INTRODUCTION
Alphaviruses cause two distinct, general disease patterns: encephalitis with or without demyelination or febrile illness with persistent arthralgia. Each alphavirus causes only one of these disease patterns, but the clinical syndromes are not segregated geographically. For example, the alphaviruses present in South America are Venezuelan equine encephalitis virus (VEEV), eastern equine encephalitis virus (EEEV), western equine encephalitis virus (WEEV), Mayaro virus (MAYV), Una virus (UNAV), Pixuna virus (PIXV), Aura virus (AURAV), and Trocara virus (TROCV). The first three, as indicated by their names, cause encephalitis, MAYV and UNAV cause febrile illness with an accompanying prolonged and severe arthritis, whereas PIXV, AURAV, and TROCV are not known to cause serious human illness.1
In addition to the distinct clinical illness patterns, alphaviruses have several different arthropod-borne transmission cycles that allow the viruses to be maintained in nature. The most well characterized of these transmission cycles are those of the equine encephalitis viruses, VEEV, EEEV, and WEEV. Enzootic VEEV is typically transmitted between small rodents and mosquitoes of the subgenus Culex melanoconion.2 WEEV and EEEV are better known as viruses that are maintained in bird–mosquito transmission cycles. However, South American EEEV strains may be maintained in mosquito–rodent–mosquito cycles similar to that of VEE complex viruses.3–5 These viruses have received much attention because of the severity of disease when they infect human or equine populations. Viruses such as MAYV and UNAV, new world members of the Semliki forest antigenic complex, are far well less characterized, presumably because the extent of their ability to cause human illness is poorly understood.
MAYV was first isolated in 1954 from human sera recovered from febrile patients in Trinidad.6 There have been four documented epidemics of MAYV disease providing the few opportunities to study the virus during outbreaks of human illness.7–11 One outbreak in Belterra, Brazil, during 1978 that was extensively studied provided the first detailed description of MAYV epidemiology.6,7 During this outbreak, virus isolates were recovered only from Haemagogus janthinomys mosquitoes, predominantly in the forest canopy where this mosquito is most typically found. However, two isolates were made from this mosquito species at ground level, suggesting that canopy-dwelling mosquitoes could transmit the virus to humans.12 During the same study, investigators found antibodies against MAYV in only 1% of the birds captured but 27% of marmoset (Callithrix) sera sampled were positive, indicating that tree-dwelling primates could be a primary vertebrate host of MAYV. The studies during this outbreak represented the first time a specific insect vector was identified in the transmission of epidemic MAYV and suggested a sylvatic vertebrate host may have contributed to amplification during the outbreak. However, the lack of human cases after the epidemic and inability to recover virus from Hg. janthinomys the following year indicated that the maintenance cycle had not yet been identified. Two additional small outbreaks in Brazil were recorded in 1991 in Benevides, Pará State, and Peixe, Tocantins State, in 1991, when two isolates of MAYV were obtained in each municipality from febrile patients and several other patients showed specific IgM antibodies. Additionally, 15 MAYV strains were isolated from Hg. janthinomys during the outbreaks (Travassos da Rosa and Vasconcelos, unpublished information); this was the same vector that was incriminated during previous outbreaks. Additional field and laboratory studies identified several mosquitoes that could serve as potential vectors of MAYV,13,14 as well as several other species of vertebrates that were found to have antibodies against MAYV.15–21 Despite these efforts, a maintenance cycle for MAYV has not been clearly elucidated.
UNAV, the closest genetic relative of MAYV, is even less well understood. Little is known about the epidemiology of UNAV, and virtually no studies have been undertaken to identify a transmission cycle for this virus. Periodically, isolates of UNAV have been made from a variety of mosquito species including Psorophora ferox and Ps. albipes,22–24 but there is no indication that these are the predominant species involved in virus maintenance or epidemic transmission. Serosurveys have identified antibodies against UNAV in birds, horses, and humans25–28; however, the extent of viral distribution and human disease risk is unknown.
Until recently, characterization of MAYV and UNAV has been performed serologically by investigating plaque characteristics or by comparing their pathogenesis in experimentally infected animals.20,29–33 While all the strains examined in previous serological studies indicated the MAYV or UNAV under study were the same species, some specific tests such as plaque reduction/neutralization, complement fixation, or hemagglutination inhibition assays have shown distinctions among strains,8,34 suggesting different levels of virulence. Attempts to correlate these minor antigenic differences with biologic significance have not yet been successful. However, the observation that some large plaque variants produce more intense lesions in connective tissue of infant mice35 and that different strains varied in their pathogenicity for adult mice13 has led to speculation that virulence differences may exist among virus strains.
Recently, molecular methodologies have become valuable tools to genetically type viruses and to provide insight into the nature of viral transmission cycles and epidemiologic patterns.36–42 In this study, we used this approach to analyze > 60 strains of MAYV and UNAV isolated over the past 40 years, covering the known geographic range of these viruses (Figure 1). Our molecular analyses, combined with serological comparisons, give clearer indications of the genetic relationships among these viruses and suggest mechanisms for their maintenance in nature.
MATERIALS AND METHODS
Viral growth and RNA extraction.
Monolayer cultures of baby hamster kidney cells (BHK-21) or Vero cells in 25-cm2 flasks were infected at a multiplicity of infection (moi) of 0.05 of each virus listed in Table 1. Infected monolayers were observed daily until cytopathic effect (CPE) was evident in > 90% of the cells. At this time, a 250-μL aliquot of supernatant was mixed with 250 μL Trizol-LS (BRL Laboratories, Gaithersburg, MD). From the remaining cell culture supernatant, virus was concentrated by precipitation with polyethylene glycol and RNA extracted from the viral pellet using Trizol as previously described.43,44 Trizol slurries were stored at −80°C until RNA was extracted.
Trizol samples were mixed with 2 μL of yeast tRNA (Sigma, St. Louis, MO) and 200 μL of chloroform. After vortexing, the samples were centrifuged to separate the phases. The aqueous phase was mixed with isopropanol to precipitate the RNA, which was subsequently collected by centrifugation. The RNA pellet was resuspended in 20 μL of RNase-free water containing RNase inhibitor (Promega, Madison, WI) to prevent degradation until subsequent reverse transcription.
Reverse transcription and amplification.
A 5-μl aliquot of the extracted RNA was mixed in a buffered solution with dNTPs, RNase inhibitor, dithiothreitol, and T25-C or V primer designed to anneal to the poly-adenylation sequence. The mixture was placed in a 42°C bath for 2 minutes before 200 U of Superscript II (Promega) were added and cDNA was synthesis allowed to proceed for up to 12 hours.45 The resulting cDNA was amplified by polymerase chain reaction (PCR) using Pfu Turbo Polymerase (Stratagene, La Jolla, CA) and primers (40 pmol) designed to amplify a portion of E2, E1, and the 3′ non-coding region (NCR) from 9368 through the end of the genome (Table 2; Figure 2). Amplicons were either cleaned and sequenced directly or subcloned and sequenced from the plasmids.
Sequencing and phylogenetic analysis.
Sequencing reactions were performed on the PCR amplicons using Big Dye 3.0 on an ABI 377 automated sequencer or the DTCS Quick Start Kit on a Beckman capillary sequencer (see Table 2 for sequencing primers used). Sequences were aligned using the GAP and PILEUP program in the Genetics Computer Group package46 with manual refinements to maintain codon homology. Phylogenetic analyses were performed using maximum parsimony (heuristic algorithm), neighbor-joining distance matrix algorithms (Kimura 3 parameter and F84 corrections), and maximum-likelihood approaches (Quartet puzzling with the HKY85 least squares variant) within the PAUP program.47 Both nucleotide sequence covering the entire amplicon and amino acid sequence from the E2/E1 coding region were used in the analyses. Each clade was also resampled individually by maximum likelihood to increase resolution among highly conserved sequences. Other members of the alphavirus genus were included as outgroup members. Bootstrap resampling (1,000 replicates) provided estimates of confidence on the groups generated in each analysis.48
Production of immune sera.
BALB/C mice were used to generate immune sera to five diverse strains of UNAV (Tables 3 and 4). Animals received a single intraperitoneal injection of virus, and ~4 weeks after inoculation, mice were injected intraperitoneally with sarcoma 180 cells to produce hyperimmune ascitic fluid. Abdominal ascitic fluid was removed between 1 and 2 weeks after injection of the sarcoma cells and was used in serological analyses as described below.
Serological analyses.
Complement fixation (CF) and hemagglutination inhibition (HI) assays were performed on selected UNAV isolates to further characterize the relationships identified with genetic analyses. Two-way tests were completed with all five sera and antigens were examined. CF tests were performed using a microtechnique49 with two full units of guinea pig complement. Titers were recorded as the highest dilutions giving 3+ or 4+ fixation of complement on a scale of 0 to 4+. HI tests were also performed using a microtechnique, as described previously.49 Immune sera and ascitic fluids for the HI tests were acetone-extracted, and antigens were tested at pH 6.2.
RESULTS
Sequence analysis.
The sequence of nucleotides covering the 3′ portion of the E2 protein, the entire E1 protein, and the 3′ non-coding region (NCR) was determined for each MAYV and UNAV listed in Table 1; these strains were collected from a broad geographic range as depicted in Figure 1. This amplicon is a region that has previously been shown to contain phylogenetically informative characters for many alphaviruses36; therefore, the PCR products were analyzed by comparison of the nucleotide and deduced amino acid sequences with those of other previously sequenced alphaviruses. As expected, pairwise comparisons and phylogenetic analyses showed the isolates to be most closely related to other members within the Semliki Forest antigenic complex. Both nucleotide and E2/E1 amino acid sequences were used in the analyses; however, because of the extremely high degree of nucleotide conservation among the MAYV strains, amino acid analyses were less informative and generally produced topologies with less resolution. All analyses produced the same three distinct genotypes, but there were analysis-specific variations among the strains within a given genotype. For example, the high degree of genetic conservation frequently yielded several hundred equally parsimonious topologies at the terminal branches.
In all analyses performed, all MAYV strains formed a monophyletic group. Pairwise comparisons showed the MAYV strains to range from 0.05% to 18.2% nucleotide sequence divergence. These MAYV strains segregated into two distinct genotypic clades, each of which consisted of members with very little genetic divergence (Figure 3). The first clade (genotype D) contained isolates from 1954 to 2003, covering a geographic range spanning South America that included Trinidad, Brazil, French Guiana, Surinam, Peru, and Bolivia. This clade also contained the strain Uruma, which was reported as a new human pathogen in 1959 but never previously published as a MAYV strain.50 The most closely related virus strains within clade D were only 0.05% divergent with the maximum nucleotide diversity reaching 5.9%. The second clade (genotype L) contained only six isolates; all were geographically limited to the northcentral region of Brazil and were genetically similar (ranging from 0.1% to 3.0% nucleotide sequence divergence), even though the isolations were made over a broad temporal range (1955–1991). Members of genotype D were 15–18% divergent from strains of genotype L at the nucleotide level. Whereas bootstrap support for clustering within either clade was strong in only two instances (two early isolates from Trinidad and several recent isolates from Peru and Bolivia), there was 100% support for the distinction between the two clades.
As with the MAYV, the UNAV strains formed a monophyletic group. However, unlike the MAYV strains that exhibited a high degree of genetic relatedness within clades, the UNAV isolates were much more genetically diverse. Pairwise comparisons revealed nucleotide divergence levels between 2.5% and 27.7% with no apparent clustering based on geography or time of isolation. However, the limited number of isolates may contribute to the lack of any discernible patterns.
Antigenic analyses.
To further evaluate the relationships of the UNAV in this study, several strains were analyzed for antigenic differences of biologic significance. Antibodies to five strains were generated in mice and used in HI and CF assays to determine antigenic relationships against homologous and heterologous viruses (Tables 3 and 4, respectively). In general, the homologous virus titers were the highest in both testing formats; however, several exceptions to this trend were noted. For example, when ZPC195 strain (from Venezuela) was used as antigen, antibody titers from sera of BeAr13136 (Brazil) and CbaAn979 (Argentina) infected mice were up to 4-fold higher than the homologous titers in HI and/or CF assays, suggesting that this antigen contained broadly conserved epitopes. Curiously, Peruvian strain PE10800 (the virus most closely related to ZPC195 in the serological analysis) always had lower titers against ZPC195 antigen or serum than more phylogenetically distant strains. In comparisons of all strains included in this analysis, there was no instance where there were 4-fold or greater differences between strains in both directions. Whereas the one-way 4-fold differences did occasionally exist in both test formats, this is only sufficient to classify strains as antigenic subtypes.51 The UNAV strains from Peru and Colombia were indistinguishable by CF and HI assays with the strain from Venezuela, which is the most closely related antigenically to the Peruvian/Colombian pair. The strains from Brazil and Argentina were closely related to each other but more distant from the remaining viruses. These antigenic subtype distinctions demonstrated general geographic alignments as well as an agreement with the phylogenetic analyses performed in this study.
DISCUSSION
Mayaro viruses are one group of alphaviruses that are of resurging interest in South America. Recent reports suggest that changing demographics and land use practices could alter the frequency of human illness caused by MAYV.8,9,52 The most detailed studies of the virus occurred during an outbreak near Belterra, Brazil, in 1978. Through the epidemiologic and entomologic studies, a description of how a MAYV epidemic spreads and amplifies was proposed.7,8,12 Unfortunately, no clear understanding of how the virus is maintained afterward or what initiates an epidemic has been recorded. To accomplish this, extensive field studies to monitor human illness, non-human seroprevalence, and mosquito infection rates would be ideal. However, in the absence of such longitudinal field studies, molecular genetic analysis of existing MAYV isolates can provide clues as to its maintenance patterns and geographic distribution; this approach may also help to more effectively design field studies. We examined > 60 isolates of MAYV in an attempt to ascertain relationships among them. We also genetically analyzed the most closely related virus, UNAV, to determine if the patterns of maintenance for arthritis-causing alphaviruses in South America are consistent.
Our genetic analyses showed that the MAYV strains are monophyletic and form two very distinct genotypic lineages. Interestingly, the two genotypes are sympatric in the Amazon basin of Brazil, but they are > 15% divergent at the nucleic acid level. There is no evidence of alternate genetic types or other clades of MAYV in this same geographic area even though there are isolates from both the widely dispersed (D) and limited (L) genotypes from approximately the same year. Furthermore, even with isolates spanning over 40 years, there were no isolates identified that were distinct from either the L or D genotypes. This information suggests that distinct transmission patterns may have played a role in the evolution and current maintenance of MAYV.
The very close genetic relatedness of isolates within a given genotype is suggestive of a transmission mechanism that continually circulates viruses and is unimpeded by significant barriers to dispersal that would lead to divergent evolution. An example of another alphavirus that exhibits this molecular epidemiologic pattern is North American EEEV. EEEV, in North America, is maintained in a very well-characterized enzootic cycle involving Culiseta melanura mosquitoes and avian vertebrate hosts.53,54 Molecular phylogenetic studies of EEEV have shown that North American strains have > 98% nucleotide identity and form a single, highly conserved lineage grouped to some extent by geography and year of isolation.55–57 A virtually identical pattern is observed within each clade of MAYV in this study, suggesting that the maintenance may involve bird hosts that broadly disperse the viruses maintaining genetic homogeneity over extensive periods of time. As with the North American EEEV strains, some temporal groupings in the terminal branches of MAYV were observed and may reflect regional or local foci during a 2- to 3-year period. One example was the cluster of 13 strains from Peru and Bolivia collected in 2002–2003. This clustering may only have been identified because numerous isolates were obtained from the same area during a short time frame allowing only this degree of resolution in the genetic analyses. Similar localized patterns of virus transmission have been documented for St. Louis encephalitis virus58 and West Nile virus,59 which are maintained in mosquito–bird transmission cycles. While there is little information regarding the seroprevalence of MAYV in birds, there have been isolations from avians and some evidence that birds may be involved in the enzootic cycles.15,52
More intriguing than the low degree of genetic diversity within clades is the distinct and complete divergence of the two genotypes of MAYV with no other apparent genetic types existing. This is particularly curious because of the overlapping geography and the fact that both genotypes contain isolates spanning 30 or more years. This would suggest that both lineages are maintained independently in enzootic maintenance cycles in discrete foci leading to divergent gene flow and that neither has gone extinct. In this scenario, transmission by resident vertebrates (in genotype L), rather than widely dispersing avian hosts, would seem likely. Detection of antibodies against MAYV in sloths, marmosets, other primates, rodents, and numerous other non-flying mammals12,16,19,60,61 provides evidence that focal enzootic transmission of the virus may indeed be a component of the transmission cycle that led to the evolution of two distinct MAYV genotypes.
Because several MAYV isolates have been obtained from Haemagogus sp. mosquitoes, it has also been postulated that MAYV is maintained in constantly moving waves or “wandering epizootics” by non-human primates similar to the pattern that has been described for the sylvan cycle of yellow fever virus (YFV).52 The fact that distinct genotypes exist would suggest that, at most, the wandering population hypothesis is only partially applicable. As with MAYV, this finding of discrete genetic groups of YFV in the Amazon region has also been used to argue against the concept of continuous movement of the virus within primate populations.40 Additionally, if a single, intermixed population of MAYV was continually moving across the broad geographic range of tropical South America, a continual evolution of the virus from a hypothetical ancestor would be expected. Our genetic analysis showed no evidence of this but rather a true conservation of the genome over time and space.
In contrast to the high degree of genetic homogeneity among the MAYV strains, the UNAV isolates examined in this study have a very different phylogenetic pattern. The UNAV strains are monophyletic but have a maximum genetic diversity of 28%. They are also distinct from the MAYV strains, with only ~45% nucleotide identity between the two species. While some of the UNAV strains isolated by as much as 35 years apart were quite similar (pairwise comparisons of as little as 2.5%), others separated by only a few years varied genetically by 20%. The genetic diversity pattern of UNAV would suggest that these viruses moved to new ecological niches and subsequently established discrete enzootic foci in which the viruses are being maintained, following divergent evolutionary paths. This would be consistent with transmission by rodents or other vertebrates with limited movement patterns. Our serological analyses were a further attempt to ascertain the relationships among the UNA viruses and were in general agreement with the phylogenetic analyses. Unfortunately, the degree of cross-reactivity among the antisera produced in our study was too great to distinguish these viruses as more than variants or subtypes. With the paucity of seroprevalence data for UNAV, the molecular evidence implicating discrete transmission foci provides the most reasonable estimate of enzootic maintenance for the virus at this time. Of further note for both the UNAV and MAYV strains is that, whereas the serological analyses indicate that there are indeed some distinctions, in the absence of biologic characterization of these isolates, it is difficult to assess whether these subtypes have pathogenic or epidemiologic relevance. It is also important to emphasize that, whereas MAYV is a well-known human pathogen, UNAV has not yet been recovered from humans. Further studies are warranted to evaluate the extent of distribution of MAYV and UNAV and the risk to human and animal populations in the affected areas. Hopefully, information obtained from the molecular epidemiologic studies presented here will provide information to make more informed decisions regarding the most appropriate field materials to be collected.
Summary of Mayaro and Una viral isolates examined
| Strain | Location state/department, country | Isolation date | Passage history | Source | Accession no. |
|---|---|---|---|---|---|
| V, Vero cells; BHK, baby hamster kidney cells; C6/36, Aedes albopictus mosquito cells; SM, suckling mouse; P, passage of undocumented cell or host type; ?, unknown number of passages. | |||||
| Mayaro viruses | |||||
| 07-18066-99 | Huanuco, Peru | July, 1999 | V-1, BHK-1 | Human serum | DQ487401 |
| ARV 0565 | San Martin, Peru | April, 1995 | SM-1, V-1 | Human | DQ487397 |
| BeAn 343102 | Para, Brazil | May, 1978 | Sm-4, V-1 | Monkey | DQ487389 |
| BeAr 30853 | Para, Brazil | May, 1961 | SM-1, V-1 | Ixodes spp. | DQ487378 |
| BeAr 350396 | Para, Brazil | August, 1978 | V-1 | Haemagogus spp. | DQ487388 |
| BeAr505411 | Para, Brazil | March, 1991 | SM-1, V-1, BHK-1 | Haemagogus janthinomys | DQ487382 |
| BeH 186258 | Amapa, Brazil | June, 1970 | V-1 | Human | DQ487408 |
| BeH 256 | Para, Brazil | April, 1955 | SM-8, V-1 | Human serum | DQ487381 |
| BeH 342912 | Para, Brazil | April, 1978 | SM-2, V-1 | Human | DQ487387 |
| BeH 343148 | Para, Brazil | April, 1978 | V-1 | Human | DQ487413 |
| BeH 343155 | Para, Brazil | April, 1978 | V-1 | Human | DQ487390 |
| BeH 343178 | Para, Brazil | April, 1978 | V-1 | Human | DQ487391 |
| BeH 394881 | Para, Brazil | June, 1981 | SM-2, V-1 | Human | DQ487414 |
| BeH 407 | Para, Brazil | 1955 | P-?, V-2 | Human | DQ487380 |
| BeH 473130 | Para, Brazil | May, 1988 | V-1 | Human | DQ487379 |
| BeH 428890 | Para, Brazil | December, 1984 | SM-1, V-1 | Human | DQ487383 |
| BeH 504378 | Para, Brazil | 1991 | SM-1, V-1 | Human | DQ487407 |
| BeH 504639 | Goias, Brazil | 1991 | SM-1, V-1 | Human | DQ487392 |
| BeH 506151 | Tocantins, Brazil | 1991 | SM-1, V-1 | Human | DQ487386 |
| D218 | Surinam | September, 1984 | P-1, C6/36-2, BHK-1 | Human serum | DQ487409 |
| DEF533 | Loreto, Peru | March, 2003 | Human serum | DQ487425 | |
| FSB279 | Bolivia | February, 2002 | V-2 | Human serum | DQ487424 |
| FSB309 | Bolivia | March, 2002 | V-2 | Human serum | DQ487423 |
| FSB311 | Bolivia | March, 2002 | V-2 | Human serum | DQ487422 |
| FSB319 | Bolivia | April, 2002 | V-2 | Human serum | DQ487421 |
| FSB323 | Bolivia | April, 2002 | V-2 | Human serum | DQ487420 |
| FSC497 | Cuzco, Peru | March, 2003 | V-2 | Human serum | DQ487419 |
| FSC498 | Cuzco, Peru | March, 2003 | V-2 | Human serum | DQ487418 |
| Guyane | French Guiana | 1996 | p-?, V-1 | DQ487385 | |
| IQD2668 | Loreto, Peru | May, 2002 | C6/36-1 | Human serum | DQ487429 |
| IQD4881 | Loreto, Peru | February, 2003 | C6/36-1 | Human serum | DQ487428 |
| IQD5316 | Loreto, Peru | March, 2003 | C6/36-1 | Human serum | DQ487427 |
| IQD5364 | Loreto, Peru | February, 2003 | V-2 | Human serum | DQ487426 |
| IQT 2849 | Loreto, Peru | February, 1996 | C6/36-2, V-1 | Human | DQ487403 |
| IQT 4235 (CH) | Loreto, Peru | August, 1997 | C6/36-2, V-1 | Human | DQ487410 |
| IQU 2939 | Loreto, Peru | 2000 | C6/36-1, V-1 | Human | DQ487415 |
| IQU 2950 | Loreto, Peru | June, 2000 | C6/36-1, V-1 | Human | DQ487394 |
| IQU 3056 | Loreto, Peru | June, 2000 | V-1, BHK-1 | Human | DQ487402 |
| IQU 3132 | Loreto, Peru | 2000 | C6/36-1, V-1 | Human | DQ487416 |
| MFI0231 | Iquitos, Peru | September, 2002 | C6/36-1 | Human serum | DQ487430 |
| Obs 2209 | Tumbes, Peru | March, 1995 | V-1, BHK-1 | Human | DQ487399 |
| Obs 2248 | Huanuco, Peru | May, 1995 | C6/36-2, BHK-1 | Human serum | DQ487398 |
| Obs 2251 | Huanuco, Peru | May, 1995 | V-1, BHK-1 | Human | DQ487396 |
| Obs 2340 | Ayacucho, Peru | June, 1995 | SM-1, V-1 | Human | DQ487406 |
| Obs 6161 | Ucayali, Peru | January, 1998 | C6/36-2, V-1, BHK-1 | Human | DQ487393 |
| Obs 6443 | Ucayali, Peru | February, 1998 | C6/36-1, V-1, BHK-1 | Human | DQ487400 |
| Obs 6515 | Cuzco, Peru | 1998 | C6/36-1, V-2, BHK-1 | Human | DQ487404 |
| Obt2191 | Loreto, Peru | April, 2002 | V-2 | Human serum | DQ487431 |
| Ohio (#96-104) | Loreto, Peru | 1995 | p-?, V-1 | Human | DQ487405 |
| TRVL 4675 | Mayaro County, Trinidad | August, 1954 | SM-13, V-1 | Human serum | DQ487369 |
| TRVL 15537 | Rio Grande Forest, Trinidad | March, 1957 | SM-5, V-1, BHK-1 | Mansonia venezuelensis | DQ487384 |
| Uruma | Uruma, Bolivia | March, 1955 | P-? | Human | DQ487395 |
| Una viruses | |||||
| 788382 | Trinidad | 1978 | P?, SM3, BHK-1 | Psorophora spp. | DQ487417 |
| BeAr 13136 | Para, Brazil | September, 1959 | SM-6, BHK-1 | Psorophora ferrox | DQ487373 |
| BeAr 379631 | Goias, Brazil | 1980 | P-?, V-1 | Psorophora ferox | DQ487412 |
| BeAr 416216 | Roraima, Brazil | 1983 | SM-1, V-1 | Aedes serratus | DQ487411 |
| CoAn 20-26-70 | Colombia | 1972 | SM-9, BHK-1 | Dasyprocta fuliginosa | DQ487370 |
| BT 1495-3 | Bocas del Toro, Panama | 1960–1961 | P-?, SM-8, BHK-1 | Mosquitoes | DQ487376 |
| CbaAn 979 | Cordoba, Argentina | January, 1964 | SM-9, BHK-1 | Horse | DQ487374 |
| CoAr 2518 | Valle, Colombia | April, 1964 | SM-3, BHK-1 | Psorophora ferrox | DQ487377 |
| MAC 150 | Miranda, Venezuela | October, 1997 | V-1 | Hamster | DQ487375 |
| PE 10800 | Loreto, Peru | November, 1996 | V-3, BHK-1 | Psorophora ferrox | DQ487371 |
| ZPC 195 | Rio Claro, Venezuela | August, 1998 | V-1, BHK-1 | Hamster | DQ487372 |
Polymerase chain reaction amplification and sequencing primers used for MAY and/or UNA viruses
| Name | Sequence | MAY or UNA specific |
|---|---|---|
| PCR primers | ||
| 9368(+) | ACCAGTGGTGCAACCATAAACC | UNA and MAY |
| 9397(+) | GCARWGCRCATGGMTGGCC | UNA and MAY |
| 10344(−) | TCGTGTTTRCACACGTCAGC | UNA and MAY |
| 10475(+) | CACGTTCCATACACGCAGACTCC | UNA |
| 10051(+) | GGAGCATAYTGCTTCTGCGACAC | UNA |
| 9400(+) | GGCAATGCGCACGGATGGC | UNA |
| 10247A | TACCCCNTTYATGTGGGG | UNA and MAY |
| 10247B | CCCCACATRAANGGGTA | UNA and MAY |
| T25C | CTTTTTTTTTTTTTTTTTTTTTTTTT | UNA and MAY |
| T215V | VTTTTTTTTTTTTTTTTTTTTTTTTT | UNA and MAY |
| Sequencing primers | ||
| 9368(+) | ACCAGTGGTGCAACCATAAACC | UNA and MAY |
| 9397(+) | GCARWGCRCATGGMTGGCC | UNA and MAY |
| 9597(−) | CCGATAGTAACAGGGACAAC | MAY |
| 10344(−) | TCGTGTTTRCACACGTCAGC | UNA and MAY |
| 10475(+) | CACGTTCCATACACGCAGACTCC | UNA |
| 9899(+) | CAAATGCAGGTGGTGGAGAC | UNA |
| 10051(+) | GGAGCATAYTGCTTCTGCGACAC | UNA |
| 10379(+) | CTGGTAGGTTTGGAGACATTC | UNA |
| 10734(+) | GTGCACTGTATCTACATGCAC | MAY |
| 10130(+) | CCAWCRCTYAACCTGGAG | MAY |
| 10576(+) | GTTAGGGCCATGAAYTGTGCGG | UNA |
| 10576(−) | CCGCACARTTCATGGCCCTAAC | UNA |
| 11006(+) | GGGTTCARCGACTGGCAGG | UNA |
| 9400(+) | GGCAATGCGCACGGATGGC | UNA |
| 11006(−) | CCTGCCAGTCGYTGAACCC | UNA |
| 10247A | TACCCCNTTYATGTGGGG | UNA and MAY |
| 10247B | CCCCACATRAANGGGTA | UNA and MAY |
Results of hemagglutination inhibition antibody tests showing the relationships between selected UNAV isolates
| Antigens* (4 units) | |||||
|---|---|---|---|---|---|
| UNAV antisera | Be Ar 13136 | Cba An 979 | PE 10800 | Co Ar 2380 | ZPC 195 |
| * Bold indicates homologous titers. | |||||
| Be Ar 13136 | 2,560 | 1,280 | 2,560 | 2,560 | 2,560 |
| Cba An 979 | 2,560 | 2,560 | 1,280 | 2,560 | 1,280 |
| PE 10800 | 320 | 640 | 1,280 | 1,280 | 1,280 |
| Co Ar 2380 | 320 | 640 | 1,280 | 1,280 | 1,280 |
| ZPC 195 | 320 | 640 | 640 | 640 | 1,280 |
Results of complement fixation titers comparing selected UNAV strains
| Antigens* | |||||
|---|---|---|---|---|---|
| UNAV antisera | Be Ar 13136 | Cba An 979 | PE 10800 | Co Ar 2380 | ZPC 195 |
| * Bold indicates homologous titers. | |||||
| Be Ar 13136 | 1,024 | 512 | 512 | 512 | 512 |
| Cba An 979 | 512 | 1,024 | 512 | 256 | 512 |
| PE 10800 | 64 | 32 | 128 | 128 | 64 |
| Co Ar 2380 | 128 | 32 | 128 | 128 | 64 |
| ZPC 195 | 128 | 128 | 128 | 256 | 128 |
Distribution of MAYV and UNAV strains. Symbols indicate regions where isolates of each virus have been obtained.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Distribution of MAYV and UNAV strains. Symbols indicate regions where isolates of each virus have been obtained.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Distribution of MAYV and UNAV strains. Symbols indicate regions where isolates of each virus have been obtained.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
MAYV genome organization and amplicon region.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
MAYV genome organization and amplicon region.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
MAYV genome organization and amplicon region.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Phylogram of genetic relationships among the MAVY and UNAV strains sequenced in this study. Numbers are bootstrap support values for the specific clades.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Phylogram of genetic relationships among the MAVY and UNAV strains sequenced in this study. Numbers are bootstrap support values for the specific clades.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Phylogram of genetic relationships among the MAVY and UNAV strains sequenced in this study. Numbers are bootstrap support values for the specific clades.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.461
Address correspondence to Ann M. Powers, Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases, Fort Collins, CO 80522. E-mail: APowers@cdc.gov
Authors’ addresses: Ann M. Powers, Aaron C. Brault, and Tiffany Meakins, Centers for Disease Control and Prevention, Division of Vector-Borne Infectious Diseases, Fort Collins, CO 80522. Patricia Aguilar, Laura J. Chandler, Amelia Travassos Da Rosa, Scott C. Weaver, and Robert B. Tesh, Center for Tropical Diseases, Department of Pathology, and Department of Microbiology and Immunology, University of Texas Medical Branch, Galveston, TX 77555. Douglas Watts, Kevin Russell, and James Olson, US Naval Medical Research Center Detachment, Lima, Peru. Pedro Vasconcelos, Department of Arbovirology and Hemorrhagic Fevers, Instituto Evandro Chagas, Belem, Para, Brazil.
Acknowledgments: The authors thank the Centers for Disease Control and Prevention Arbovirus Reference Collection, the UTMB World Reference Center for Emerging Viruses and Arboviruses, and Dr. Tad Kochel of the U.S. Naval Medical Research Center Detachment, Lima, Peru for providing the viruses used in this study.
Financial support: A.M.P. was supported in part by NIH Grant AI-07536. A.C.B. and P.A. were supported by the James W. McLaughlin Fellowship Fund and NIH Grant AI-107526. This research was supported in part by Grant AI049725 from the NSF/NIH program on the ecology of infectious disease, NIH Contract N01-AI30027, and CNPq grant process 302770/2002-0. This work was also supported by funded work unit No. 847705 82000 25GB B0016.
Disclaimer: The views expressed in this article are those of the author and do not necessarily reflect the official policy or position of the Department of the Navy, Department of Defense, nor the U.S. Government. No official support or endorsement by the Centers for Disease Control and Prevention, Department of Health and Human Services is intended, nor should be inferred.
Human use statement: Some of the Mayaro isolates were obtained under the study protocol which was approved by the Naval Medical Research Center Institutional Review Board (Protocol # NMRCD.2000.0006) in compliance with all applicable Federal regulations governing the protection of human subjects.
REFERENCES
- 1↑
Weaver SC, Frey TK, Huang HV, Kinney RM, Rice CM, Roehrig JT, Shope RE, Strauss EG, 2005. Togaviridae. Fauquet CM, Mayo MA, Maniloff J, Desselberger U, Ball LA, eds. Virus Taxonomy: Eighth Report of the International Committee on Taxonomy of Viruses. Amsterdam: Elsevier Academic Press, 999–1008.
- 2↑
Scherer WF, Weaver SC, Taylor CA, Cupp EW, Dickerman RW, Rubino HH, 1987. Vector competence of Culex (Melanoconion) taeniopus for allopatric and epizootic Venezuelan equine encephalomyelitis viruses. Am J Trop Med Hyg 36 :194–197.
- 3↑
Scott TW, Hildreth SW, Beaty BJ, 1984. The distribution and development of eastern equine encephalitis virus in its enzootic mosquito vector, Culiseta melanura. Am J Trop Med Hyg 33 :300–310.
- 4
Weaver SC, Powers AM, Brault AC, Barrett AD, 1999. Molecular epidemiological studies of veterinary arboviral encephalitides. Vet J 157 :123–138.
- 5↑
Brault AC, Powers AM, Chavez SLV, Lopez RN, Cachon MF, Gutierrez LFL, Kang W, Tesh RB, Shope RE, Weaver SC, 1999. Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America. Am J Trop Med Hyg 61 :579–586.
- 6↑
Anderson CR, Downs WG, Wattley GH, Ahin NW, Reese AA, 1957. Mayaro virus: a new human disease agent. II. Isolation from blood of patients in Trinidad, B.W.I. Am J Trop Med Hyg 6 :1012–1016.
- 7↑
LeDuc JW, Pinheiro FP, Travassos da Rosa AP, 1981. An outbreak of Mayaro virus disease in Belterra, Brazil. II. Epidemiology. Am J Trop Med Hyg 30 :682–688.
- 8↑
Pinheiro FP, Freitas RB, Travassos da Rosa JF, Gabbay YB, Mello WA, LeDuc JW, 1981. An outbreak of Mayaro virus disease in Belterra, Brazil. I. Clinical and virological findings. Am J Trop Med Hyg 30 :674–681.
- 9↑
Tesh RB, Watts DM, Russell KL, Damodaran C, Calampa C, Cabezas C, Ramirez G, Vasquez B, Hayes CG, Rossi CA, Powers AM, Hice CL, Chandler LJ, Cropp BC, Karabatsos N, Roehrig JT, Gubler DJ, 1999. Mayaro virus disease: An emerging mosquito-borne zoonosis in tropical South America. Clin Infect Dis 28 :67–73.
- 10
Causey OR, Maroja OM, 1957. Mayaro virus: A new human disease agent. III. Investigation of an epidemic of acute febrile illness on the river Guama in Para, Brazil, and isolation of Mayaro virus as causative agent. Am J Trop Med Hyg 6 :1017–1023.
- 11↑
Schaeffer M, Gajdusek DC, Lema AB, Eichenwald H, 1959. Epidemic jungle fevers among Okinawan colonists in the Bolivian rain forest. I. Epidemiology. Am J Trop Med Hyg 8 :372–396.
- 12↑
Hoch AL, Peterson NE, LeDuc JW, Pinheiro FP, 1981. An outbreak of Mayaro virus disease in Belterra, Brazil. III. Entomological and ecological studies. Am J Trop Med Hyg 30 :689–698.
- 13↑
Aitken TH, Downs WG, Anderson CR, Spence L, Casals J, 1960. Mayaro virus isolated from a Trinidadian mosquito, Mansonia venezuelensis. Science 131 :986.
- 14↑
Smith GC, Francy DB, 1991. Laboratory studies of a Brazilian strain of Aedes albopictus as a potential vector of Mayaro and Oropouche viruses. J Am Mosq Control Assoc 7 :89–93.
- 15↑
Calisher CH, Gutierrez E, Maness KS, Lord RD, 1974. Isolation of Mayaro virus from a migrating bird captured in Louisiana in 1967. Bull Pan Am Health Organ 8 :243–248.
- 16↑
de Thoisy B, Gardon J, Salas RA, Morvan J, Kazanji M, 2003. Mayaro virus in wild mammals, French Guiana. Emerg Infect Dis 9 :1326–1329.
- 17
Price JL, 1978. Serological evidence of infection of Tacaribe virus and arboviruses in Trinidadian bats. Am J Trop Med Hyg 27 :162–167.
- 18
Seymour C, Peralta PH, Montgomery GG, 1983. Serologic evidence of natural togavirus infections in Panamanian sloths and other vertebrates. Am J Trop Med Hyg 32 :854–861.
- 19↑
Talarmin A, Chandler LJ, Kazanji M, de Thoisy B, Debon P, Lelarge J, Labeau B, Bourreau E, Vie JC, Shope RE, Sarthou JL, 1998. Mayaro virus fever in French Guiana: isolation, identification, and seroprevalence. Am J Trop Med Hyg 59 :452–456.
- 20↑
Verlinde JD, 1968. Susceptibility of cynomolgus monkeys to experimental infection with arboviruses of group A (Mayaro and Mucambo), group C (Oriboca and Restan) and an unidentified arbovirus (Kwatta) originating from Surinam. Trop Geogr Med 20 :385–390.
- 21↑
Downs WG, Anderson CR, 1958. Distribution of immunity to Mayaro virus infection in the West Indies. West Indian Med J 7 :190–195.
- 22↑
Causey OR, Casals J, Shope RE, Udomsakdi S, 1963. Aura and Una, two new group A arthropod-borne viruses. Am J Trop Med Hyg 12 :777–781.
- 23
Haas RA, Arron-Leeuwin AE, 1975. Arboviruses isolated from mosquitos and man in Surinam. Trop Geogr Med 27 :409–412.
- 24↑
Walder R, Suarez OM, Calisher CH, 1984. Arbovirus studies in southwestern Venezuela during 1973–1981. II. Isolations and further studies of Venezuelan and eastern equine encephalitis, Una, Itaqui, and Moju viruses. Am J Trop Med Hyg 33 :483–491.
- 25↑
Diaz LA, Spinsanti LI, Almiron WR, Contigiani MS, 2003. UNA virus: First report of human infection in Argentina. Rev Inst Med Trop Sao Paulo 45 :109–110.
- 26
Monath TP, Sabattini MS, Pauli R, Daffner JF, Mitchell CJ, Bowen GS, Cropp CB, 1985. Arbovirus investigations in Argentina, 1977–1980. IV. Serologic surveys and sentinel equine program. Am J Trop Med Hyg 34 :966–975.
- 27
Sabattini MS, Shope RE, Vanella JM, 1965. Serological survey for arboviruses in Cordoba Province, Argentina. Am J Trop Med Hyg 14 :1073–1078.
- 28↑
Sabattini MS, Aviles G, Monath TP, 1998. Historical, epidemioligical and ecological aspects of arboviruses in Argentina: Togaviridae, Alphavirus. Travassos da Rosa APA, Vasconcelos PFC, Travassos da Rosa JFS, eds. An Overview of Arbovirology in Brazil and Neighbouring Countries. Belem: Instituto Evandro Chagas, 135–153.
- 29↑
Buckley SM, Clarke DH, 1970. Differentiation of group A arboviruses chikungunya, mayaro, and semliki forest by the fluorescent antibody technique. Exp Biol Med 135 :533–539.
- 30
Calisher CH, el-Kafrawi AO, Al-Deen Mahmud MI, Travassos da Rosa AP, Bartz CR, Brummer-Korvenkontio M, Haksohusodo S, Suharyono W, 1986. Complex-specific immunoglobulin M antibody patterns in humans infected with alphaviruses. J Clin Microbiol 23 :155–159.
- 31
Casals J, Whitman L, 1957. Mayaro virus: a new human disease agent. I. Relationship to other arbor viruses. Am J Trop Med Hyg 6 :1004–1011.
- 32
Figueiredo LT, Nogueira RM, Cavalcanti SM, Schatzmayr H, da Rosa AT, 1989. Study of two different enzyme immunoassays for the detection of Mayaro virus antibodies. Mem Inst Oswaldo Cruz 84 :303–307.
- 33↑
Porterfield JS, 1961. Cross-neutralization studies with group A arthropod-borne viruses. Bull World Health Organ 24 :735.
- 34↑
Chanas AC, Johnson BK, Simpson DI, 1976. Antigenic relationships of alphaviruses by a simple micro-culture cross-neutralization method. J Gen Virol 32 :295–300.
- 35↑
Pinheiro FP, Dias LB, 1967. Virus Mayaro e Una: estudo de variantes produzindo grandes e pequenas placas. Lent H, ed. Atas Simposio Biota Amazonica. Rio de Janeiro: Conselho Nacional de Pesquisas, 211.
- 36↑
Powers AM, Brault AC, Shirako Y, Strauss EG, Kang W, Strauss JH, Weaver SC, 2001. Evolutionary relationships and systematics of the alphaviruses. J Virol 75 :10118–10131.
- 37
Powers AM, Brault AC, Tesh RB, Weaver SC, 2000. Re-emergence of chikungunya and o’nyong-nyong viruses: Evidence for distinct geographical lineages and distant evolutionary relationships. J Gen Virol 81 :471–479.
- 38
Powers AM, Oberste MS, Brault AC, Rico-Hesse R, Schmura SM, Smith JF, Kang W, Sweeney W, Weaver SC, 1997. Repeated emergence of epidemic/epizootic Venezuelan equine encephalitis from a single genotype of enzootic subtype ID virus. J Virol 71 :6697–6705.
- 39
Wills MR, Sil BK, Cao JX, Yu YX, Barrett AD, 1992. Antigenic characterization of the live attenuated Japanese encephalitis vaccine virus SA14-14-2: A comparison with isolates of the virus covering a wide geographic area. Vaccine 10 :861–872.
- 40↑
Bryant J, Wang H, Cabezas C, Ramirez G, Watts D, Russell K, Barrett A, 2003. Enzootic transmission of yellow fever virus in Peru. Emerg Infect Dis 9 :926–933.
- 41
Mutebi JP, Wang H, Li L, Bryant JE, Barrett AD, 2001. Phylogenetic and evolutionary relationships among yellow fever virus isolates in Africa. J Virol 75 :6999–7008.
- 42↑
Vasconcelos PF, Bryant JE, da Rosa TP, Tesh RB, Rodrigues SG, Barrett AD, 2004. Genetic divergence and dispersal of yellow fever virus, Brazil. Emerg Infect Dis 10 :1578–1584.
- 43↑
Cilnis M, Kang W, Weaver SC, 1996. Genetic conservation of Highlands J viruses. Virology 218 :343–351.
- 44↑
Killington RA, Stokes A, Hierholzer JC, 1996. Virus purification. Mahy BWJ, Kangro HO, eds. Virology Methods Manual. San Diego, CA: Academic Press, 71–89.
- 45↑
Powers AM, Brault AC, Kinney RM, Weaver SC, 2000. The use of chimeric Venezuelan equine encephalitis viruses as an approach for the molecular identification of natural virulence determinants. J Virol 74 :4258–4263.
- 46↑
Devereux J, Haeberli P, Smithies O, 1984. A comprehensive set of sequence analysis programs for the VAX. Nucleic Acids Res 12 :387–395.
- 47↑
Swofford DL, 1998. PAUP*. Phylogenetic Analysis Using Parsimony (*and Other Methods). Version 4. Sunderland, MA: Sinauer Associates.
- 48↑
Felsenstein J, 1985. Confidence limits on phylogenies: An approach using the bootstrap. Evol Int J Org Evol 39 :783–791.
- 49↑
Beaty BJ, Calisher CH, Shope RE, 1989. Arboviruses. Schmidt NJ, Emmons RW, eds. Diagnostic Procedures for viral, Rickettsial and Chlamydial Infections. Sixth Edition. Washington, DC: American Public Health Association, 797–855.
- 50↑
Schmidt JR, Gajdusek DC, Schaffer M, Gorrie RH, 1959. Epidemic jungle fever among Okinawan colonists in the Bolivian rain forest. II. Isolation and characterization of Uruma virus, a newly recognized human pathogen. Am J Trop Med Hyg 8 :479–487.
- 51↑
Calisher CH, Karabatsos N, 1988. Arbovirus serogroups: Definition and geographic distribution. Monath TP, ed. The Arboviruses: Epidemiology and Ecology, Vol. I. Boca Raton, FL: CRC Press, 19–57.
- 52↑
Pinheiro FP, LeDuc JW, 1988. Mayaro virus disease. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Boca Raton, FL: CRC Press, 137–150.
- 53↑
Morris CD, 1988. Eastern equine encephalomyelitis. Monath TP, ed. The Arboviruses: Epidemiology and Ecology, Vol. III. Boca Raton, FL: CRC Press, 1–36.
- 54↑
Scott TW, Weaver SC, 1989. Eastern equine encephalomyelitis virus: Epidemiology and evolution of mosquito transmission. Adv Virus Res 37 :277–328.
- 55↑
Brault AC, Powers AM, Chavez CL, Lopez RN, Cachon MF, Gutierrez LF, Kang W, Tesh RB, Shope RE, Weaver SC, 1999. Genetic and antigenic diversity among eastern equine encephalitis viruses from North, Central, and South America. Am J Trop Med Hyg 61 :579–586.
- 56
Weaver SC, Bellew LA, Hagenbaugh A, Mallampalli V, Holland JJ, Scott TW, 1994. Evolution of alphaviruses in the eastern equine encephalomyelitis complex. J Virol 68 :158–169.
- 57↑
Weaver SC, Scott TW, Lorenz LH, 1991. Detection of eastern equine encephalomyelitis virus deposition in Culiseta melanura following ingestion of radiolabeled virus in blood meals. Am J Trop Med Hyg 44 :250–259.
- 58↑
Chandler LJ, Parsons R, Randle Y, 2001. Multiple genotypes of St. Louis encephalitis virus (Flaviviridae: Flavivirus) circulate in Harris County, Texas. Am J Trop Med Hyg 64 :12–19.
- 59↑
Anderson JF, Vossbrinck CR, Andreadis TG, Iton A, Beckwith WH 3rd, Mayo DR, 2001. A phylogenetic approach to following West Nile virus in Connecticut. Proc Natl Acad Sci USA 98 :12885–12889.
- 60↑
de Thoisy B, Vogel I, Reynes JM, Pouliquen JF, Carme B, Kazanji M, Vie JC, 2001. Health evaluation of translocated free-ranging primates in French Guiana. Am J Primatol 54 :1–16.
- 61↑
Theiler M, Downs WG, 1973. The Arthropod-borne Viruses of Vertebrates. New Haven. CT: Yale University Press.