• View in gallery

    Map of India showing the location of collection sites [district (state)] for An. culicifacies s.l.

  • View in gallery

    Sequence alignment of mitochondrial COII gene among the five sibling species of the An. culicifacies complex using CLUSTAL X. - indicates similarity to the first sequence (in this figure of species B).

  • View in gallery

    AD-PCR assay for the differentiation of species A and D of the An. culicifacies complex. Lanes 1 and 2: species A; lanes 3–6: species D; lane 7: 100-bp ladder (Promega).

  • View in gallery

    Multiplex BCE-PCR assay to differentiate species B, C, and E of the An. culicifacies complex. Lane 1: 100-bp ladder (Promega); lanes 2 and 3: species B; lanes 4–7: species C; lanes 8–10: species E.

  • 1

    Harrison BA, 1980. The Myzomyia series of Anopheles (Cellia) in Thailand, with emphasis on intra-specific variations (Diptera: Culicidae). Contr Am Entomol Inst (Ann Arbor) 17 :1–195.

    • Search Google Scholar
    • Export Citation
  • 2

    Van Bortel W, Sochanta T, Harbach RE, Socheat D, Roelants P, Backeljau T, Coosemans M, 2002. Presence of Anopheles culicifacies B in Cambodia established by the PCR-RFLP assay developed for the identification of Anopheles minimus species A and C and four related species. Med Vet Entomol 16 :329–334.

    • Search Google Scholar
    • Export Citation
  • 3

    Rao TR, 1984. The Anophelines of India. Delhi, India: Malaria Research Centre.

  • 4

    Green CA, Miles SJ, 1980. Chromosomal evidence for sibling species of the malaria vector Anopheles (Cellia) culicifacies Giles. J Trop Med Hyg 83 :75–78.

    • Search Google Scholar
    • Export Citation
  • 5

    Subbarao SK, Vasantha K, Adak T, Sharma VP, 1983. Anopheles culicifacies complex: evidence for a new sibling species, species C. Ann Entomol Soc Am 76 :985–986.

    • Search Google Scholar
    • Export Citation
  • 6

    Suguna SG, Tewari SC, Mani TR, Hiryan J, Reuben R, 1989. A cytogenetic description of a new species of the Anopheles cu-licifacies species complex. Genetica 78 :225–230.

    • Search Google Scholar
    • Export Citation
  • 7

    Vasantha K, Subbarao SK, Sharma VP, 1991. Anopheles culicifacies complex: Population cytogenetic evidence for species D (Diptera: Culicidae). Ann Entomol Soc Am 84 :531–536.

    • Search Google Scholar
    • Export Citation
  • 8

    Kar I, Subbarao SK, Eapen A, Ravindran J, Satyanarayana TS, Raghavendra K, Nanda N, Sharma VP, 1999. Evidence for a new malaria vector species, species E, within the Anopheles culicifacies complex (Diptera: Culicidae). J Med Entomol 36 :595–600.

    • Search Google Scholar
    • Export Citation
  • 9

    Subbarao SK, 1998. Anopheline Species Complexes in South-East Asia. New Delhi, India: World Health Organization Regional Office for South-East Asia.

  • 10

    Subbarao SK, Adak T, Sharma VP, 1980. Anopheles culicifacies: sibling species distribution and vector incrimination studies. J Commun Dis 12 :102–104.

    • Search Google Scholar
    • Export Citation
  • 11

    Subbarao SK, Adak T, Vasantha K, Joshi H, Raghavendra K, Cochrane AH, Nussenzweig RS, Sharma VP, 1988. Suceptibility of Anopheles culicifacies species A and B to Plasmodium vivax and P falciparum as determined by immunoradiometric assay. Trans Roy Soc Trop Med Hyg 82 :394–397.

    • Search Google Scholar
    • Export Citation
  • 12

    Subbarao SK, Vasantha K, Joshi H, Raghavendra K, Usha Devi C, Satyanarayana TS, Cochrane AH, Nussenzweig RS, Sharma VP, 1992. Role of Anophelese culicifacies sibling species in malaria transmission in Madhya Pradesh, India. Trans Roy Soc Trop Med Hyg 86 :613–614.

    • Search Google Scholar
    • Export Citation
  • 13

    Subbarao SK, Vasantha K, Raghavendra K, Sharma VP, Sharma GK, 1988. Anopheles culicifacies: sibling species composition and its relationship to malaria incidence. J Am Mosq Contr Assoc 4 :29–33.

    • Search Google Scholar
    • Export Citation
  • 14

    Joshi H, Vasantha K, Subbarao SK, Sharma VP, 1988. Host feeding patterns of Anophelese culicifacies species A and B. J Am Mosq Contr Assoc 4 :248–251.

    • Search Google Scholar
    • Export Citation
  • 15

    Subbarao SK, Vasantha K, Sharma VP, 1988a. Response of Anopheles culicifacies species A and B to DDT and HCH in India: implications in malaria control. Med Vet Entomol 2 :219–223.

    • Search Google Scholar
    • Export Citation
  • 16

    Raghavendra K, Vasantha K, Subbarao SK, Pillai MKK, Sharma VP, 1991. Resistance in Anopheles culicifacies sibling species B and C to malathion in Andhra Pradesh and Gujarat states in India. J Am Mosq Contr Assoc 7 :255–259.

    • Search Google Scholar
    • Export Citation
  • 17

    Subbarao SK, Sharma VP, 1997. Anopheline species complexes and malaria control. Indian J Med Res 106 :164–173.

  • 18

    Subbarao SK, Nanda N, Raghavendra K, 1999. Malariogenic stratification of India using Anopheles culicifacies sibling species prevalence. ICMR Bull 29 :75–80.

    • Search Google Scholar
    • Export Citation
  • 19

    Milligan PJM, Phillips A, Molyneux DH, Subbarao SK, White GB, 1986. Differentiation of Anopheles culicifacies Giles (Diptera: Culicidae) sibling species by analysis of cuticular components. Bull Entomol Res 76 :529–537.

    • Search Google Scholar
    • Export Citation
  • 20

    Adak T, Subbarao SK, Sharma VP, Rao SRV, 1994. Lactate dehydrogenase allozyme differentiation of species in the Anopheles culicifacies complex. Med Vet Entomol 8 :137–140.

    • Search Google Scholar
    • Export Citation
  • 21

    Gunasekera MB, de Silva BGDNK, Abeyewickreme W, Subbarao SK, Nandadasa HG, Karunayayake EH, 1995. Development of DNA probes for the identification of sibling species A of the Anopheles culicifacies (Diptera: Culicidae) complex. Bull Entomol Res 85 :345–353.

    • Search Google Scholar
    • Export Citation
  • 22

    Krzywinski J, Besansky NJ, 2003. Molecular systematics of Anopheles: from subgenera to subpopulations. Annu Rev Entomol 48 :111–139.

  • 23

    Curtis CF, Townson H, 1998. Existing methods of vector control and molecular entomology. British Med Bull 54 :311–325.

  • 24

    Singh OP, Goswami G, Nanda N, Raghavendra K, Chandra D, Subbarao SK, 2004. An allele specific polymerase chain reaction assay for the identification of members of Anopheles culicifacies complex. J Biosciences 29 :275–278.

    • Search Google Scholar
    • Export Citation
  • 25

    Goswami G, Nanda N, Raghavendra K, Gakhar SK, Subbarao SK, 2005. PCR-RFLP of mitochondrial cytochrome oxidase subunit II and ITS2 of ribosomal DNA: markers for the identification of members of Anopheles culicifacies complex (Diptera: Culicidae). Acta Trop 95 :92–99.

    • Search Google Scholar
    • Export Citation
  • 26

    Salazar M, Theoduloz C, Vega A, Poblete F, Gonzalez E, Badilla R, Meraa-Basso L, 2002. PCR-RFLP identification of endemic Chilean species of Rhagoletis (Diptera:Tephritidae) attacking solanaceae. Bull Entomol Res 92 :337–341.

    • Search Google Scholar
    • Export Citation
  • 27

    Hazel CL, Garcia-Maruniak A, Maruniak JE, 2002. Strain identification of Spodoptera frugiperda (Lepidoptera:Noctuidae) Insects and cell line: PCR-RFLP of cytochrome oxidase c subunit I gene. Fla Entomol 85 :186–190.

    • Search Google Scholar
    • Export Citation
  • 28

    Carew ME, Pettigrove V, Hoffmann AA, 2003. Identifying chironomids (Diptera: Chironomidae) for biological monitoring with PCR-RFLP. Bull Entomol Res 93 :483–490.

    • Search Google Scholar
    • Export Citation
  • 29

    Mitchell SE, Narang SK, Cockburn AK, Seawright JA, Godenthal M, 1992. Mitochondrial and ribosomal DNA variation among members of the Anopheles quadrimaculatus (Diptera: Culicidae) species complex. Genome 35 :939–950.

    • Search Google Scholar
    • Export Citation
  • 30

    Narang SK, Seawright JA, Mitchell SE, Kaiser PE, Calrson DA, 1993. Multiple-technique identification of sibling species of the Anopheles quadrimaculatus complex. J Am Mosq Cont Assoc 9 :463–464.

    • Search Google Scholar
    • Export Citation
  • 31

    Green CA, Hunt RH, 1980. Interpretation of variation in ovarian polytenene chromosomes of Anopheles funestus Giles, A Parensis gillies and A Aruni? Genetica 51 :187–195.

    • Search Google Scholar
    • Export Citation
  • 32

    Subbarao SK, Vasantha K, Sharma VP, 1988. Cytotaxonomy of certain malaria vectors of India. Service MW, ed. Biosystematics of hematophagous insects. Oxford, UK: Clarendon Press, 25–37.

  • 33

    Subbarao SK, Nanda N, Chandrahas RK, Sharma VP, 1993. Anopheles culicifacies complex: Cytogenetic characterization of Rameshwaram island populations. J Am Mosq Contr Assoc 9 :27–31.

    • Search Google Scholar
    • Export Citation
  • 34

    Coen ES, Thoday JM, Dover G, 1982. Rate of turnover of structural variants in the rDNA gene family of Drosophila melanogaster.Nature 295 :564–568.

    • Search Google Scholar
    • Export Citation
  • 35

    Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P, 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a complilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87 :651–701.

    • Search Google Scholar
    • Export Citation
  • 36

    Thompson JD, Gibson TJ, Plenwniak F, Jeanmougin F, Higgins DG, 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res 24 :4876–4882.

    • Search Google Scholar
    • Export Citation
  • 37

    Ugozzoli L, Wallace RB, 1991. Allele-specific polymerase chain reaction. Methods: A comparison to Methods in Enzymology 2 :42–48.

  • 38

    Huang MM, Arnheim N, Goodman MF, 1992. Extension of base mispairs by Taq DNA polymerase: implication for single nucleotide discrimination in PCR. Nucl Acids Res 20 :4567–4573.

    • Search Google Scholar
    • Export Citation
  • 39

    Paskewitz SM, Collins FH, 1990. Use of polymerase chain reaction to identify mosquito species of the Anopheles gambiae complex. Med Vet Entomol 4 :367–373.

    • Search Google Scholar
    • Export Citation
  • 40

    Nanda N, Yadav RS, Subbarao SK, Joshi H, Sharma VP, 2000. studies in Anopheles fluviatilis and Anopheles culicifacies in relation with malaria in forest and deforested reverine ecosystems in northern Orissa, India. J Am Mosq Contr Assoc 16 :199–205.

    • Search Google Scholar
    • Export Citation

 

 

 

 

IDENTIFICATION OF ALL MEMBERS OF THE ANOPHELES CULICIFACIES COMPLEX USING ALLELE-SPECIFIC POLYMERASE CHAIN REACTION ASSAYS

View More View Less
  • 1 Malaria Research Centre, Delhi, India; Maharshi Dayanand University, Rohtak, India; Indian Council of Medical Research, New Delhi, India

Anopheles culicifacies, a complex of five isomorphic sibling species, is a major vector of malaria in India and neighboring countries. The five species are provisionally designated as species A, B, C, D, and E. Polytene chromosome examination has been the only method available that differentiates four members of this complex in areas where species E is not prevalent. However, this technique requires the mosquitoes to be in the half-gravid stage and thus limits its application to only about one fourth to one third of the total adult collection and excludes immature stages completely. For species E, both polytene chromosome examination and mitotic chromosome examination of F1 males are required. A polymerase chain reaction (PCR) assay based on the D3 domain (D3-PCR) of 28S rDNA and a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay involving ITS2 of rDNA are available for the discrimination of the members of the An. culicifacies complex. However, both these can only differentiate species A and D from species B, C, and E. We report here two allele-specific PCR assays (AD-PCR and BCE-PCR) using sequence differences in the mitochondrial cytochrome oxidase II (CO II) subunit. The AD-PCR assay distinguishes species A and D, whereas the BCE-PCR assay distinguishes species B, C, and E. Thus, with a combination of two PCR assays, namely the D3-PCR/ITS2-RsaI assay, followed by either the AD-PCR or the BCE-PCR assay, it is possible to identify individual specimens of any of the species of this complex. This assay system is the first, and the best available at present to distinguish all sibling species and especially to discriminate non-vector, species B from all the vector species, A, C, D, and E, of the An. culicifacies complex. Until another DNA-based method involving fewer steps is developed, this assay system can be used in all malaria epidemiologic studies where An. culicifacies is prevalent.

INTRODUCTION

Anopheles culicifacies sensu lato has a distribution from India eastward into Nepal, Bangladesh, Thailand, Myanmar, China, Vietnam, and Cambodia, westward into Afghanistan, Pakistan, Iran, Yemen, and Ethiopia, and southward into Sri Lanka.13 It is a major vector of malaria in India accounting for ~60—70% of malaria cases in the country. It has thus far been recognized as a complex of five sibling species that are provisionally designated as species A, B, C, D, and E,48 and the distribution of these species has been mapped.9 Laboratory and malaria epidemiologic studies, correlated with cytologic identification, have incriminated species A, C, D, and E as vectors of malaria in India and have shown that species B is a very poor vector or a non-vector.1013 In addition, the sibling species exhibit distinct biologic characters, host-feeding preference, biting activity, and susceptibility to commonly used insecticides in public health programs,1417 which are relevant for the transmission of the disease and control. Based on distribution of vector and non-vector species, specific and effective control strategies can be suggested.17,18 Thus, efficient diagnostic methods for distinguishing vectors from non-vector in this complex are still needed.

Attempts to find morphologic markers for the members of this complex have not been successful thus far. Presently, identification of these members is being carried out by polytene chromosome examination. However, this technique requires the mosquitoes to be in the half-gravid stage. In anophelines, polytene chromosomes are also found in salivary glands of late third- and early fourth-instar larvae. However, in An. culicifacies, because it is not possible to obtain good quality chromosomes preparations at the larval stage, accurate identification of sibling species at the larval stage is difficult, and the use of immature stages was ruled out in our studies. There are also technical difficulties in identifying all five species by polytene chromosome examination. Species D can be differentiated from species A only at the population level in areas where the 2i1 inversion, which is diagnostic for species D, is polymorphic in species A. In these areas, a deficiency of i1 heterozygotes indicates the presence of species D, but individual specimens cannot be identified as species D.7 Furthermore, species E cannot be differentiated from species B because they have homosequential polytene chromosome arrangements. Species E requires mitotic chromosome examination of male progeny and/or vectorial potential needs to be established for distinction from species B.8 In the absence of either of these, identification of species E may not be accurate. Cuticular hydrocarbon profiles distinguished species A, B, and C with 78% accuracy.19 After screening several enzyme systems, electrophoretic variation at the Lactate dehydrogenase (Ldh) locus was found to be useful. It could group species A and D in one category and species B and C in another category.20 Species E showed the same Ldhs allele as in species B and C.8

DNA-based techniques are now available to differentiate members of the An. culicifacies complex. A DNA probe hybridization assay21 distinguishes species B from species A and also species A from species B and C when DNA from a single mosquito is diluted 200-fold. DNA probe techniques have high-throughput potential,22 but this assay is limited by the fact that it may be unreliable because of its sensitivity both to unequal amounts of target DNA loaded on a membrane and to variation in copy number across the different species, and possibly within the same species from different geographical regions. Ribosomal DNA (rDNA) has been one of the preferred candidates to develop diagnostic assays to differentiate cryptic members of many species complexes. A polymerase chain reaction (PCR) assay developed from the ITS-2 region, which differentiated species A from B, has been reported.23 The assay has not been evaluated with the other species, and even for species A and B, it has not been evaluated on field specimens. A species-specific PCR assay developed from the D3 region of the 28S rDNA cistron differentiates species A and D from species B, C, and E.24 A recently developed ITS2 PCR-RFLP assay, like the D3 assay, grouped five sibling species into two categories.25 Thus, attempts to find variation in rDNA among all the five species have not been successful thus far. Therefore, variation in the mitochondrial cytochrome oxidase subunit 2 (COII) sequences was considered. Mitochondrial DNA has been widely used in sibling species identification in various insect taxa,2628 as well as in some anophelines.29,30 Recently a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) technique, using variation in the COII region, distinguished species E from species B/C.25 Although these techniques have been helpful in identifying the members of this complex, all five members cannot be identified using any single one of the methods developed thus far. Thus, a DNA-based technique, preferably a PCR assay, to distinguish all the members is still needed for this important complex. Sequencing of the mitochondrial COII region of the sibling species and their alignment showed species-specific differences. In this paper, we report two PCR assays designed from the COII region, which, when used in association with the rDNA D3-PCR assay,24 were able to differentiate all the five members of the An. culicifacies complex.

MATERIALS AND METHODS

Insect material.

Anopheles culicifacies species A, B, and C colonized in the laboratory and species D collected from district Jabalpur, Madhya Pradesh State, and species E from Rameshwaram Island in district Ramanathapuram, Tamil Nadu State, were used for the optimization of all the PCR assays. Indoor resting An. culicifacies s.l. females were collected from various areas of India having different sympatric associations to evaluate the correlation between cytologic and PCR identifications. Collection sites represented different parts of India, namely, northern India—districts Allahabad (Uttar Pradesh State), Hardwar (Uttaranchal State), and Sonepat (Haryana State); central India—districts Jabalpur (Madhya Pradesh State) and Bastar (Chattisgarh State); southern India—districts Bijapur (Karnataka State) and Ramanathapuram (Tamil Nadu State); western India—districts Udaipur (Rajasthan State) and Kheda (Gujarat State); and eastern India—districts Hazaribagh and Ranchi (Jharkhand State) (Figure 1).

From adult female mosquitoes at the half-gravid stage (Christopher’s late stage III), ovaries were extracted and preserved in Carnoy’s fixative (1:3 glacial acetic acid: methanol). The rest of the body was preserved in isopropanol for DNA extraction. The ovaries and the rest of the body of a given mosquito were assigned identical labels. Care was taken to dissect out the abdomen in the case of blood-fed females before DNA extraction to avoid mosquito genomic contamination with vertebrate DNA from the blood.

Cytologic identification.

The ovaries of individual mosquitoes were processed for polytene chromosome examination following Green and Hunt31 and were identified using the paracentric inversions on the X-chromosome and chromosome arm 2. The diagnostic inversion genotypes for each species32 were as follows:

Species A: X +a + b; 2 + g1+ h1 (i1 inversion polymorphic in certain areas)

Species B: Xab; 2g1 + h1

Species C: Xab; 2 + g1h1

Species D: X + a + b; 2i1 + h1 (i1 inversion includes g1 inversion)

For species E identification, male F1 progeny of the females collected from Rameshwaram Island in district Ramanathapuram (Tamil Nadu State) were examined for variation in the centromeric position of the mitotic Y chromosome.33 Specimens with polytene chromosome genotype Xab; 2g1 + h1 and F1 progeny having submetacentric Y chromosome were designated as species E and those having an acrocentric Y chromosome as species B.8 In Rameshwaram Island, only species B and E are found.8 Therefore, from the same island, isofemale lines having F1 males with acrocentric Y chromosome characterized as species B were used in cytologic correlation analysis.

DNA extraction.

Genomic DNA was extracted34 from individual mosquitoes after removing the ovaries. The DNA pellet finally obtained was dissolved in 200 μL of TE (Tris-EDTA) buffer and stored at 4°C.

DNA sequencing.

The COII region of mitochondrial DNA was amplified from chromosomally identified specimens of each sibling species using primers C2-J-3138 and C2-N-3686.35 The PCR reactions were performed in a 20-μL volume using a Perkin-Elmer thermal cycler. Each tube contained 1 μL of mosquito DNA, 20 μmol/L each dNTPs, 2.5 mmol/L MgCl2, 20 mmol/L ammonium sulphate, 1× buffer, 10 pmol of primer, and 1 unit of Taq DNA polymerase. The PCR conditions used were initial denaturation at 94°C for 4 minutes followed by 40 cycles each of denaturation at 95°C for 40 seconds, annealing at 50°C for 40 seconds, and extension at 68°C for 40 seconds followed by final extension at 72°C for 10 minutes. The PCR product thus obtained was gel extracted using QIAEX II gel extraction kit (QIAGEN, Valencia, CA) directly subjected to cycle sequencing using BigDye Terminator Ready Reaction Kit from Applied Biosystems. The products were precipitated by the ethanol-sodium acetate and suspended in template suppressor reagent (TSR) and finally sequenced with DNA sequencer ABI Prism 310. Sequencing was done for three specimens of each species using both forward and reverse primers.

Sequences have been submitted to EMBL with the accession numbers AJ 519492 (species A); AJ 518810 (species B); AJ 519493 (species C); AJ 519494 (species D); and AJ 534646 (species E). Sequence alignment was done using ClustalX36 and is presented in Figure 2. Translation of the sequences with the reading frame 1 using the Expasy tool yielded protein sequences that contained no stopcodons. The primers for sibling species identifications were designed using primerselect of DNASTAR (DNASTAR, Madison, WI).

RESULTS

Primer selection.

The amplified sequences of the mitochondrial COII gene (using primers C2J3138 and C2N3686) from the five species of the An. culicifacies complex were found to be about 530 bp long. BLAST (n) analysis showed that these were partial, because the complete COII sequence is 684 bp long in anopheline taxa (with accession numbers AF448470; AAU 94284; ASU94314; ACU512747). It was evident from the alignment that to a large extent species A and D shared the one sequence and species B, C, and E shared another sequence. Species A differed from species D at position 273 T→C, 291 G→A, 445 C→A, and 510 T→G. Species C showed a single base different from species B at position 171 G→A. Species E differed from species B and C at positions 165 T→C, 186 T→C, 231 T→C, 255 T→C, 291 A→G, 334 G→A, 405 T→G, and 475 C→T. However, at these positions, species E had the same nucleotides as those of species A and D. The above nucleotide differences were targeted for designing diagnostic primers for each species.

A total of seven primer sequences were selected (Table 1). In the design of specific primers, base substitutions concentrated at the 3′-end of the primer were used, because those at the 3′-end have the maximum effect in inhibiting extension from mismatched-primer-DNA template.37 Depending on the availability of mismatch, wherever possible, the most discriminating mismatch base-pairs were used.38 Care was taken to design primers that generated amplification products of differing sizes that could be easily separated on an agarose gel and identified.

Of these seven primers, three primers (ADF, ADR, and DF) were used in the AD-PCR assay differentiating species A from D, and the other four primers (BCEF, BCR, CR, and ER) were used in the BCE-PCR assay for differentiating species B, C, and E from each other. A single cocktail using all the seven primers for differentiating all the five species was not possible because the substitutions that differentiated species E from B and C were shared by species A and D. Thus, to avoid the ER primer annealing to species A and D, two separate PCR assays were designed.

PCR optimization.

Trial PCR amplifications were performed using different primer combinations for differentiating species A from D, species B from C, species B from E, and species B, C, and E from each other. The aim was to maximize the yield of the desired products while retaining the product specificity. The PCR conditions were optimized with respect to parameters such as MgCl2 concentration, primer concentration, Taq DNA polymerase concentration, and annealing temperature. After achieving a set of reaction conditions from which products of the correct size were generated from the corresponding primer pair and DNA combinations, an effort was made to minimize the number of PCR assays needed to differentiate all five members of the complex.

Optimized conditions for AD-PCR assay.

The PCR reaction was comprised of ADF, ADR, and DF primers each at 25 pmol, 200 μmol/L of each of the dNTP, 1.5 mmol/L MgCl2, 20 mmol/L (NH4)2 SO4, 75 mmol/L Tris-HCl pH 9.0, 0.01× (wt/vol) Tween, and 0.625 unit of Taq DNA polymerase. The cycling conditions were initial denaturation at 95°C for 5 minutes followed by 35 cycles each of denaturation at 95°C for 40 seconds, annealing at 50°C for 40 seconds, and extension at 68°C for 40 seconds, followed by a final extension at 72°C for 10 minutes. All the identifications were performed in a 25-μL volume with about 50 ng of template DNA. The expected fragment sizes in AD-PCR assay are as follows: species A, 359 bp; species D, 166 + 359 bp (Figure 3).

Optimized conditions for BCE-PCR assay.

For the BE-PCR (using primers BCEF, BCR, and ER) and the BC-PCR assay (using primers BCEF, BCR, and CR), the conditions were exactly same as those of the AD-PCR assay. The BC-PCR and BE-PCR were multiplexed into one BCE-PCR in which the three species, B, C, and E, could be differentiated from each other. For the multiplex BCE-PCR assay, the primer concentrations were 25 pmol BCEF, 12 pmol BCR, 25 pmol ER, and 30 pmol CR. The other reaction and cycling conditions were the same as those for the AD-PCR assay. The expected fragment sizes in the BCE-PCR assay are as follows: species B, 248 bp; species C, 95 + 248 bp; species E, 178 + 248 bp (Figure 4).

Strategy for the identification of sibling species of the An. culicifacies complex.

An. culicifacies specimens identified morphologically were first assayed by the D3-PCR assay24 that distinguishes the five species into two categories: A/D and B/C/E. The specimens identified as belonging to the species A/D category in the D3-PCR assay were subjected to the AD-PCR assay to differentiate species A from D. The samples that were identified as belonging to the species B/C/E category were subjected to the BCE-multiplex PCR assay to differentiate species B, C, and E from each other.

Evaluation of the PCR technique developed by correlating with cytologically identified field and laboratory specimens.

Table 2 shows cytologic and AD-PCR identification of laboratory-reared and field-collected An. culicifacies specimens. PCR identification of specimens from a laboratory colony and field specimens from districts Allahabad, Gulbarga, Jabalpur, and Udaipur correlated completely with the cytologically identified individual specimens. The field specimens included allopatric species D from Allahabad and Jabalpur and sympatric species A and D from Gulbarga and Udaipur. The results did not agree fully with the specimens from Kheda and Sonepat, where the i1 inversion was polymorphic. From these areas, specimens cytologically identified as i1 homozygotes, and the heterozygotes (considered polymorphic forms of species A) were all identified as species D by the AD-PCR-assay. The i1 homozygotes could be species D or polymorphic forms of species A.

Table 3 shows the correlation between the BCE-PCR assay identifications with cytologically identified laboratory and field specimens. The BCE-PCR assay identifications correlated almost completely with the cytologic identifications. The only exception was a specimen from Hazaribagh, which was cytologically identified as species B but was identified as species C by PCR. The field specimens included allopatric species B and sympatric species B and C and B and E.

DISCUSSION

Accurate identification of anopheline mosquitoes is necessary for planning effective vector control strategies and for a better understanding of their potential role in malaria transmission. Because the PCR assays developed from the D3 and ITS2 regions of rDNA failed to identify all the members of the An. culicifacies complex, variation in the COII region of mtDNA was used in this study. The mitochondrial COII sequences showed single bp differences that have been used to differentiate all the members of the An. culicifacies complex (Figure 2). These differences were used, because a single nucleotide mismatch at the 3′-position of a primer is sufficient to form the basis of a PCR assay.39

The validity of these PCR assays was tested with specimens from a laboratory colony and An. culicifacies s.l. collected from areas widely distributed in India. In the areas selected, sibling species sympatric associations included 1) species A, B, and D; 2) species A, B, C, and D; 3) species B and C; and 4) species B and E. Cytologic identifications of species B, C, and E correlated completely with all the identifications by the BCE-PCR assay, except with one specimen (Table 3). The misidentification could be an accidental error while processing, which involved several steps. Thus, it is concluded that the BCE-PCR assay is the first one that correctly distinguished species B, C, and E from each other. Species B is a non-vector in this complex. Species B is found either alone as in northeastern parts of India or in sympatric association with one or more of the other species.9,18 The PCR-RFLP assay25 reported earlier is useful only in areas where species B and E are sympatric such as in Rameshwaram island, whereas the BCE-PCR assay reported here will work in sympatric association with species C as well.

Species A and D identifications by the AD-PCR assay, however, were not well correlated with the cytologic identifications. This is because the cytologic identification of species D was based on the finding that the i1 inversion is fixed in species D and also diagnostic for species D, and this inversion is polymorphic in species A in a few areas.7 With reference to species A and D and the i1 inversion, one therefore encounters any of the following situations in a population.

  1. +i1 and i1 homozygotes without any heterozygotes, suggesting that species A and D are present.
  2. +i1, i1, and +i1/i1 (heterozygotes) in expected proportions, suggesting that only species A is present and i1 is polymorphic.
  3. Similar to 2) but with a significant deficiency of heterozygotes, suggesting that species A and D are present, and in species A i1 is polymorphic.

In a situation such as 3), a population genetic analysis will indicate the presence of species D, but individual specimens cannot be identified as species D.7 Situations 1) and 3) have been encountered in this study (Table 2).

In all specimens from districts Allahabad and Jabalpur, where only i1 homozygotes, and in Gulbarga, where +i1 and i1 homozygotes (representing species A and D respectively) were present, cytologic assignments to the individual specimens correlated with the PCR identifications. Specimens from a species A laboratory colony, which was the source DNA for species A primers, were correctly identified by the AD-PCR assay. For species D, cytologically identified field specimens from Jabalpur were the source DNA. These results suggest that the AD-PCR assay correctly identifies species A and D. In districts Kheda and Udaipur, because of the i1 polymorphism, it was not possible to accurately assign cytologically identified i1 homozygotes individually to species A or D, but PCR has identified all the specimens as species D. From the fact that this assay has identified species A and D correctly in areas where i1 was not polymorphic, PCR identification of the i1 homozygotes in Kheda and Udaipur has been considered as correct. Furthermore, in Udaipur, the i1 heterozygote, as expected, was identified as species A. However, the AD-PCR assay did not identify the i1 heterozygotes from Kheda and Sonepat or the +i1 homozygotes from Sonepat as species A. One possible reason for these misidentifications could be that the i1 polymorphism also exists in species D, which could not be detected by polytene chromosome examinations. Until the reasons for this misidentification are clarified, it will be presumed, that in certain situations, species A may be misidentified as species D. In field studies thus far, no distinct differences in the vectorial potential or preference to feed on a particular host species have been observed between these two species.17 Thus, misidentification of species A as D will not lead to errors in planning vector control strategies targeted against An. culicifacies in areas where species A and D are sympatric.

By the two assays, AD-PCR and BCE-PCR, reported here, together with the D3 assay as has been done in this study or with the recently developed ITS2 PCR-RFLP assay, the non-vector species B now can be unequivocally distinguished from the four vector species, A, C, D, and E, in entomological surveys in all the areas where An. culicifacies is prevalent.

In many areas, An. culicifacies and An. fluviatilis sibling species are found sympatric in India.12,18,40 An. culicifacies belonging to the Myzomyia series can be distinguished from An. minimus and An. fluviatilis belonging to the same series by the D3 PCR assay.24 In northeastern India, all these three taxa are found sympatric. Similarly these assays can distinguish An. culicifacies from An. stephensi, another important vector, found sympatric in periurban areas. Thus, the PCR assay system presented here can be used in epidemiologic studies involving all five sibling species of the An. culicifacies complex and also in sympatric association with An. fluviatilis, An. minimus, and An. stephensi, three important malaria vectors in India.

The technique developed in this study identifies all the sibling species at all stages of the life cycle of the mosquito and is also easy to use. It requires three PCR assays to identify all the members of the complex and two assays to identify each An. culicifacies specimen to the level of the individual sibling species. It promises to be a useful technique for malaria entomological and insecticide resistance monitoring surveys until a new unified technique is developed. Keeping in view the complexity of malaria control in areas where vector species belong to species complexes, an AS-PCR technique such as the one reported here for the An. culicifacies complex will provide necessary information for planning and implementing control strategies against malaria vectors in India and neighboring countries.

Table 1

DNA sequences of the primers selected for AS-PCR assay, designed from COII region of mtDNA from five sibling species of the An. culicifacies complex

Sequence no.PrimerSequence (5′–3′)
1ADFCTAATCGATATTTATTACAC
2ADRTTACTCCTAAAGAAGGC
3DFTTAGAGTTTGATTCTTAC
4BCEFAAATTATTTGAACAGTATTG
5BCRTTATTTATTGGTAAAACAAC
6CRAGGAGTATTAATTTCGTCT
7ERGTAAGAATCAAATTCTAAG
Table 2

Results of AD-PCR assay evaluated on specimens of An. culicifacies s. l. collected from different areas and cytologically identified

Cytological karyotypes
Areas/districtsASPCR identifications+i1/+i1+i1/i1i1/i1Cytological identifications/ assignmentsAgreement of methods
* Details in the discussion section.
AllahabadD21DYes
GulbargaA2AYes
D3DYes
JabalpurD26DYes
KhedaD2ANo
D14A/D*Yes
SonepatD21ANo
UdaipurA1AYes
D14A/D*Yes
Laboratory colonyA15AYes
Table 3

Results of multiplex BCE-PCR assay evaluated on specimens of An. culicifacies s.l. collected from different areas and cytologically identified

Cytological identifications
DistrictsASPCR identificationsSpecies BSpecies CSpecies E
* One sample chromosomally identified as species B was identified as species C by PCR.
AllahabadB5
C2
BastarB1
C9
HardwarB12
HazaribaghB21
C1*12
RamanathapuramB5
E28
RanchiB16
Laboratory coloniesB15
C15
TotalB75
C138
E28
Figure 1.
Figure 1.

Map of India showing the location of collection sites [district (state)] for An. culicifacies s.l.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.454

Figure 2.
Figure 2.

Sequence alignment of mitochondrial COII gene among the five sibling species of the An. culicifacies complex using CLUSTAL X. - indicates similarity to the first sequence (in this figure of species B).

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.454

Figure 3.
Figure 3.

AD-PCR assay for the differentiation of species A and D of the An. culicifacies complex. Lanes 1 and 2: species A; lanes 3–6: species D; lane 7: 100-bp ladder (Promega).

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.454

Figure 4.
Figure 4.

Multiplex BCE-PCR assay to differentiate species B, C, and E of the An. culicifacies complex. Lane 1: 100-bp ladder (Promega); lanes 2 and 3: species B; lanes 4–7: species C; lanes 8–10: species E.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 75, 3; 10.4269/ajtmh.2006.75.454

*

Address correspondence to Sarala K. Subbarao, Indian Council of Medical Research, Ansari Nagar, New Delhi 110029, India. E-mail: saralaks@yahoo.com

Authors’ addresses: Geeta Goswami, O. P. Singh, N. Nanda, K. Raghavendra, and Sarala K. Subbarao, Malaria Research Centre, 22 Sham Nath Marg, Delhi 110054, India, E-mails: geetagoswami@hotmail.com, singh@mrcindia.org, nutanmrc@yahoo.co.in, kamarajur2000@yahoo.com, and saralks@yahoo.com; S. K. Gakhar, Maharshi Dayanand University, Rohtak, India, E-mail: skgakhar@yahoo.com. Present address of Sarala K. Subbarao: Indian Council of Medical Research, New Delhi, India.

Acknowledgments: We thank Prof. C. F. Curtis for valuable and helpful comments about the manuscript, K. B. Masiwal for providing the laboratory colonies, R. S. Sharma for helping with DNA extractions, A. K. Mukherji, Krishan Gopal, and Ram Kanwar for help with the chromosomal preparations, and Drs. V. K. Dua, S. K. Ghosh, Alex Eapen, B. N. Nagpal, B. Shahi, and R. S. Yadav for providing field specimens.

Financial support: This study was supported by the Department of Biotechnology (DBT), India.

REFERENCES

  • 1

    Harrison BA, 1980. The Myzomyia series of Anopheles (Cellia) in Thailand, with emphasis on intra-specific variations (Diptera: Culicidae). Contr Am Entomol Inst (Ann Arbor) 17 :1–195.

    • Search Google Scholar
    • Export Citation
  • 2

    Van Bortel W, Sochanta T, Harbach RE, Socheat D, Roelants P, Backeljau T, Coosemans M, 2002. Presence of Anopheles culicifacies B in Cambodia established by the PCR-RFLP assay developed for the identification of Anopheles minimus species A and C and four related species. Med Vet Entomol 16 :329–334.

    • Search Google Scholar
    • Export Citation
  • 3

    Rao TR, 1984. The Anophelines of India. Delhi, India: Malaria Research Centre.

  • 4

    Green CA, Miles SJ, 1980. Chromosomal evidence for sibling species of the malaria vector Anopheles (Cellia) culicifacies Giles. J Trop Med Hyg 83 :75–78.

    • Search Google Scholar
    • Export Citation
  • 5

    Subbarao SK, Vasantha K, Adak T, Sharma VP, 1983. Anopheles culicifacies complex: evidence for a new sibling species, species C. Ann Entomol Soc Am 76 :985–986.

    • Search Google Scholar
    • Export Citation
  • 6

    Suguna SG, Tewari SC, Mani TR, Hiryan J, Reuben R, 1989. A cytogenetic description of a new species of the Anopheles cu-licifacies species complex. Genetica 78 :225–230.

    • Search Google Scholar
    • Export Citation
  • 7

    Vasantha K, Subbarao SK, Sharma VP, 1991. Anopheles culicifacies complex: Population cytogenetic evidence for species D (Diptera: Culicidae). Ann Entomol Soc Am 84 :531–536.

    • Search Google Scholar
    • Export Citation
  • 8

    Kar I, Subbarao SK, Eapen A, Ravindran J, Satyanarayana TS, Raghavendra K, Nanda N, Sharma VP, 1999. Evidence for a new malaria vector species, species E, within the Anopheles culicifacies complex (Diptera: Culicidae). J Med Entomol 36 :595–600.

    • Search Google Scholar
    • Export Citation
  • 9

    Subbarao SK, 1998. Anopheline Species Complexes in South-East Asia. New Delhi, India: World Health Organization Regional Office for South-East Asia.

  • 10

    Subbarao SK, Adak T, Sharma VP, 1980. Anopheles culicifacies: sibling species distribution and vector incrimination studies. J Commun Dis 12 :102–104.

    • Search Google Scholar
    • Export Citation
  • 11

    Subbarao SK, Adak T, Vasantha K, Joshi H, Raghavendra K, Cochrane AH, Nussenzweig RS, Sharma VP, 1988. Suceptibility of Anopheles culicifacies species A and B to Plasmodium vivax and P falciparum as determined by immunoradiometric assay. Trans Roy Soc Trop Med Hyg 82 :394–397.

    • Search Google Scholar
    • Export Citation
  • 12

    Subbarao SK, Vasantha K, Joshi H, Raghavendra K, Usha Devi C, Satyanarayana TS, Cochrane AH, Nussenzweig RS, Sharma VP, 1992. Role of Anophelese culicifacies sibling species in malaria transmission in Madhya Pradesh, India. Trans Roy Soc Trop Med Hyg 86 :613–614.

    • Search Google Scholar
    • Export Citation
  • 13

    Subbarao SK, Vasantha K, Raghavendra K, Sharma VP, Sharma GK, 1988. Anopheles culicifacies: sibling species composition and its relationship to malaria incidence. J Am Mosq Contr Assoc 4 :29–33.

    • Search Google Scholar
    • Export Citation
  • 14

    Joshi H, Vasantha K, Subbarao SK, Sharma VP, 1988. Host feeding patterns of Anophelese culicifacies species A and B. J Am Mosq Contr Assoc 4 :248–251.

    • Search Google Scholar
    • Export Citation
  • 15

    Subbarao SK, Vasantha K, Sharma VP, 1988a. Response of Anopheles culicifacies species A and B to DDT and HCH in India: implications in malaria control. Med Vet Entomol 2 :219–223.

    • Search Google Scholar
    • Export Citation
  • 16

    Raghavendra K, Vasantha K, Subbarao SK, Pillai MKK, Sharma VP, 1991. Resistance in Anopheles culicifacies sibling species B and C to malathion in Andhra Pradesh and Gujarat states in India. J Am Mosq Contr Assoc 7 :255–259.

    • Search Google Scholar
    • Export Citation
  • 17

    Subbarao SK, Sharma VP, 1997. Anopheline species complexes and malaria control. Indian J Med Res 106 :164–173.

  • 18

    Subbarao SK, Nanda N, Raghavendra K, 1999. Malariogenic stratification of India using Anopheles culicifacies sibling species prevalence. ICMR Bull 29 :75–80.

    • Search Google Scholar
    • Export Citation
  • 19

    Milligan PJM, Phillips A, Molyneux DH, Subbarao SK, White GB, 1986. Differentiation of Anopheles culicifacies Giles (Diptera: Culicidae) sibling species by analysis of cuticular components. Bull Entomol Res 76 :529–537.

    • Search Google Scholar
    • Export Citation
  • 20

    Adak T, Subbarao SK, Sharma VP, Rao SRV, 1994. Lactate dehydrogenase allozyme differentiation of species in the Anopheles culicifacies complex. Med Vet Entomol 8 :137–140.

    • Search Google Scholar
    • Export Citation
  • 21

    Gunasekera MB, de Silva BGDNK, Abeyewickreme W, Subbarao SK, Nandadasa HG, Karunayayake EH, 1995. Development of DNA probes for the identification of sibling species A of the Anopheles culicifacies (Diptera: Culicidae) complex. Bull Entomol Res 85 :345–353.

    • Search Google Scholar
    • Export Citation
  • 22

    Krzywinski J, Besansky NJ, 2003. Molecular systematics of Anopheles: from subgenera to subpopulations. Annu Rev Entomol 48 :111–139.

  • 23

    Curtis CF, Townson H, 1998. Existing methods of vector control and molecular entomology. British Med Bull 54 :311–325.

  • 24

    Singh OP, Goswami G, Nanda N, Raghavendra K, Chandra D, Subbarao SK, 2004. An allele specific polymerase chain reaction assay for the identification of members of Anopheles culicifacies complex. J Biosciences 29 :275–278.

    • Search Google Scholar
    • Export Citation
  • 25

    Goswami G, Nanda N, Raghavendra K, Gakhar SK, Subbarao SK, 2005. PCR-RFLP of mitochondrial cytochrome oxidase subunit II and ITS2 of ribosomal DNA: markers for the identification of members of Anopheles culicifacies complex (Diptera: Culicidae). Acta Trop 95 :92–99.

    • Search Google Scholar
    • Export Citation
  • 26

    Salazar M, Theoduloz C, Vega A, Poblete F, Gonzalez E, Badilla R, Meraa-Basso L, 2002. PCR-RFLP identification of endemic Chilean species of Rhagoletis (Diptera:Tephritidae) attacking solanaceae. Bull Entomol Res 92 :337–341.

    • Search Google Scholar
    • Export Citation
  • 27

    Hazel CL, Garcia-Maruniak A, Maruniak JE, 2002. Strain identification of Spodoptera frugiperda (Lepidoptera:Noctuidae) Insects and cell line: PCR-RFLP of cytochrome oxidase c subunit I gene. Fla Entomol 85 :186–190.

    • Search Google Scholar
    • Export Citation
  • 28

    Carew ME, Pettigrove V, Hoffmann AA, 2003. Identifying chironomids (Diptera: Chironomidae) for biological monitoring with PCR-RFLP. Bull Entomol Res 93 :483–490.

    • Search Google Scholar
    • Export Citation
  • 29

    Mitchell SE, Narang SK, Cockburn AK, Seawright JA, Godenthal M, 1992. Mitochondrial and ribosomal DNA variation among members of the Anopheles quadrimaculatus (Diptera: Culicidae) species complex. Genome 35 :939–950.

    • Search Google Scholar
    • Export Citation
  • 30

    Narang SK, Seawright JA, Mitchell SE, Kaiser PE, Calrson DA, 1993. Multiple-technique identification of sibling species of the Anopheles quadrimaculatus complex. J Am Mosq Cont Assoc 9 :463–464.

    • Search Google Scholar
    • Export Citation
  • 31

    Green CA, Hunt RH, 1980. Interpretation of variation in ovarian polytenene chromosomes of Anopheles funestus Giles, A Parensis gillies and A Aruni? Genetica 51 :187–195.

    • Search Google Scholar
    • Export Citation
  • 32

    Subbarao SK, Vasantha K, Sharma VP, 1988. Cytotaxonomy of certain malaria vectors of India. Service MW, ed. Biosystematics of hematophagous insects. Oxford, UK: Clarendon Press, 25–37.

  • 33

    Subbarao SK, Nanda N, Chandrahas RK, Sharma VP, 1993. Anopheles culicifacies complex: Cytogenetic characterization of Rameshwaram island populations. J Am Mosq Contr Assoc 9 :27–31.

    • Search Google Scholar
    • Export Citation
  • 34

    Coen ES, Thoday JM, Dover G, 1982. Rate of turnover of structural variants in the rDNA gene family of Drosophila melanogaster.Nature 295 :564–568.

    • Search Google Scholar
    • Export Citation
  • 35

    Simon C, Frati F, Beckenbach A, Crespi B, Liu H, Flook P, 1994. Evolution, weighting and phylogenetic utility of mitochondrial gene sequences and a complilation of conserved polymerase chain reaction primers. Ann Entomol Soc Am 87 :651–701.

    • Search Google Scholar
    • Export Citation
  • 36

    Thompson JD, Gibson TJ, Plenwniak F, Jeanmougin F, Higgins DG, 1997. The Clustal X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acid Res 24 :4876–4882.

    • Search Google Scholar
    • Export Citation
  • 37

    Ugozzoli L, Wallace RB, 1991. Allele-specific polymerase chain reaction. Methods: A comparison to Methods in Enzymology 2 :42–48.

  • 38

    Huang MM, Arnheim N, Goodman MF, 1992. Extension of base mispairs by Taq DNA polymerase: implication for single nucleotide discrimination in PCR. Nucl Acids Res 20 :4567–4573.

    • Search Google Scholar
    • Export Citation
  • 39

    Paskewitz SM, Collins FH, 1990. Use of polymerase chain reaction to identify mosquito species of the Anopheles gambiae complex. Med Vet Entomol 4 :367–373.

    • Search Google Scholar
    • Export Citation
  • 40

    Nanda N, Yadav RS, Subbarao SK, Joshi H, Sharma VP, 2000. studies in Anopheles fluviatilis and Anopheles culicifacies in relation with malaria in forest and deforested reverine ecosystems in northern Orissa, India. J Am Mosq Contr Assoc 16 :199–205.

    • Search Google Scholar
    • Export Citation

Author Notes

Reprint requests: K. Raghavendra, Malaria Research Centre, 22 Sham Nath Marg, Delhi 110054, India, E-mail: kamarajur2000@yahoo.com.
Save