Baquerizo E, Bergoin M, 2000. A new densovirus isolated from the mosquito Culex pipiens (Diptera: culicidae). Virus Res 67 :11–16.

    • Search Google Scholar
    • Export Citation
  • 10

    Rwegoshora R, Baisley K, Kittayapong P, 2000. Seasonal and spatial variation in natural densovirus infection in Anopheles minimus S.L. in Thailand. Southease Asian J Trop Med Public Health 21 :3–9.

    • Search Google Scholar
    • Export Citation
  • 11

    Buchatsky LP, 1989. Densonucleosis of bloodsucking mosquitoes. Dis Aqua Org 6 :145–150.

  • 12

    Ledermanm JP, Suchman EL, Black WC IV, Carlson JO, 2004. Infection and pathogenicity of the mosquito densoviruses AaeDNV, HeDNV, and APeDNV in Aedes aegypti mosquitoes (Diptera:Culicidae). Biological and Microbial Control 97 :1828–1835.

    • Search Google Scholar
    • Export Citation
  • 13

    Barreau C, Jousset F-X, Cornet M, 1994. An efficient and easy method of infection of mosquito larvae from virus-contaminated cell cultures. J Virol Methods 49 :153–156.

    • Search Google Scholar
    • Export Citation
  • 14

    Mitchell CJ, 1995. Geographic spread of Aedes albopictus and potential for involvement in arbovirus cycles in the Mediterranean basin. J Vec Ecol 20 :44–58.

    • Search Google Scholar
    • Export Citation
  • 15

    Ibanez-Bernal S, Briseno B, Mutebi JP, Argot E, Rodriguez G, Martinez-Campos C, Paz R, De La Fuente-San Roman P, Tapia-Conyer R, Flisser A, 1997. First record in America of Aedes albopictus naturally infected with dengue virus during the 1995 outbreak at Reynosa, Mexico. Med. Vet. Entomol Mexico II: 305–309.

    • Search Google Scholar
    • Export Citation
  • 16

    Hunter-Fujita FR, Entwistle PF, Evans HF, Crook NE, eds., 1998. Insect Viruses and Pest Management. Chichesten, UK.

  • 17

    Moscardi F, 1999. Assessment of the application of baculoviruses for control of Lepidoptera. Annu Rev Entomol 44 :257–289.

  • 18

    Linley JR, Nielsen HT, 1968. Transmission of a mosquito iridescent virus in Aedes taeniorhynchus.I. Laboratory experiments. J Invertebr Pathol 12 :7–16.

    • Search Google Scholar
    • Export Citation
  • 19

    Igarashi A, Matsuo S, Bundo-Morita K, 1986. Larvicidal effect of an insect virus of mosquitoes: An attempt to use as a potential agent of biological control on mosquitoes. Trop Med 28 :191–207.

    • Search Google Scholar
    • Export Citation
  • 20

    Cornet M, Deubel V, Mattei X, 1986. Le virus MAV: Unnouveau moyen de lutte contre Aedes aegypti. Ann Inst Pasteur Virol 137E :417–424.

  • 21

    Berns KI, 1996. Parvoviridae: the viruses and their replication. BN Fields, DM Knipe, PM Howley, eds. Fundamental Virology. Third edition. Philadelphia, PA: Lippincott-Raven, 1017–1041.

  • 22

    Burivong P, Pattanakitsakul S-N, Thongrungkiat S, Malasit P, Flegel TW, 2004. Markedly reduced severity of Dengue virus infection in mosquito cell cultures persistently infected with Aedes albopictus densovirus (AalDNV). Virology 329 :261–269.

    • Search Google Scholar
    • Export Citation
  • 23

    Rhode SL, 1978. Defective interfering particles of parvovirus H-1. J Virol 27 :347–356.

  • 24

    Dittmar D, Castro A, Haines H, 1982. Demonstration of interference between dengue virus types in cultured mosquito cells using monoclonal antibody probes. J Gen Virol 59 :273–282.

    • Search Google Scholar
    • Export Citation
  • 25

    Karpf AR, Lenches E, Strauss EG, Strauss JH, Brown DT, 1997. Superinfection exclusion of alphaviruses in three mosquito cell lines persistently infected with Sindbis virus. J Virol 71 :7119–7123.

    • Search Google Scholar
    • Export Citation
  • 26

    Namikoshi A, Wu JL, Yamashita T, Nishizawa T, Nishioka T, Arimoto M, Muroga K, 2004. Vaccination trials with Penaeus japonicus to induce resistance to white spot syndrome virus. Aquaculture 229 :25–36.

    • Search Google Scholar
    • Export Citation
  • 27

    Liu J, Fallon AM, 1998. Effect of nutrient deprivation on ribosomal RNA and ribosomal protein mRNA in cultured mosquito cells. Arch Insect Biochem 37 :239–247.

    • Search Google Scholar
    • Export Citation

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

THE PATHOGENICITY OF MOSQUITO DENSOVIRUS (C6/36DNV) AND ITS INTERACTION WITH DENGUE VIRUS TYPE II IN AEDES ALBOPICTUS

View More View Less
  • 1 State Key Lab for Biocontrol and Institute of Entomology, Sun Yat-Sen University, Guangzhou 510275, PR China; College of Animal Science, Zhejiang University, 310027, PR China

When Aedes albopictus larvae were infected with C6/36 densovirus (C6/36DNV), the mortality reached 97.46% within 21 days for those larvae infected at the first day after hatching, and 14.17% for control. A real-time quantitative polymerase chain reaction (qPCR) was used to trace the dynamic change of the quantity of C6/36DNV genomes in the larvae and the adults, and to study the interaction of C6/36DNV with dengue virus type II(DEN-II) in mosquitoes. It showed that C6/36DNV could persist in the adults that could transmit C6/36DNV vertically to the next generation. The quantity of C6/36DNV after DEN-II infection increased by 102~103 times in the C6/36DNV-positive mosquitoes, and the quantity of DEN-II in the C6/36DNV-positive mosquitoes was about 100 times lower than that in the C6/36DNV-negative mosquitoes, which suggested that DEN-II could remarkably stimulate the reproduction of C6/36DNV, while C6/36DNV persisted in mosquitoes could inhibit the reproduction of DEN-II. The study throws light on C6/36DNV as a possible biologic control agent against dengue virus and Ae. albopictus.

INTRODUCTION

Aedes albopictus C6/36 cell densovirus (C6/36DNV), a new mosquito densovirus, was isolated from a chronically infected but apparently healthy strain of Ae. albopictus C6/36 cells in our laboratory.1 The virus, a single-stranded linear DNA, belongs to the genus Brevidensovirus of the subfamily Densovirinae in the family Parvoviridae. Each densovirus virion packages either a plus or a minus single-stranded linear DNA chain. The virion appears as icosahedral, non-enveloped particle with a diameter of 18–26 nm. The sequence analysis and comparison showed that the nucleotide and coded amino acid sequences of C6/36DNV are highly homologous to the AaeDNV genome, but genomic organization and some repeating sequences of C6/36DNV are more closely related to those of AalDNV.1

In the genus Brevidensovirus, AaeDNV and AalDNV have been isolated from Aedes aegypti larvae and a chronically infected Ae. albopictus C6/36 cell line, respectively.2,3 Both AaeDNV and AalDNV are very pathogenic for mosquito larvae and all mosquito tissues, killing up to 100% of early-age larvae.4,5 But old-age larvae can survive and grow into imago after the virus infection, and the mosquito imago can vertically transmit the viruses to the next generation.57 Other mosquito densoviruses have been isolated from natural populations of Ae. albopictus, Ae. aegypti, and Anopheles minimus in Thailand, from laboratory mosquito colonies or from mosquito cell lines.2,4,810 These mosquito densoviruses have been studied as a biologic control agent for mosquitoes.6,11 When Ae. aegypti larvae were infected with AaeDNV, HeDNV, ApeDNV, the mortality reached 75.1%, 33.5%, and 27.8%, respectively.12 Meanwhile AThDNV caused death for up to 82% of Ae. albopictus larvae, and 51% of Ae. Aegypti larvae.8 Moreover AaPV was highly pathogenic for the first- and third-instar Ae. Aegypti larvae, with mortality higher than 90% within 10 days at the first instar upon infection.6,13

Ae. albopictus belongs to a large genus of mosquito, with a wide-range distribution. Known as the Asian “tiger”, they originate from the tropical forest in Southeast Asia. This area is also considered to be the origin of the dengue virus. Ae. albopictus, along with Ae. Aegypti, is considered to be one of the most important dengue vectors, with higher susceptibility to the virus than that of Ae. Aegypti.14 Additionally, the species has the possibility of naturally transmitting the serotypes II and III of the dengue virus vertically,15 and shows aggressive anthropophilic behavior and great adaptability to different habitats. Presently, an integrated approach to mosquito control encompasses aspects of environmental management (i.e., habitat reduction), chemical control (i.e., insecticides), and biologic control (i.e., mosquito pathogens). Biologic control agents include pathogens such as nematodes, fungi, bacteria, viruses, predators such as the mosquito fish, or toxins produced by microorganisms. Some viruses, such as the baculoviruses, have been used successfully to control agricultural arthropod pests.16,17 However, the development of biologic control agents targeting vectors of human pathogens has been slow. Consequently improving old techniques and developing new mosquito control methods are needed.

Dengue virus belongs to the family Flaviviridae. It is transmitted by mosquito to human and causes dengue fever (DF), dengue hemorrhagic fever (DHF), and dengue shock syndrome (DHF/DSS). So far, no effective and reliable anti-dengue vaccines and antivirals have been developed. In its life cycle, dengue virus must live in the mosquito for some time before being transmitted to humans. At present, there is no highly effective method to control the population of mosquitoes, which is an important reason for the prevalence of dengue fever in the whole world. So if we could control the population of mosquitoes or inhibit the reproduction of dengue virus in mosquitoes, we could effectively minimize the prevalence of diseases caused by dengue virus.

In this study, we used the C6/36DNV to infect Ae. albopictus larvae, which could cause larvae death and restrain the reproduction of dengue virus type II(DEN-II) in mosquitoes. Therefore, the study of C6/36DNV as a possible biologic control agent suggests a dual control method against dengue virus in its transmission process. This research has not been reported before.

MATERIALS AND METHODS

Viruses.

C6/36DNV was isolated from a chronically infected but apparently healthy strain of Ae. albopictus C6/36 cell line conserved in our laboratory. DEN-II was provided by the Research Institute of Guangzhou Military Medicine.

Cell lines.

The C6/36 clone of Ae. albopictus was grown in M199 essential cell culture medium (Gibco, Grand Island, NY) at 28°C, supplemented with 10% heat-inactivated fetal calf serum(Gibco) and 1% penicillin-streptomycin (Gibco). After 3 freeze/thaw cycles, the quantity of the C6/36DNV genomes in cell culture medium was determined to be 2.87 × 109 copy/ml in chronically C6/36DNV-infected but apparently healthy cell by the real-time quantitative polymerase chain reaction (qPCR) using SYBR Green assay. These cells could gradually show pathologic changes when cultured at 37°C for 8 hours and then at 28°C for several days. The quantity of the C6/36DNV genomes was 6.14 × 1011 copy/ml in the cells with pathologic changes. Both the cell culture mediums were used to infect Ae. albopictus larvae.

Mosquitoes.

The colonized Ae. albopictus strain was obtained from the Center for Disease Control and Prevention of Guangdong Province. Every batch of mosquitoes was examined by conventional PCR to ensure that the experimental mosquitoes were C6/36DNV-free and DEN-II-free. Control and experiment-infected mosquitoes were reared in 2 separate rooms to avoid contamination at a temperature of 27 ± 1°C and a relative humidity of 65–75%. Mosquito adults were fed on a 10% sugar solution and the females were fed on healthy live quail for the maturation of their eggs. Control and experiment-infected mosquito larvae were reared in 2 separate 2-liter water bowls (diameter: 25 cm) with 1-liter water and 5-gram alevin and soybean mixed powder, at the same temperature and humidity as mosquito adults.

Infection of mosquito larvae.

Infection of the first-day larvae after hatching.

We exposed 2 groups of first-day larvae to C6/36DNV. In group II, there were 600 larvae for experiment and 600 larvae for control. In group II, 2,100 larvae were used in the experiment and 500 larvae for control. In the experiment group, every 300 larvae were infected with C6/36DNV (5 mL clear water + 5 mL 2.87 × 109copy/ml cell culture medium) for 24 hours. Controls received no virus and were also incubated in 5 mL clear water + 5 mL pure M199 cell culture medium.

Infection of the sixth-day larvae after hatching.

Two groups (200 sixth-day larvae per group) were exposed to C6/36DNV (4 mL clear water + 4 mL 2.87 × 109copy/ml cell culture medium) for 24 hours and 72 hours, respectively. Another 200 sixth-day larvae were exposed to C6/36DNV (4 mL clear water + 4 mL 6.14 × 1011 copy/ml cell culture medium) for 24 hours. Virus-free controls were incubated in 4 mL clear water + 4 mL pure M199 cell culture medium.

After infection, each experiment group and control group were reared separately in sterilized 2-liter water bowls (diameter: 25 cm) with 1-liter clear water and 5-gram alevin and soybean mixed powder. Every day, we replaced water and food, and counted the number of the larvae and pupae, live or dead, until all of them totally grew into adults.

C6/36DNV-positive adults and their offspring.

Twenty adults as one sample were selected randomly from the survivors in each experimental group, which were infected at first and sixth day after hatching to check whether they were C6/ 36DNV-positive. The adults, which were confirmed C6/ 36DNV-positive by conventional PCR, oviposited. The G1 eggs from C6/36DNV-positive female were hatched. Twenty G1 larvae were randomly selected as one sample and were detected by conventional PCR to be confirmed C6/36DNV-positive. The remainders continued to be cultured. When they became adults, twenty G1 adults were also detected by conventional PCR.

Conventional polymerase chain reaction for C6/36DNV and DEN-II.

DNA extraction.

The sampled mosquitoes were washed twice with physiologic salt solution (0.9% sodium chlorine, 1,000 units/ml penicillin, and 1 mg/ml streptomycin) and were frozen in −30°C for 30 minutes; 300 μL CTAB (hexadecyltrimethylammonium bromide) extractive buffer (100 mM Tris-HCl, pH 8.0; 20 mM EDTA-Na2; 1.4 M NaCl; 2% CTAB, freshly added 0.1%(v/v) β-mercaptoethanol) was used in grinding the mosquito samples. After the suspension was collected in a 1.5-mL tube, the pestle was rinsed once with 200 μL CTAB extractive buffer, followed by 2 washes of 100 μL. The grinding suspension was split at 65°C for 2 hours, shaken gently and periodically. The nucleic acid was extracted once with phenol: chloroform: isoamylalcohol (25:24: 1), then once with chloroform: isoamylalcohol (24:1), precipitated by addition of 2.5 volume of 100% ethanol, and resuspended in TE (10 mM Tris, 1 mM EDTA, pH8.0) buffer solution. The DNA was prepared as the template for conventional PCR to detect C6/36DNV.

Conventional polymerase chain reaction for C6/36DNV.

The primers are listed in Table 1. The reaction system consisted of 5 μL 10 × PCR buffer (TaKaRa), 1 μL 10 mM dNTP mixture (TaKaRa), 1 μL 10 μM C6/36DNVsenseprimer, 1 μL 10uM C6/36DNVanti-senseprimer, 1 μL template, 0.5 μL Tag polymerase (TaKaRa), 40.5 μL ddH2O. The thermocycler program was 94°C, 5 minutes; 94°C, 40 seconds; 58°C, 40 seconds; 72°C, 70 seconds, 30 cycles, 72°C, 10 minutes, performing in Biometra UNO II. The negative control was C6/36DNV-free mosquitoes. The positive control was chronically C6/36DNV-infected C6/36 cell lines.

RNA extraction.

The samples were washed twice with physiologic salt solution and were grinded in 880 μl M199 essential culture medium with 5% heat-inactivated fetal. The suspensions were centrifuged to obtain the supernatant. The total RNA of mosquitoes was extracted once with Trizol (Bio Basic Inc., Markham, Ontario, Canada), twice with chloroform, then once with isoamylalcohol, precipitated by addition of 2.5 volume of 100% ethanol, and dissolved in 20 μl die-thypyrocarbonate (DEPC)-treated water as the template for reverse transcription.

Conventional RT-PCR for DEN-II.

The primers are listed in Table 1. The RNA of the DEN-II was transcribed to cDNA immediately after RNA extraction. The RT reaction system for DEN-II was 1 μl the mosquitoes total RNA, 0.5 μL 10 μM DEN-II anti-senseprimer, 2 μL 10 mM dNTP mixture (TaKaRa), 2 μL 5 × First-Strand buffer (Invitrogen, Carlsbad, CA), 1 μL 0.1 M DTT (Invitrogen, Carlsbad, CA), 0.5 μL HPRI (Invitrogen, Carlsbad, CA), 0.5 μL SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA), and 2.5 μL H2O. The reactive program was 50°C, 55 minutes: 70°C, 15 seconds. The cDNAs were stored at −30°C as the DEN-II template for conventional PCR to detect DEN-II.

The conventional PCR reaction system for DEN-II consisted of 5 μL 10 × PCR buffer (TaKaRa), 1 μL 10 mM dNTP mixture (TaKaRa), 1 μL 10 μM DEN-II senseprimer, 1 μL 10 μM DEN-II anti-senseprimer, 3 μL cDNA, 0.5 μL Tag polymerase (TaKaRa), 38.5 μL ddH2O. The thermocycler program was 94°C, 3 minutes; 94°C, 30 seconds; 55°C, 30 seconds; 72°C, 12 seconds, 30 cycles, 72°C, 10 minutes in Biometra UNO II.

DEN-II infected C6/36DNV-positive adults.

Eleven C6/ 36DNV-positive adults as one sample were selected every day (for 4 days) for real-time qPCR to determine the quantity of C6/36DNV before DEN-II infection. After starvation for 24 hours, 300 from the C6/36DNV-positive adults were infected with DEN-II by placing a plate with absorbent cotton immersing in DEN-II mixed solution (fresh anticoagulant chicken blood, fetal calf serum, and 10% (w/v) brain suspension of DEN-II–infected infant mice (106.50 TCID50/0.25) with a ratio of 1:1:2) on an ice-water mixture bag in the cage. One hundred adults, which were obviously full, were selected to be fed successively with the DEN-II mixed solution for 2 more days (4 hours per day). Fifty C6/36DNV-negative mosquitoes were infected and selected in the same method as described previously. One day after serially infecting the 100 C6/ 36DNV-positive and 50 C6/36DNV-negative adults with DEN-II, eleven adults from C6/36DNV-positive group were sampled every day (for 5 days) for real-time qPCR to detect the quantity of C6/36DNV. Another 11 adults from C6/ 36DNV-positive group were sampled every day (for 3 days) to detect the quantity of DEN-II, while 11 adults from C6/ 36DNV-negative group were sampled every day (for 3 days) and detected for the same purpose.

Quantitative real-time polymerase chain reaction.

Real-time standards and preparation.

For quantification of C6/ 36DNV, primers were designed, based on a conserved region of the C6/36DNV (Table 1). The 84 bp product was cloned into pMD18-T vector (TaKaRa). The recombinant plasmid as real-time qPCR standard of C6/36DNV was sequenced in an automated DNAsequencer (model ABI373A, PE Applied Biosystems). The sequence analyses were carried out in the NCBI BLAST search program to confirm the identity between the cloned and the published sequences. UV spectrophotometry (model 500; Beckman, Fullerton, CA) was used to determine the concentration of the recombinant plasmid. The plasmid has a calculated weight of 2.64 × 1014copy/μl. The standard was serially diluted to obtain concentrations of 2.64 × 1014–2.64 × 106copy/μl. The “working set” of standards was stored at −30°C. After 3 freeze/thaw cycles, it should be discarded.

Absolute real-time qPCR for dynamic change of the quantity of C6/36DNV genomes in larvae and adults.

Twenty larvae as one sample were selected randomly every day (for 16 days) after 3,000 first-day larvae were infected with C6/36DNV (genomes dose: 2.87 × 109copy/ml) for 24 hours. On the twentieth day, 20 survival adults were sampled. The sample DNA extraction was described previously. The DNA was dissolved in 30 μL TE and stored at −30°C as the template for determining C6/36DNV DNA genome in real-time qPCR. Primers (Table 1) were diluted to 2 uM. The real-time qPCR reaction system consisted of 10 μl 2 × DyNAmomaster mix (MJ Bioworks, Finnzymes Oy), 0.4 μl Rox (TaKaRa, Otsu Shiga, Japan), 1 μl C6/36DNV senseprimer, 1 μl C6/36DNV anti-senseprimer, 0.5 μl template, and 7.1 μl ddH2O. Each sample had 3 repeats. At the same time, the real-time qPCR standard of C6/36DNV described previously was used to construct the standard curve of the virus. The thermocycler program was 94°C, 3 minutes; 94°C, 30 seconds; 55°C, 30 seconds; 72°C, 15 seconds; 40 cycles in an ABI PRISM 7900 Quantitative Real-Time PCR (Applied Biosystem, Foster City, CA) thermocycler/florescence reader.

Absolute real-time qPCR for the C6/36DNV before and after the DEN-II infected the C6/36DNV-positive adults.

The DNA of adult samples was extracted, dissolved in 15 μL TE and used for real-time qPCR in the same methods as described previously.

Relative real-time qPCR for the DEN-II after the C6/ 36DNV-positive and C6/36DNV-negative adults infected with DEN-II.

The primers (Table 1) for real-time qPCR were designed within the conserved regions of DEN-II and Ae. albopictus house keeping rpL8 as internal control gene. The total RNA of mosquito samples was extracted as described previously and dissolved in 20 μL DEPC-treated water as the template for reverse transcription.

The RNA of the DEN-II and rpL8 was transcribed to cDNA immediately after RNA extraction. The reaction system was 1 μL the mosquitoes total RNA, 0.5 μL 10 uM DEN-II anti-senseprimer, 0.5 μL 10 μM rpL8 anti-senseprimer, 2 μL dNTP mixture (TaKaRa), 2 μL 5 × First-Strand buffer (Invitrogen, Carlsbad, CA), 1 μL 0.1 M DTT (Invitrogen, Carlsbad, CA), 0.5 μL HPRI (Invitrogen, Carlsbad, CA), 0.5 μL SuperScript III Reverse Transcriptase (Invitrogen, Carlsbad, CA), and 2 μL H2O. The reactive program was 50°C, 55 minutes; 70°C, 15 seconds. The cDNAs were stored at −30°C as the templates of both the DEN-II and rpL8 for real-time qPCR.

The DEN-II and rpL8 primers for real-time qPCR (Table 1) were diluted to 2 uM. The reaction system was 10 μL 2 × DyNAmomaster mix (MJ Bioworks, Finnzymes Oy), 0.4 μL Rox (TaKaRa), 1 μL senseprimer, 1 μL anti-senseprimer, 0.5 μL cDNA template, and 7.1 μL ddH2O. Each sample had 3 repeats. The thermocycler program was 94°C, 3 minutes; 94°C, 30 seconds; 55°C, 30 seconds; 72°C, 15 seconds, 40 cycles in an ABI PRISM 7900.

Electron microscopy for larvae infected with C6/36DNV at the first day after hatching.

After the first-day larvae were infected with C6/36DNV for 24 hours, two larvae were sampled randomly every day. Controls were also sampled. The samples were washed twice in physiologic salt solution. Each larva was cut into 2 or 3 parts by sharp blade, fixed in 2.5% glutaraldehyde (0.1M PBS, pH 7.4) overnight, then in 1% osmic acid (0.1M PBS, pH 7.4) for 1 hour. After serial dehydration in ethanol, they were Spurr-embedded for 16 hours at 70°C, ultrathin sectioned, stained with uranyl acetate and lead citrate. The preparations were examined in electron microscopy.

RESULTS

The susceptibility of different-age Ae. albopictus larvae to C6/36DNV.

To examine the susceptibility of different-age Ae. albopictus larvae to C6/36DNV, the first- and sixth-day larvae after hatching were infected with the same dose of C6/36DNV (genomes dose: 2.87 × 109 copy/ml) for the same period of time (24 hours). The first- and sixth-day larvae were sampled respectively in the first and the fourth day after infection and examined by conventional PCR. It was found that the first-day larvae were all C6/36DNV-positive, while the sixth-day larvae were all C6/36DNV-negative (Figure 1).

When the sixth-day larvae were exposed to C6/36DNV (genomes dose: 2.87 × 109 copy/ml) for a longer time (72 hours) or with higher dose of C6/36DNV (genomes dose: 6.14 × 1011 copy/ml) for 24 hours, the larvae sampled in the first day and the fourth day respectively after infection were all C6/ 36DNV-positive (Figure 2).

C6/36DNV latency in adults and its transmission to offspring.

To find out whether C6/36DNV could persist in adults, we examined the survival adults that grew from C6/ 36DNV-positive larvae by conventional PCR. The survival adults were C6/36DNV-positive (Figure 3).

We then continued to culture the survivors. After their oviposition and hatching, both the G1 larvae and G1 offspring adults were C6/36DNV-positive as detected by conventional PCR (Figure 3). This confirms that C6/36DNV-latent adults could transmit C6/36DNV to offspring.

The mortality for larvae infected with C6/36DNV at the first day after hatching.

Two batches of the first-day larvae were infected with C6/36DNV (dose: 2.87 × 109 copy/ml) for 24 hours. The number of larvae and pupae, live or dead, was counted on a daily basis until all had become adults (Table 2).

In the first batch, the mortality peak of experimental larvae and pupae appeared in the second and the tenth day, while the mortality peak of the control group appeared only in the tenth day. The mortalities of 600 experimental larvae and 600 control larvae were 97.16% and 12.33%, respectively.

In the second batch, the mortality peak of the experimental larvae and pupae appeared in the fourth and the eighth day. In control, the mortality peak appeared only in the ninth day. The mortalities of 2,100 experimental larvae and 500 control larvae were 97.77% and 16.00%, respectively.

The average mortalities of 2 experiment and control groups were 97.46% and 14.17%. The curvilinear trend of the mortality in the 2 experiment groups and controls was shown in Figure 4.

The mortality for larvae infected with C6/36DNV at the sixth day after hatching.

The six-day larvae were infected with C6/36DNV (genome dose: 2.87 × 109 copy/ml) for 72 hours. The mortality of the experiment group was 43.00%, compared with 11.00% in control. When the six-day larvae were infected with C6/36DNV (genome dose: 6.14 × 1011 copy/ml) for 24 hours, the mortalities of the experiment and the control group were 38.50% and 10.00%, respectively (Table 3).

Absolute real-time qPCR for dynamic change of the C6/ 36DNV in larvae and adult.

The infection of 3,000 first-day larvae after hatching, sampling, and qPCR were carried out as described in “Materials and Methods”. The results of qPCR for dynamic quantitative change of the C6/36DNV genome in larvae and adult are listed in Figure 5. Results showed that the virus quantity rose rapidly after infection and reached peak at the fifth day, then decreased slowly and reached the minimum in the twentieth day when the larvae became adults. The standard curve R2 = 0.9945442 and only 1 dissociation curve.

Absolute real-time qPCR detecting C6/36DNV before and after DEN-II infected the C6/36DNV-positive adults.

The DEN-II infection, sampling, and qPCR were carried out as described in “Materials and Methods”. Before DEN-II infection, the quantity of C6/36DNV in adults was at a relatively low level between 8.22 × 109 copy/μl~ 3.73 × 1010 copy/μl. After DEN-II infection, the quantity of C6/36DNV in adults ascended to the range of 1.01 × 1012 copy/μl~ 4.50 × 1013 copy/μl. The quantity of C6/36DNV after DEN-II infection was several thousand times more than what it was before DEN-II infection. The standard curve R2 = 0.98060364 and only 1 dissociation curve. The results are listed in Table 4.

Relative real-time qPCR detecting DEN-II after DEN-II infected both the C6/36DNV-positive and C6/36DNV-negative adults.

The DEN-II infection, sampling, and qPCR were carried out as described in “Materials and Methods”. The DEN-II viral relative load was determined by normalizing the CT values of the virus with internal control gene rpL8 CT values. The results are listed in Table 5. The relative quantity of sample b1 in qPCR assay was calculated as the benchmark line. The relative quantity of DEN-II in C6/ 36DNV-negative adults was between 7.58 × 101 to 2.94 × 101, while the relative quantity in C6/36DNV-positive adults was between 3.83 × 10−1 to 1. The relative quantity of DEN-II in C6/36DNV-negative adults was about 100 times more than that in C6/36DNV-positive adults.

Electron microscopy for larvae infected with C6/36DNV at the first day after hatching.

After the first-day larvae were infected with C6/36DNV, two mosquitoes were sampled randomly every day. Controls were also sampled. The samples were examined by electron microscopy. No virus-like particle, virus-related structure, or pathologic change was observed in the first-, second-, or third-day samples. In the fourth-day sample, there were virus paracrystalline structures in the nuclei and cytoplasm of fat body cells. The nuclear membrane began to expand, with increased heterochromatin in nucleus. But there was no obvious pathologic change in other tissues. In samples after the fourth day, other tissues such as hypodermal cells and muscle cells also appeared some pathologic changes. For example, nuclear membrane was broken and dissolved. Both the mitochondria and the endoplasmic reticulum swelled. In some serious cases, the infected cell dissolved and died (Figure 6).

DISCUSSION

Other virus pathogens for mosquito, such as Mosquito iridescent virus, Yokoshoji virus, and mosquito African virus have been thoroughly studied, but their potential use in biologic control was revealed to be limited.1820 In contrast, some mosquito densovirus were reported to efficiently control mosquito larvae. We have seen a new prospect, but the virus pathogenesis, production, and application require further investigation and optimization before field application.

In Asia, Ae. albopictus is one of the most important vectors of yellow fever, dengue, encephalitis, and other arboviruses.14,15 C6/36DNV, a new mosquito densovirus, was detected, isolated, and studied deeply by Chen et al. in our laboratory.1 We used the virus to infect Ae. albopictus larvae, and obtained a series of experimental results.

The results of the susceptibility of different-age larvae to C6/36DNV revealed that the first-day larvae after hatching could be infected successfully at a lower dose (2.87 × 109 copy/ml) for a shorter time (24 hours) with the mortality of 97.463%, while the sixth-day larvae after hatching were infected at a higher dose (6.14 × 1011 copy/ml) or for a longer time (72 hours) with a mortality of only 40.75%. These results suggested that the sixth-day larvae might be less sensitive to environmental changes and more resistant to pathogens such as C6/36DNV. In addition, parvoviruses depend on the S phase of the host cell for replication,21 and this predilection for dividing cells is also a reliable explanation for this phenomenon. When infected, the older the larvae are, the more likely the larvae can survive. The C6/36DNV-positive adults we obtained mostly grew up from the C6/36DNV-infected sixth-day larvae. They can transmit the virus to their offspring. It may indicate an advantage of biologic control agent for mosquito arising from the persistent viral infections in mosquitoes.

In the assay of infecting first-day larvae with C6/36DNV for 24 hours, there were 2 mortality peaks. The first one appeared from the second to the fourth day after infection. It was smaller than the second one that appeared from the eighth to the tenth day. There were also 2 peaks of virus quantity in the results of absolute qPCR for the C6/36DNV-infected first-day mosquito larvae. Interestingly, the first larval mortality peak (the second day in experimental group II and the fourth day in experimental group II) is less obvious but the virus quantity in almost the same period (the fifth day after infection) reaches the maximum peak. The second larval mortality peak, which is the most remarkable after infection, does not appear in the period of the highest quantity of virus, but in the tenth day (experimental group II) and the eighth days (experimental group II) when virus quantity began to decline. It is possible that the first peak was caused mainly by the virus itself, while the second one partially by the fact that C6/36DNV-infected larva was in the pupal stage. In the pupation stage, mosquito larvae’s resistance to diseases declines. With the effect of virus infection, the number of dead larvae reached the highest peak in this stage. Comparing with results in the control group that the unique mortality peak also appeared in the pupation stage, this hypothesis seems reasonable. In biologic mosquito control, the pupation stage is worth of notice. Additionally, C6/36DNV infection seemed to prolong the larval period. The possible reason is that the nucleic acid of C6/36DNV begins to replicate greatly after larvae were infected with it. The act of DNA replication may compete for the nutrition needed for larvae cell division. Therefore, the division of larvae cell might be interrupted, and larvae might grow slowly. Further investigation is needed for the explanation of its mechanism.

The observation under electron microscope revealed that the virus paracrystalline structures and pathology began to appear in the fourth-day sample. In the qPCR assay, the virus quantity rose rapidly after infection, and reached peak in the fifth day. The two results suggested that large amount of DNA of C6/36DNV was synthesized, but was not processed to assemble the whole virus particles until the fourth day after infection.

Burivong et al. 22 have done some studies on the interaction of AalDNV with DEN-II in C6/36 cell. When challenged by DEN-II, naive C6/36 cell showed severe cytopathic effects (CPE) and high mortality within 4 days, as did early passage anti-AalDNV –positive cells (APC) cultures. Remarkably, DEN-II infections in persistent APC cultures were much less severe, characterized by reduced DEN-II-infection percentage, retarded DEN-II virion production, no CPE, and no significant mortality.22 No other studies on the interaction of mosquito densovirus with DEN-II in cell or mosquito are available.

In our study, before DEN-II infection, the C6/36DNV quantity in survival C6/36DNV-positive mosquito adults was at a relatively low level. After DEN-II infection, the C6/ 36DNV quantity ascended to a higher level. It is several thousand times that the C6/36DNV quantity after DEN-II infection is more than that before infection (Table 4). These results suggest that DEN-II could greatly stimulate the reproduction of latent C6/36DNV in Ae. albopictus.

After the survival C6/36DNV-positive and healthy C6/ 36DNV-negative mosquito adults were infected with DEN-II under the same infection protocol, the DEN-II relative quantity in the healthy C6/36DNV-negative mosquito adults was about 100 times more than that in the survival C6/36DNV-positive adults (Table 5). It seems that the C6/36DNV-latent Ae. albopictus mosquitoes are not suitable for DEN-II reproduction. In other words, C6/36DNV could probably retard or interfere with the reproduction of DEN-II in Ae. albopictus mosquitoes. This inhibitory effect indicates a second advantage arising from the persistent viral infections in mosquitoes.

However, the mechanism of the interaction between C6/ 36DNV and DEN-II in Ae. albopictus mosquitoes has not been well understood. According to the presumption of Burivong et al.22 and studies on other viruses, the mechanism of the interaction of C6/36DNV with DEN-II might be explained as the following. Defective interfering viral particles (DIP) of densoviruses and other viruses in interfering with virus infection have been reported. DIP has long been suggested to take part in the interference in viral production or competition with infective particles for cell receptors.22,23 However, whether DEN-II and C6/36DNV share the same cell receptors has not been determined. It seems that the interference of DIP might occur in the process of virus production. There might be some defections in the DIP, which retards the vast reproduction of C6/36DNV. When DEN-II infected the C6/36DNV-positive mosquitoes, these defections in DIP of C6/36DNV could be compensated. On the other hand, the production of DEN-II might be inhibited by the competition with DIP of C6/36DNV for some DEN-II gene products.

This phenomenon could occur in the case of homologous virus re-infection, called superinfection exclusion. DEN-I is against DEN-III re-infection in C6/36 cell.24 Sindbisvirus-positive Ae. albopictus cell lines excluded the replication of both homologous (variant strains) and heterologous alphaviruses.25 The phenomenon may also involve intracellular host factors such as interferon, interferon-like substances, or other antiviral substances. However, other explanations are possible and more work would be needed to prove the DIP contention.

Compared with the phenomenon of dual to multiple infections occurring in shrimp26 and interaction of DEN-II with AalDNV in C6/36 cells,22 another mechanism of the interaction of C6/36DNV with DEN-II could be proposed. The vast replication of C6/36DNV may trigger the apoptosis in mosquito cells. That is why we obtained the higher larvae mortality. Once the C6/36DNV persists in mosquito cells, the process of viral accommodation prevents the apoptosis from being triggered by some unknown process. It may result in the fact that the C6/36DNV-positive mosquitoes seem to be healthy and be able to transmit C6/36DNV to the next generation. But the infection of DEN-II induces the vast replication of C6/36DNV, and then re-triggers the apoptosis. As the result obtained from the AalDNV-positive C6/36 cells,22 the DEN-II infection might also cause the increasing mortality of the C6/36DNV-positive mosquito. Further work is needed to determine whether the C6/36DNV accommodation in mosquito prevents apoptosis from being triggered and whether the DEN-II infection could also induce the increasing mortality of C6/36DNV-positive mosquito.

Two questions still exist. Besides DEN-II, are there any other viruses that could trigger the vast reproduction of C6/ 36DNV in C6/36DNV-positive mosquitoes? In our experiment, we noticed when C6/36DNV-latent C6/36 cells were cultured under the conditions different from the conventional ones, the cells showed cytopathic effects and the quantity of C6/36DNV increased remarkably. Would the inappropriate environment conditions such as cold, heat, wind, light, rain, and other pathogens cause the vast replication of C6/36DNV in C6/36DNV-positive mosquitoes? Both of them require further investigation.

In a word, lots of work must be done concerning the interaction between DEN-II and C6/36DNV and in the application of C6/36DNV as a potential biologic mosquito control agent.

Table 1

Primers of conventional polymerase chain reaction (PCR) and real-time qPCR for C6/36DNV, DEN-II, and rpL8

Virus/internal control geneUsageSequence (5′–3′)ProductReference
C6/36DNVConventional PCRSenseprimer: GCGGAATTCATGGCAGACAGCACTACAATGG1077 bp1
Anti-senseprimer: GCGGTCGACGAGTTTTCATTTCATATGGCATACGenBank accession no. AYO95351
Real-time qPCRSenseprimer: CTTCGCATTTCCAACTGT84 bp
Anti-senseprimer: TCCGTATTATCTGGCTCG
DEN-IIReal-time qPCRSenseprimer: AGACAACAATGAGGGGAG109 bpGenBank accession no. DO0346
Anti-senseprimer: AACTTGGTGGAGAGCCTT
RTAnti-senseprimer: AACTTGGTGGAGAGCCTT
rpL8Real-time qPCRSenseprimer: TGGGGCGTGTTATTCGT83 bp27
Anti-senseprimer: TTTGGGCTCTCCCTTTCGenBank accession no. M99055
RTAnti-senseprimer: TTTGGGCTCTCCCTTTC
Table 2

The mortality for larvae infected with C6/36DNV at the first day after hatching

Experimental group I of 600 larvaeControl group I of 600 larvaeExperimental group II of 2100 larvaeControl group II of 500 larvae
Days after infectionDeath of larvaeDeath of pupaeSurvival adultsDeath of larvaeDeath of pupaeSurvival adultsDeath of larvaeDeath of pupaeSurvival adultsDeath of larvaeDeath of pupaeSurvival adults
1289
24613
32873
419273
51551
671123
78328323
828338152
9592632935107
10971415233583514
11751111475439317
12434171410325725
1326482365726635
14323178518428289
152019812782477
1612227493143
1754156273449
189362178111133
194344931220
20222312229
21341
Total number56320176311526199261475624420
Percentage93.83%3.33%2.83%10.50%1.83%87.67%94.86%2.91%2.23%11.20%4.80%84.00%
Total mortality97.16%12.33%97.77%16.00%
Table 3

The mortality of larvae infected with C6/36DNV at the sixth day after hatching

Experimental group I of 200 larvaeControl group I of 200 larvaeExperimental group II of 200 larvaeControl group II of 200 larvae
Mortality of larvae and pupaeNumber of survival adultsMortality of larvae and pupaeNumber of survival adultsMortality of larvae and pupaeNumber of survival adultsMortality of larvae and pupaeNumber of survival adults
Larvae infected with a lower dose of virus for 72 hr8611422178Larvae infected with a higher dose of virus for 24 hr7712320180
Percentage43%57%11%89%Percentage38.5%61.5%10%90%
Table 4

The absolute real-time qPCR results of the quantity of C6/36DNV genomes before and after DEN-II infected the C6/36DNV-positive adults

Sample (11 mosquitoes per sample)Quantity of C6/36DNV genomes (copy/ml)
Fourth day before infection3.73 × 1010
Third day before infection7.11 × 1010
Second day before infection2.87 × 1010
First day before infection8.22 × 109
First day after infection1.01 × 1012
Second day after infection4.85 × 1012
Third day after infection2.47 × 1013
Fourth day after infection1.65 × 1013
Fifth day after infection4.50 × 1013
Table 5

The results of the relative quantity of DEN-II genomes after DEN-II infected the C6/36DNV-positive and the C6/36DNV-negative adults by real-time qPCR

Sample (11 mosquitoes per sample)Relative quantity of DEN-II
First day after C6/36DNV-negative mosquito infection (f1)7.58 × 101
Second day after C6/36DNV-negative mosquito infection (f2)3.23 × 101
Third day after C6/36DNV-negative mosquito infection (f3)2.94 × 101
First day after C6/36DNV-positive mosquito infection (b1)1.00
Second day after C6/36DNV-positive mosquito infection (b2)3.83 × 10−1
Third day after C6/36DNV-positive mosquito infection (b3)3.97 × 10−1
Figure 1.
Figure 1.

The conventional PCR results of the first- and sixth-day larvae after hatching infected with C6/36DNV for 24 hours. M: wide range DNA ladder marker; 1: the first-day sample (20 larvae) of first-day larvae infected with C6/36DNV; 2: the fourth-day sample (20 larvae) of first-day larvae infected with C6/36DNV; 3: the first-day sample (20 larvae) of sixth-day larvae infected with C6/36DNV; 4: the fourth-day sample (20 larvae) of sixth-day larvae infected with C6/ 36DNV; 5: chronically C6/36DNV-infected C6/36 cell lines as positive control; 6: C6/36DNV-free mosquitoes (20 adults) as negative control.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

Figure 2.
Figure 2.

The conventional PCR results of sixth-day larvae after hatching infected with C6/36DNV. M: wide range DNA ladder marker; 1: the first-day sample (20 larvae) of sixth-day larvae infected with a lower dose of virus for 72 hours; 2: the fourth-day sample (20 larvae) of sixth-day larvae infected with a lower dose of virus for 72 hours; 3: the first-day sample (20 larvae) of sixth-day larvae infected with a higher dose of virus for 24 hours; 4: the fourth-day sample (20 larvae) of sixth-day larvae infected with a higher dose of virus for 24 hours; 5: chronically C6/36DNV-infected C6/36 cell lines as positive control; 6: C6/36DNV-free mosquitoes (20 adults) as negative control.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

Figure 3.
Figure 3.

The conventional PCR results of C6/36DNV-latent adults and their offspring. M: wide range DNA ladder marker; 1: survival adults (20 adults) from the C6/36DNV-positive larvae; 2:G1 larvae (20 larvae) from survival C6/36DNV-positive adults; 3: G1 adults (20 adults) from G1 C6/36DNV-positive larvae; 4: chronically C6/36DNV-infected C6/36 cell lines as positive control; 5: C6/36DNV-free mosquitoes (20 adults) as negative control.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

Figure 4.
Figure 4.

The curvilinear trend of the mortality for larvae infected with C6/36DNV at the first day after hatching.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

Figure 5.
Figure 5.

The absolute real-time qPCR results of the quantity of C6/36DNV genomes in larvae and survival adults (20 larvae or adults per sample) after C6/36DNV infected the first-day larvae after hatching. Larvae were sampled from the first day to the sixteenth day. In the twentieth day, adults were sampled.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

Figure 6.
Figure 6.

On the fourth day after C6/36DNV infected the first-day larvae after hatching, there were virus paracrystalline structures in nuclei of fat body cells. N: nuclei; C: cytoplasm.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 6; 10.4269/ajtmh.2006.75.1118

*

Address correspondence to Jingqiang Zhang, Sun Yat-Sen University, State Key Lab for Biocontrol and Institute of Entomology, Guangzhou 510275, PR China. E-mail: ww20032006@eyou.com

Authors’ addresses: Wei Wei, Dingyong Shao, Xiaojun Huang, Haidong Chen, Qingfen Zhang, Jingqiang Zhang, Sun Yat-Sen University, State Key Lab for Biocontrol and Institute of Entomology, Sun Yat-Sen University, Guangzhou 510275, PR China; Jianping Li, Zhejiang University College of Animal Science, Hangzhou Zhejiang 310027, PR China.

Acknowledgments: This work was supported by special funds of National Natural Science Foundation (No.10274106). The authors also thank Meiyu Fang for providing the Dengue virus type II.

REFERENCES

  • 1

    Chen S, Cheng L, Zhang Q, Lin W, Lu X, Brannan J, Zhou ZH, Zhang J, 2004. Genetic, biochemical, and structural characterization of a new densovirus isolated from a chronically infected Aedes albopictus C6/36 cell line. Virology 318 :123–133.

    • Search Google Scholar
    • Export Citation
  • 2

    Jousset FX, Barreau C, Boublik Y, Cornet M, 1993. A Parvo-like virus persistently infecting a C6/36 clone of Aedes albopictus mosquito cell line and pathogenic for Aedes aegypti larvae. Virus Res 29 :99–114.

    • Search Google Scholar
    • Export Citation
  • 3

    Lebedeva OP, Kuznetsova MA, Zelenko AP, Gudz-Gor-bana AP, 1973. Investigation of a virus disease of the densonucleosis type in a laboratory culture of Aedes aegypti. Acta Virol 17 :253–256.

    • Search Google Scholar
    • Export Citation
  • 4

    O’Neill SL, Kittayapong P, Braig HR, Andreadis TG, Gonzalez JP, Tesh RB, 1995. Insect densoviruses may be widespread in mosquito cell lines. J Gen Virol 76 :2067–2074.

    • Search Google Scholar
    • Export Citation
  • 5

    Ward TW, Jenkins MS, Afanasiev BN, Edwards M, Duda BA, Suchman E, Jacobs-Lorena M, Beaty BJ, Carlson JO, 2001. Aedes aegypti transducing densovirus pathogenesis and expression in Aedes aegypti and Anopheles gambiae larvae. Insect Mol Biol 10 :397–405.

    • Search Google Scholar
    • Export Citation
  • 6

    Barreau C, Jousset F-X, Bergoin M, 1996. Pathogenicity of the Aedes albopictus parvovirus (AaPV), a denso-like virus, for Aedes aegypti mosquitoes. J Invertebr Pathol 68 :299–309.

    • Search Google Scholar
    • Export Citation
  • 7

    Barreau C, Jousset F-X, Bergoin M, 1997. Venereal and vertical transmission of the Aedes albopictus parvovirus in Aedes albopictus mosquitoes. Am J Trop Med Hyg 57 :126–131.

    • Search Google Scholar
    • Export Citation
  • 8

    Kittayapong P, Baisley KJ, O’Neill SL, 1999. A mosquito densovirus infecting Aedes aegypti and Aedes albopictus from Thailand. Am J Trop Med Hyg 61 :612–617.

    • Search Google Scholar
    • Export Citation
  • 9

    Jousset FX, Baquerizo E, Bergoin M, 2000. A new densovirus isolated from the mosquito Culex pipiens (Diptera: culicidae). Virus Res 67 :11–16.

    • Search Google Scholar
    • Export Citation
  • 10

    Rwegoshora R, Baisley K, Kittayapong P, 2000. Seasonal and spatial variation in natural densovirus infection in Anopheles minimus S.L. in Thailand. Southease Asian J Trop Med Public Health 21 :3–9.

    • Search Google Scholar
    • Export Citation
  • 11

    Buchatsky LP, 1989. Densonucleosis of bloodsucking mosquitoes. Dis Aqua Org 6 :145–150.

  • 12

    Ledermanm JP, Suchman EL, Black WC IV, Carlson JO, 2004. Infection and pathogenicity of the mosquito densoviruses AaeDNV, HeDNV, and APeDNV in Aedes aegypti mosquitoes (Diptera:Culicidae). Biological and Microbial Control 97 :1828–1835.

    • Search Google Scholar
    • Export Citation
  • 13

    Barreau C, Jousset F-X, Cornet M, 1994. An efficient and easy method of infection of mosquito larvae from virus-contaminated cell cultures. J Virol Methods 49 :153–156.

    • Search Google Scholar
    • Export Citation
  • 14

    Mitchell CJ, 1995. Geographic spread of Aedes albopictus and potential for involvement in arbovirus cycles in the Mediterranean basin. J Vec Ecol 20 :44–58.

    • Search Google Scholar
    • Export Citation
  • 15

    Ibanez-Bernal S, Briseno B, Mutebi JP, Argot E, Rodriguez G, Martinez-Campos C, Paz R, De La Fuente-San Roman P, Tapia-Conyer R, Flisser A, 1997. First record in America of Aedes albopictus naturally infected with dengue virus during the 1995 outbreak at Reynosa, Mexico. Med. Vet. Entomol Mexico II: 305–309.

    • Search Google Scholar
    • Export Citation
  • 16

    Hunter-Fujita FR, Entwistle PF, Evans HF, Crook NE, eds., 1998. Insect Viruses and Pest Management. Chichesten, UK.

  • 17

    Moscardi F, 1999. Assessment of the application of baculoviruses for control of Lepidoptera. Annu Rev Entomol 44 :257–289.

  • 18

    Linley JR, Nielsen HT, 1968. Transmission of a mosquito iridescent virus in Aedes taeniorhynchus.I. Laboratory experiments. J Invertebr Pathol 12 :7–16.

    • Search Google Scholar
    • Export Citation
  • 19

    Igarashi A, Matsuo S, Bundo-Morita K, 1986. Larvicidal effect of an insect virus of mosquitoes: An attempt to use as a potential agent of biological control on mosquitoes. Trop Med 28 :191–207.

    • Search Google Scholar
    • Export Citation
  • 20

    Cornet M, Deubel V, Mattei X, 1986. Le virus MAV: Unnouveau moyen de lutte contre Aedes aegypti. Ann Inst Pasteur Virol 137E :417–424.

  • 21

    Berns KI, 1996. Parvoviridae: the viruses and their replication. BN Fields, DM Knipe, PM Howley, eds. Fundamental Virology. Third edition. Philadelphia, PA: Lippincott-Raven, 1017–1041.

  • 22

    Burivong P, Pattanakitsakul S-N, Thongrungkiat S, Malasit P, Flegel TW, 2004. Markedly reduced severity of Dengue virus infection in mosquito cell cultures persistently infected with Aedes albopictus densovirus (AalDNV). Virology 329 :261–269.

    • Search Google Scholar
    • Export Citation
  • 23

    Rhode SL, 1978. Defective interfering particles of parvovirus H-1. J Virol 27 :347–356.

  • 24

    Dittmar D, Castro A, Haines H, 1982. Demonstration of interference between dengue virus types in cultured mosquito cells using monoclonal antibody probes. J Gen Virol 59 :273–282.

    • Search Google Scholar
    • Export Citation
  • 25

    Karpf AR, Lenches E, Strauss EG, Strauss JH, Brown DT, 1997. Superinfection exclusion of alphaviruses in three mosquito cell lines persistently infected with Sindbis virus. J Virol 71 :7119–7123.

    • Search Google Scholar
    • Export Citation
  • 26

    Namikoshi A, Wu JL, Yamashita T, Nishizawa T, Nishioka T, Arimoto M, Muroga K, 2004. Vaccination trials with Penaeus japonicus to induce resistance to white spot syndrome virus. Aquaculture 229 :25–36.

    • Search Google Scholar
    • Export Citation
  • 27

    Liu J, Fallon AM, 1998. Effect of nutrient deprivation on ribosomal RNA and ribosomal protein mRNA in cultured mosquito cells. Arch Insect Biochem 37 :239–247.

    • Search Google Scholar
    • Export Citation
Save