.png)
INTRODUCTION
The major merozoite surface protein 1 (MSP-1) of Plasmodium falciparum undergoes processing during formation and maturation of merozoites to form four major fragments of approximately 83, 28–30, 38, and 42 kD.1 The 42-kD polypeptide is further cleaved into 33- and 19-kD fragments and the latter remains at the surface of the ring-stage parasite after invasion of the host erythrocyte. The MSP-1 gene can be divided into 17 sequence blocks that are either conserved, semi-conserved, or variable.2 The MSP-1 gene is dimorphic at each block for either K1 or MAD 20 with the exception of block 2, which has an additional allele RO33,3 and block 4, which may either be of the K1 or MAD20 prototypes or a recombinant of these types. Thus, the MSP-1 gene can have the following combinations: one of three versions of block two: K1, MAD20, or RO33; one of four possibilities of block 4: MM, KK, MK, or KM; and one of two possibilities for block 6 through 16: K1 or MAD20. These combinations present 24 possible gene types for MSP-1 and sequence variation occurs in more than 60% of the gene.4–6 Antigenic polymorphism of MSP-1 corresponding to this sequence variability has been demonstrated using a panel of variant-specific monoclonal antibodies.7,8 A polymerase chain reaction (PCR) strategy was developed to determine the 24 different MSP-1 association types based on block 2, 4a, 4b, and 10–17 to investigate allelic variation in the MSP-1 gene.9 Their study from southern Vietnam showed 1) that recombination between two representative allelic types in the central part of the MSP-1 gene did not exist, 2) the frequency distribution of MSP-1 association types did not differ in different population groups, and 3) particular MSP-1 association types were predominant. Other studies of MSP-1 genetic diversity in Brazil6 have suggested that selection operates in favor of particular MSP-1 association types.
Antigenic polymorphism is a potential limitation for developing a P. falciparum MSP-1–based malaria vaccine. In contrast to the N-terminal region of MSP-1, a limited degree of polymorphism has been documented for the 19-kD C-terminal region, which has been attributed to point mutation and recombination.10 In this study, we have analyzed the genetic diversity in the N-terminal region (blocks 2, 4, and 6) and the C-terminal region (block 16) of MSP-1 using PCR on DNA obtained from parasites of children and adults infected with P. falciparum in the malaria-endemic region of Buenaventura, Colombia.
MATERIALS AND METHODS
Study site.
The study was conducted in Buenaventura, a port city located on the Pacific coast of Colombia. It has 292,373 inhabitants, 85.6% of whom live in the urban area. The population of the four coastal states located along the Pacific coast is nearly one million (2.5% of the national population) and the malaria cases of this region represent 12.5% of the total cases in the country.11–13 Colombia reported 206,195 malaria cases in 2001, and 93,633 of these were due to infection with P. falciparum.14 In Buenaventura, 16,578 malaria cases were reported in 1998 and 10,238 in 2001. Malaria transmission is low and unstable in this disease-endemic area and Anopheles albimanus is the primary vector in the urban area. Anopheles neivai and An. nuneztovari are common in the rural area. Buenaventura is characterized by relatively high humidity (80–90%) and receives 8,000 mm of annual rainfall. The average temperature is 26°C (78.8°F).11,13,15
Plasmodium falciparum isolates. Blood samples positive for P. falciparum were collected from symptomatic patients (patients with fever and headache) who attended the Program for Tropical Diseases and Immunology Institute in Buenaventura after consent was provided to Malaria Vaccine and Drug Development Center health personnel. The study protocol was reviewed and approved by the Institutional Review Board of Universidad del Valle. Patients attending the health center came from Buenaventura (patient population = 270,000) and the surrounding rural area (patient population = 4,331) and provide a representative sample of malaria cases in the rural and urban areas. Forty-six blood samples were obtained at three different times: 18 samples (01–20) were collected in February 1998, 11 samples (Z01–Z12) were collected in October 1998, and 17 samples (1F–17F) were collected in July 2001. Plasmodium falciparum parasitemia in these samples varied from 5 to 350 parasites/100 white blood cells. Each sample was identified by patient origin, age, and sex, and parasitemia was determined by a thick blood smear stained with Giemsa.
Isolation of P. falciparum DNA from blood of infected humans.
Blood (0.5–1 mL) was withdrawn from each patient and 500 μL of lysis buffer (1.6 M sucrose, 5% [v/v] Triton X-100, 25 mM MgCl2, 60 mM Tris-HCl, pH 7.5) was added to the blood. The mixture was centrifuged at 13,000 rpm for one minute in an Eppendorf (Hamburg, Germany) microcentrifuge. The supernatant was discarded and the excess liquid was air-dried. The pellet was resuspended in 5× filtered proteinase K buffer (0.375 M NaCl, 0.12 M EDTA, pH 8), proteinase K, and 20% sodium dodecyl sulfate, and adjusted up to a volume of 400 μL with distilled water. The mixture was incubated at 55°C with constant shaking for at least 30 minutes. One volume of phenol-chloroform was then added and mixed by vortexing to remove protein contaminants. The sample was then centrifuged at 10,000 rpm for five minutes at room temperature. The aqueous phase was transferred to a new vial, precipitated with cold ethanol, and incubated at −70°C for one hour. The vial was centrifuged at 13,000 rpm for 15 minutes at 4°C. The DNA was pelleted by centrifugation at 13,000 rpm for five minutes and the pellet was washed with 70% ethanol. The supernatant was discarded and the DNA pellet was washed again with 70% ethanol. The sample was centrifuged at 13,000 rpm for five minutes and the DNA pellet was dried. Gene Clean III kit (Bio 101, Irvine, CA) was used to further purify the isolated DNA.
Plasmodium falciparum MSP-1 typing of blocks 2, 4a, 4b, 6, and 16.
Specific PCR primer pairs4–6,9 (Gibco-BRL, Gaithersburg, MD) were used to type the different variable blocks of MSP-1 and are shown in Table 1. The location of each of the primers along the MSP-1 gene is shown in Figure 1. Genotyping focused on blocks 2, 4, 6, and 16–17 because although blocks 2 and 4 are variable and block 4 is known to undergo intragenic recombination, blocks 6–16 are concordant in all parasites examined to date.16 Prototype MSP-1 allelic sequences were derived from the K1, MAD20, and RO33 isolates of P. falciparum. The sensitivity and specificity of each primer pair was established using positive control DNA templates obtained from parasites containing each allelic sequence.
Amplification by PCR.
The PCR mixtures (25 μL) contained 23 μL of PCR Super Mix (Gibco-BRL), 0.6 μL of DNA template, and 0.5 μL of each primer. For amplification of blocks 2 and 16, 50 cycles at 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 30 seconds were used. To type block 4, blocks 3–5 were amplified and a nested PCR was performed using 0.5 μL of the blocks 3–5 PCR products per 25-μL PCR. For these reactions, 25 cycles at 95°C for 30 seconds, 56°C for 30 seconds, and 72°C for 10 seconds were used to amplify the DNA. For block 6, 50 cycles at 95°C for 30 seconds, 56°C for 10 seconds, and 72°C for 10 seconds were used. Every PCR assay included a tube containing no template as a negative control.
Gel electrophoresis.
The PCR products were subjected to electrophoresis on 2% agarose gels (Gibco-BRL) in Tris-acetate-EDTA buffer for various lengths of time depending of the predicted size of the PCR products and visualized with ethidium bromide by transillumination with ultraviolet light. We used 100 and 50 basepair ladders (Pharmacia Biotech, Piscataway, NJ) as standards for estimation of the sizes of DNA fragments.
Determination of P. falciparum MSP-1 gene type by PCR.
Table 1 shows the set of PCR primers designated to identify 24 distinct MSP-1 gene types targeting sequences in blocks 2, 3–5, 4a, 4b, 6, and 16–17. Typing was done using the PCR primers shown in Table 2 and based on the predicted sizes of PCR products. Our strategy to determine MSP-1 gene type was as follows. First, the allelic type of block 2 was determined by PCR in three separate reaction mixtures containing any of three allele-specific primers (K2F, M2F, or R2F) and the reverse primer C3R. Second, block 3–5 was amplified with C3F as forward primer and C5R as reverse primer. Third, the allelic type of block 4 (4a/4b) was determined in four different reactions of the block 3–5 PCR product with all combinations of the M4AF, K4AF forward primers and M4PR and K4PR reverse primers.
Data analysis.
Variation in haplotype frequencies between populations from different geographic areas was analyzed using Wrights FST statistics as computed by the Arlequin version 2.000 population genetics software program (Genetics and Biometry Laboratory, University of Geneva, Geneva, Switzerland). The MSP1 gene diversity (Ĥ) in different populations was estimated as
where n is the number of isolates sampled, k is the number of haplotypes, and pi is the sample frequency of the ith haplotype using Arlequin version 2.000.
RESULTS
The PCR amplification of the variable regions of P. falciparum MSP-1 was performed on 46 blood samples collected in 1998 and 2001 from malaria patients in Buenaventura, Colombia (Table 3). Of the subjects analyzed, 25 (54%) were female and 20 (46%) were male. The blood samples used in this study were from 3 children ≤ 10 years of age (one 8 years old and two 10 years old, 6.52%), 17 children and young adults between 11 and 20 years of age (37%), 11 adults between 21 and 30 years of age (24%), and 15 adults between 31 and 50 years of age (32.48%). Forty-four of the 46 patient samples (96%) were successfully characterized for MSP-1 genotype by PCR. The MSP-1 allelic types for blocks 2, 6, and 16 corresponded exclusively to the M allele for all three sampling times. No size variation was noted for PCR products containing the block 2 variable repeat region in these samples. In contrast, MSP-1 block 4 showed substantial variation with sequences corresponding to both prototypic (K and M) and recombinant (K:M and M:K) allelic types.
Detection of more than one allelic type for block 4 provided evidence for multiple P. falciparum infections of many individuals. Based on block 4 typing, nine (20.5%) of the samples were found to have single infections, while 35 (79.5%) of the samples had multiple infections ranging from 2 to 4 distinguishable parasite genotypes. A total of 109 clones were identified among the 46 P. falciparum samples by PCR.
Frequency distributions of the MSP-1 gene types detected in this study are shown in Figure 2. There was no difference in the sex distribution of the observed gene types. When gene type frequencies were examined for each collection date, some differences were noted (Figure 2). There was a significant difference in the proportion of each allelic type among samples collected during February 1998 (P = 0.01 by Fisher’s exact test) and July 1998 (P = 0.0009 by Fisher’s exact test), with a higher representation of types 17 and 20 than types 14 and 23. During October 2001, allelic frequencies were also unequally distributed (χ2 = 4.86, P < 0.05), but in these samples gene types 14 and 23 were more prevalent than at earlier sampling dates. When the gene type frequencies of pairs of population samples were compared using conventional F-statistics, FST P values were significantly different for the July 1998 and October–November 2001 samples (FST P < 0.0005), while other pairwise comparisons were not significantly different. However, despite variations in gene type frequencies, the same four gene types were detected for all three sampling dates in Buenaventura.
The MSP-1 genotyping results obtained in Buenaventura were compared with those of similar studies carried out in Vietnam, the southwestern Brazilian Amazon, and northern Tanzania.4–6 The percentage of isolates with more than one MSP-1 gene type was higher in samples from Buenaventura (80%) than reported for Brazil, Vietnam, or Tanzania (Table 4). The MSP-1 gene diversity (Ĥ) was lower in Buenaventura, an area hypoendemic for P. falciparum malaria, than in the Brazilian Amazon, another hypoendemic area, Vietnam (a mesoendemic area), and northern Tanzania (a holoendemic area) (Table 4). A pairwise comparison of MSP-1 gene type frequencies for the various geographic regions by F statistics indicated that each of these regions were significantly different from each other (FST P = ≤ 0.001), with the exception of Brazil and Tanzania (Table 4). The four MSP1 gene types observed in Buenaventura represented 17–58% of the isolates identified in the three other regions. However, gene types 13–24 containing MAD20 allelic types downstream of block 4 predominated in all four geographic areas.
DISCUSSION
A restricted number of MSP-1 gene types (4 of the 24 possible gene types) were identified in P. falciparum samples collected in Buenaventura, Colombia in 1998 and 2001. In samples taken from 46 malaria cases, only the MAD20 (M) allelic type was observed for blocks 2, 6, and 16 and no size variation was noted for block 2 containing the variable repeat region. In contrast, block 4 showed remarkable variability, consisting of all four possible MSP1 parental (K1 and MAD20) and recombinant (K:M and M:K) allelic types. Although the proportion of MSP-1 gene types corresponding to the different block 4 allelic types varied somewhat over time, limitation of the parasite population to the same four MSP-1 gene types was stable over the four-year span of the study.
The presence of this pattern of diversity within block 4 suggests that parasites currently present in Buenaventura are descendent from both K1 and MAD20 parasite populations. Parasites with MSP-1 allelic types 14, 17, and 20 would have undergone two recombination events within block 4, between blocks 3 and 4, and/or between blocks 4 and 5 to generate the population of recombinant parasites present in this region. These recombination events could have occurred prior to or following introduction to this geographic region. The high frequency of mixed parasite infections observed in samples collected in Buenaventura (80%) would increase the potential for meiotic recombination at the MSP-1 locus in the mosquito vector. Similar recombination within MSP1 block 4 and co-existence of the four block 4 allelic types were observed in isolates obtained in the Mae Sod District of Tak Province in Thailand, in the Solomon Islands, and in the Brazilian Amazon.6,17 Although MSP-1 gene type 20 (block 4 allelic type K:M) was common among Buenaventura isolates, it was not detected in the Brazilian Amazon or in Tanzania. The significance of sequence diversity within block 4 is unknown. Antibody reactivity of block 2 variant peptides by malaria patients has been described.18,19
Human serologic reactivity with block 4 sequences has not been evaluated; however, murine monoclonal antibodies specific for K1 and MAD20 allelic epitopes within block 4 have been described.20 Thus, it will be of interest to determine whether humans develop an antibody response to block 4 epitopes and, if so, whether these antibodies discriminate among the prototypic K and M and chimeric M:K and K:M allelic types. Alternatively, Block 4 sequences may correspond to T cell epitopes that elicit the activation of type/major histocompatibility complex–specific CD4+ T helper cells. Dimorphic T cell epitopes of P. falciparum MSP-1 that overlap with the N-terminal border of block 4, which are frequently recognized by interferon-γ (Th1) and interleukin-4 (Th2) and produce T cells of east and west African donors, have been described.9,21
Previous studies of MSP-1 allelic types in Colombia have provided varying patterns of diversity, although these analyses have been limited to MSP-1 block 2. The first study was carried out in 1990 in several regions of Colombia including Buenaventura, located in the western coastal region of Colombia.22 In that study, most samples from Buenaventura contained either the MAD20 or RO33 block 2 allelic types, but K1 block 2 allelic type was not detected. A few samples containing the K1 block 2 allelic type were detected in patients from other locations in Colombia. Nine of the 31 samples (29%) appeared to be mixed infections in that study, while in our study 80% of the samples were mixed infections. In a second study carried out in Chocó (northwest Colombia) in 1997, all three MSP-1 block 2 allelic types were detected although MAD20 was the predominant allele and K1 was the least frequent.15 In studies carried out during 2000–2001 in the Turbo and Zaragoza municipalities of northwestern and northeastern Colombia, respectively, 100% of P. falciparum samples contained only the MAD20 block 2 allelic type, similar to our studies in Buenaventura.23 The latter study and our study, which were both carried out at approximately the same time, suggest that current P. falciparum populations may have become more homogeneous in several regions of Colombia. However, our studies additionally detected a level of diversity within MSP-1 block 4 in Colombian parasites that has not been previously recognized.
Although we did not sequence block 4 in our study, sequence variation in block 4 was previously studied in parasite clones from Thailand, the Brazilian Amazon, and several common laboratory isolates.6,17 These results indicated that recombination within block 4, although imprecise, was localized to the central region of block 4 and appears to be the only MSP-1 region that undergoes recombination resulting in the generation of chimeric types. Although overall MSP-1 gene diversity in Buenaventura was lower than most other hypoendemic and endemic areas studied in the same manner, a higher average number of gene types per patient were observed in Buenaventura than reported previously for other geographic areas. The detection of three of the four allelic types found in Buenaventura in Vietnam, Brazil, and Tanzania suggests that these MSP-1 gene types are broadly distributed worldwide. Frequencies of each of the four MSP-1 gene types were significantly different for each geographic region, suggesting that no single clone was of intrinsically greater virulence than the others. It was previously suggested that one of the mechanisms of selective pressure in malaria is the host’s immunity against particular MSP-1 association types.24 Although it is possible that immunity developed after repeated or simultaneous, multiple infections decreases the number of association types per patient with age, the stability of multiple MSP-1 gene types within a population observed in this and other studies suggest that MSP-1 block 4 is not under strong positive or negative selection at the population level. The persistence of both parental and recombinant alleles of block 4 in the face of restricted heterogeneity over the rest of the MSP-1 gene suggests that block 4 allelic diversity may either be selectively neutral or under balancing selection. Block 4 may represent a hot spot for meiotic recombination that is neutral for selection either by the human immune system or in the mosquito vector. Alternatively, balancing selection would favor maintenance of block 4 polymorphism for longer periods of time as observed for the major histocompatibility complex genes of vertebrates.25 Both synonymous (dS) and nonsynonymous (dN) nucleotide substitution rates across sites in different alleles of the MSP-1 gene indicate that recombinants within sequences corresponding to region 4 such as seen in the CAMP isolate of P. falciparum have resulted from relatively recent recombination events between the K1 and MAD20 or closely related alleles.26 Balanced selection of Block 4 polymorphism may reflect the association of these type-specific epitopes with different MHC class II genes for CD4+ T cell recognition in a genetically diverse host population.
Dominance of MAD20 sequences outside block 4, as indicated by the prevalence of the MAD20 allelic type within blocks 2, 6 and 16, suggests that there may be positive selection for the MAD20 allelic sequence outside of block 4 in P. falciparum MSP-1. This is consistent with the higher prevalence of the MAD20 MSP-1 sequences encompassing blocks 6–17 in most malaria-endemic areas worldwide, including southern Vietnam (82%), the Brazilian Amazon (96%), India (94%), and all six populations examined in Africa (> 90%: The Gambia, Nigeria, Gabon, northeastern Sudan, northeastern Tanzania, and South Africa).27,28 These studies have implications for the design of a blood-stage malaria vaccine based on MSP-1 because an effective vaccine should induce an immune response specific for these dominant, MAD20-related MSP-1 allelic sequences.
Primer sequences used to genotype Plasmodium falciparum merozoite surface protein 1
| Primer | Sequences 5′ → 3′ | Specificity |
|---|---|---|
| K2F | TCTTAAATGAGAAGAAATTACTACAAA | K1 block 2 |
| M2F | GGTTCAGGTAATTCAAGACGTAC | MAD20 block 2 |
| R2F | TAAAGGATGGAGCAAATACTCAAGT | RO33 block 2 |
| C3R | ACATATGATTGGTTAAATCAAAGAG | Common block 3 |
| C3F | TTCGTGCAAATGAATTAGACGTAC | Common block 3 |
| K4AF | AATGAAATTAAAAATCCCCCACCGG | K1 block 4a |
| M4AF | TTGAAGATATAGATAAAATTAAAACAGATG | MAD20 block 4a |
| K4PR | TCGACTTCTTTTTTTGTTCTTATCAAG | K1 block 4b |
| M4PR | TCGACTTCTTTTTTCTTATTCTCAG | MAD20 block 4b |
| C5F | CATTGATAGTTATTTACTGATCCAC | Common block 5 |
| C5R | GGATCAGTAAATAAACTATCAATGT | Common block 5 |
| K6R | GATATTCATTGGGTTCAGTTGATTC | K1 block 6 |
| M6R | ATTTGAACAGATTTCGTAGGATCTTG | MAD20 block 6 |
| K16F | CCGTTTTATCTAATTTACTTGATGGAA | K1 block 16 |
| M16F | CCTAATACAATAATATCAAAATTAATTGA | MAD20 block 16 |
| C3FlR | ATTAAGGTAACATATTTTAACTCCTAC | Common block 16/17 |
Allelic type designations for specific primer pairs and predicted fragment sizes
| Block | Allelic type* | Forward primer | Reverse primer | Fragment size (basepairs) |
|---|---|---|---|---|
| * K = K1; M = MAD20; R = RO33. | ||||
| 2 | K | K2F | C3R | 264–390 |
| M | M2F | C3R | 154 | |
| R | R2F | C3R | 270 | |
| 4a–4b | K:K | K4AF | K4PR | 80 |
| K:M | K4AF | M4PR | 83 | |
| M:K | M4AF | K4PR | 94 | |
| M:M | M4AF | M4PR | 94–90 | |
| 6 | K | C5F | K6R | 420 |
| M | C5F | M6R | 428 | |
| 16 | K | K16 | C3FlR | 420 |
| M | M16F | C3FlR | 428 | |
Plasmodium falciparum merozoite surface protein 1 polymerase chain reaction genotyping results of 46 patient samples from Buenaventura, Colombia*
| Sample collection date and no. | Age (years) | Sex | Parasite density† | Block 2 | Block 4 | Block 6 | Block 16 |
|---|---|---|---|---|---|---|---|
| * M = MAD20. Multiple allelic types are separated by slashes. ND = not done (insufficient sample volume). | |||||||
| † ++ = 11–100 parasites/100 fields; +++ = 0–10 parasites/field; ++++ = 11–100 parasites/field. | |||||||
| 2/98 01 | 39 | M | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 02 | 39 | M | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 03 | 30 | F | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 04 | 24 | M | +++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 05 | 18 | F | ++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 06 | 18 | M | +++ | MAD20 | K1:M | MAD20 | MAD20 |
| 07 | 20 | F | +++ | MAD20 | M:M/M:K1 | MAD20 | MAD20 |
| 08 | 21 | M | +++ | MAD20 | M:K1 | MAD20 | MAD20 |
| 10 | 11 | F | +++ | MAD20 | M:M/M:K1/K1:M | MAD20 | MAD20 |
| 11 | 18 | F | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 12 | 16 | F | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| 13 | 8 | M | +++ | MAD20 | ND* | MAD20 | MAD20 |
| 15 | 23 | M | ++ | MAD20 | ND* | MAD20 | MAD20 |
| 16 | 43 | F | ++ | MAD20 | M:M | MAD20 | MAD20 |
| 17 | 26 | M | +++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 18 | 12 | F | +++ | MAD20 | M:K1 | MAD20 | MAD20 |
| 20 | 10 | M | ++ | MAD20 | M:K1 | MAD20 | MAD20 |
| 22 | 17 | F | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 10/98 Z01 | 50 | M | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z02 | 37 | F | ++ | MAD20 | K1:M | MAD20 | MAD20 |
| Z03 | 21 | F | +++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z04 | 11 | M | ++++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z05 | 14 | F | ++++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z06 | 46 | M | ++++ | MAD20 | K1:M | MAD20 | MAD20 |
| Z08 | 36 | M | ++ | MAD20 | K1:M | MAD20 | MAD20 |
| Z09 | 18 | M | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z10 | 39 | M | ++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| Z11 | 27 | F | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| Z12 | 36 | F | +++ | MAD20 | M:K1/K1:M | MAD20 | MAD20 |
| 7/01 1F | 10 | M | ++ | MAD20 | M:M/M:K1/K1:M/K:K1 | MAD20 | MAD20 |
| 2F | 26 | F | ++ | MAD20 | M:M/K1:M/K1:K1 | MAD20 | MAD20 |
| 3F | 18 | F | ++ | MAD20 | K1:K1 | MAD20 | MAD20 |
| 4F | 36 | M | +++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 5F | 14 | F | ++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 6F | 18 | F | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| 7F | 35 | F | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| 8F | 30 | F | +++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| 9F | 12 | F | ++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 10F | 38 | F | +++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 11F | 46 | M | ++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 12F | 26 | M | ++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 13F | 18 | F | +++ | MAD20 | M:M/M:K1/K1:M/K1:K1 | MAD20 | MAD20 |
| 14F | 49 | M | ++ | MAD20 | M:M/K1:M/K1:K1 | MAD20 | MAD20 |
| 15F | 38 | F | ++ | MAD20 | M:M/K1:M/K1:K1 | MAD20 | MAD20 |
| 16F | 19 | F | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
| 17F | 29 | M | ++ | MAD20 | M:M/M:K1/K1:K1 | MAD20 | MAD20 |
Comparison of merozoite surface protein 1 (MSP1) genotype frequencies and diversity for Plasmodium falciparum isolates from Vietnam, Buenaventura, the southwestern Brazilian Amazon, and northern Tanzania.
| Vietnam4 | Buenaventura Colombia | Southwestern Brazilian Amazon6 | Northern Tanzania5 | |
|---|---|---|---|---|
| MSP1 gene type | (mesoendemic) | (hypoendemic) | (hypoendemic) | (holoendemic) |
| 1 | 9 | 0 | 0 | 4 |
| 2 | 16 | 0 | 2 | 2 |
| 3 | 0 | 0 | 1 | 0 |
| 4 | 1 | 0 | 0 | 0 |
| 5 | 1 | 0 | 0 | 0 |
| 6 | 0 | 0 | 0 | 0 |
| 7 | 0 | 0 | 0 | 0 |
| 8 | 3 | 0 | 0 | 2 |
| 9 | 0 | 0 | 0 | 0 |
| 10 | 1 | 0 | 0 | 0 |
| 11 | 0 | 0 | 0 | 0 |
| 12 | 1 | 0 | 0 | 0 |
| 13 | 1 | 0 | 7 | 14 |
| 14 | 16 | 21 | 0 | 6 |
| 15 | 6 | 0 | 5 | 3 |
| 16 | 6 | 0 | 25 | 43 |
| 17 | 39 | 35 | 5 | 28 |
| 18 | 1 | 0 | 18 | 32 |
| 19 | 3 | 0 | 0 | 1 |
| 20 | 13 | 31 | 0 | 0 |
| 21 | 7 | 0 | 0 | 0 |
| 22 | 14 | 0 | 5 | 18 |
| 23 | 38 | 22 | 8 | 20 |
| 24 | 6 | 0 | 1 | 14 |
| n | 182 | 109 | 77 | 187 |
| No. gene types detected | 19 | 4 | 10 | 13 |
| Percent with > 1 gene type | 46 | 80 | 39 | 60 |
| Average no. gene types sample | 1.78 | 2.4 | 1.42 | 2.37 |
| Gene diversity (Ĥ) | 0.8809 ± 0.0118 | 0.745 ± 0.0118 | 0.8178 ± 0.0264 | 0.8661 ± .0100 |
| Population pairwise comparison | Pairwise F-statistics | F-ST P |
|---|---|---|
| Vietnam vs Colombia | 0.04452 | ≤0.001 |
| Vietnam vs Brazil | 0.09691 | ≤0.001 |
| Vietnam vs Tanzania | 0.05178 | ≤0.001 |
| Colombia vs Brazil | 0.18583 | ≤0.001 |
| Colombia vs Tanzania | 0.12591 | ≤0.001 |
| Brazil vs Tanzania | 0.00813 | 0.063 |
a, Basic structure of the Plasmodium falciparum merozoite surface protein 1 gene. Conserved, semi-conserved, and variable blocks of the gene are shown as open, hatched, and closed boxes, respectively.8 b, Scheme for locations and directions of the oligonucleotide primers used to type variable blocks 2, 4, 6, and 16.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
a, Basic structure of the Plasmodium falciparum merozoite surface protein 1 gene. Conserved, semi-conserved, and variable blocks of the gene are shown as open, hatched, and closed boxes, respectively.8 b, Scheme for locations and directions of the oligonucleotide primers used to type variable blocks 2, 4, 6, and 16.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
a, Basic structure of the Plasmodium falciparum merozoite surface protein 1 gene. Conserved, semi-conserved, and variable blocks of the gene are shown as open, hatched, and closed boxes, respectively.8 b, Scheme for locations and directions of the oligonucleotide primers used to type variable blocks 2, 4, 6, and 16.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
Frequency distribution of Plasmodium falciparum merozoite surface protein 1 (MSP-1) gene types (shown as bars for types 14, 17, 20, and 23) in 44 patient blood samples collected in February 1998, July 1998, and October–November 2001 in Buenaventura, Colombia. Numbers above bars correspond to number of samples with each gene type.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
Frequency distribution of Plasmodium falciparum merozoite surface protein 1 (MSP-1) gene types (shown as bars for types 14, 17, 20, and 23) in 44 patient blood samples collected in February 1998, July 1998, and October–November 2001 in Buenaventura, Colombia. Numbers above bars correspond to number of samples with each gene type.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
Frequency distribution of Plasmodium falciparum merozoite surface protein 1 (MSP-1) gene types (shown as bars for types 14, 17, 20, and 23) in 44 patient blood samples collected in February 1998, July 1998, and October–November 2001 in Buenaventura, Colombia. Numbers above bars correspond to number of samples with each gene type.
Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 73, 5_suppl; 10.4269/ajtmh.2005.73.55
Address correspondence to Zilka I. Terrientes, Apartado 6-4625, El Dorado, Panama City, Panama. E-mail: zilkat@cwpanama.net
Author’s addresses: Zilka I. Terrientes, Apartado 6-4625, El Dorado, Panama City, Panama, Telephone: 507-223-7179, Fax: 507-223-7179, E-mail: zilkat@cwpanama.net. Juana Vergara and Sócrates Herrera, Instituto de Inmunología, Edificio de Microbiología, Tercer Piso, Facultad de Salud, Universidad del Valle, Sede San Fernando, Cali, Colombia, Telephone: 57-2-558-1931, Fax: 57-2-5570449, E-mail: sherrera@inmuno.org and Malaria Vaccine and Drug Development Center, Carrera 35 No. 4A-53, AA 26020, Cali, Colombia, Telephone: 57-2-558-3937, Fax: 57-2-556-0141. Kenton Kramer and Sandra P. Chang, Department of Tropical Medicine and Medical Microbiology, John A. Burns School of Medicine, University of Hawaii at Manoa, 3675 Kilauea Avenue, Honolulu, HI 96816, Telephone: 808-732-1483, Fax: 808-732-1477, E-mails: sandrac@hawaii.edu and kramer@hawaii.edu.
Acknowledgments: We are indebted to the patients of Buenaventura for their participation in this study. Special thanks are extended to Diana Jurado for laboratory support. Part of the study was developed in the facilities of the Tropical Medicine Research Center in Colombia (National Institute of Allergy and Infectious Diseases/Tropical Medicine Research Centers contract no. AI-49486-02). We also thank Dr. Benjamin Vine for helpful technical advice, Dr. William Weidanz for providing laboratory supplies, and Drs. Shannon Bennett and Terry Lyttle for advice on data analysis.
Financial support: This study was supported in part by a Fulbright Research Grant and a Gorgas Memorial grant.
REFERENCES
- 1↑
Holder AA, 1988. The precursor to major merozoite surface antigens: structure and role in immunity. Prog Allergy 41 :72–97.
- 2↑
Tanabe K, Mackay M, Goman M, Scaife JG, 1987. Allelic dimorphism in a surface antigen gene of the malaria parasite Plasmodium falciparum.J Mol Biol 195 :273–287.
- 3↑
Kemp DJ, Cowman AF, Walliker D, 1990. Genetic diversity in Plasmodium falciparum.Adv Parasitol 29 :75–149.
- 4↑
Ferreira MU, Qing L, Zhou M, Masatsugu K, Kaneko O, Van Thien H, Isomura S, Tanabe K, Kawamoto F, 1998. Stable patterns of allelic diversity at the merozoite surface protein-1 locus of Plasmodium falciparum in clinical isolates from southern Vietnam. J Eukaryot Microbiol 45 :131–136.
- 5↑
Ferreira MU, Liu QL, Kimura M, Ndawi BT, Tanabe K, Kawamoto F, 1998. Allelic diversity in the merozoite surface protein-1 and epidemiology of multiple-clone Plasmodium falciparum infections in northern Tanzania. J Parasitol 84 :1286–1289.
- 6↑
Ferreira MU, Liu Q, Kaneko O, Kimura M, Tanabe K, Kimura EA, Katzin AM, Isomura S, Kawamoto F, 1998. Allelic diversity at the merozoite surface protein-1 locus of Plasmodium falciparum in clinical isolates from the southwestern Brazilian Amazon. Am J Trop Med Hyg 59 :474–480.
- 7↑
Conway DJ, Roper C, Odauola AMJ, Arnot DE, Kremsner PG, Grobusch MP, Curtis C, Greenwood BM, 1999. High recombination rate in natural populations of Plasmodiium falciparum.Proc Nat Acad Sci USA 96 :4506–4511.
- 8↑
McBride JS, Newbold CI, Anand R, 1985. Polymorphism of a high molecular weight schizont antigen of human malaria parasite Plasmodium falciparum.J Exp Med 161 :160–180.
- 9↑
Kaneko O, Kimura M, Kawamoto F, Ferreira MU, Tanabe K, 1997. Plasmodium falciparum: allelic variation in the merozoite surface protein-1 in wild isolates from southern Vietnam. Exp Parasitol 86 :45–57.
- 10↑
Qari SH, Shi Y-P, Goldman IF, Nahlen BL, Tibayrenc M, Lal AA, 1998. Predicted and observed alleles of Plasmodium falciparum merozoite surface protein-1 (MSP-1), a potential malaria vaccine antigen. Mol Biochem Parasitol 92 :241–252.
- 11↑
Carrasquilla G, Banguero M, Sanchez P, Carvajal F, Barker RH Jr, Gervais GW, Algarin E, Serrano A, 2000. Epidemiologic tools for malaria surveillance in an urban setting of low endemicity along the Colombian Pacific Coast. Am J Trop Med Hyg 62 :132–137.
- 12
Gonzalez JM, Olano V, Vergara J, Arevalo-Herrera M, Carrasquilla G, Herrera S, Lopez JA, 1997. Unstable, low-level transmission of malaria on the Colombian Pacific Coast. Ann Trop Med Parasitol 91 :349–358.
- 13↑
Mendez F, Carrasquilla G, 1995. Epidemiología de la malaria en el área urbana de Buenaventura: análisis de la ocurrencia en el periodo 1987–1993. Colombia Med 26 :77–85.
- 14↑
Status Report on Malaria Programs in the Americas, (Based on 2001 data). PAHO/HCP/HCT/M217/02. 26th Pan American Sanitary Conference, 54th Session of the Regional Committee, Pan American Health Organization, World Health Organization. September 5, 2002, 10.
- 15↑
Gomez D, Chaparro J, Rubiano C, Orfa RM, Wasserman M, 2002. Genetic diversity of Plasmodium falciparum field samples from isolated Colombian village. Am J Trop Med Hyg 67 :611–616.
- 16↑
Tolle R, Bujard H, Cooper JA, 1995. Plasmodium falciparum: variations within the C-terminal region of merozoite surface antigen-1. Exp Parasitol 68 :470–473.
- 17↑
Kaneko O, Jongwutiwes S, Kimura M, Kanbara H, Ishii A, Tanabe K, 1996. Plasmodium falciparum: variation in block 4 of the precursor to the major merozoite surface proteins in natural populations. Exp Parasitol 84 :92–95.
- 18↑
da Silveira LA, Dorta MI, Kimura E, Katzin AM, Kawamoto F, Tanabe K, Ferreira M, 1999. Allelic diversity and antibody recognition of Plasmodium falciparum merozoite surface protein-1 during hypoendemic malaria transmission in the Brazilian Amazon region. Infect Immun 67 :5906–5916.
- 19↑
Kimbi HK, Tetteh KKA, Polley SD, Conway DJ, 2004. Cross-sectional study of specific antibodies to a polymorphic Plasmodium falciparum antigen and of parasite antigen genotypes in school children on the slope of Mount Cameroon. Trans Rl Soc Trop Med Hyg 98 :284–289.
- 20↑
Conway DJ, Rosario V, Oduola AMJ, Salako LA, Greenwood BM, McBride JS, 1991. Plasmodium falciparum intragenic recombination and nonrandom association between polymorphic domains of the precursor to the major merozoite surface antigens. Exp Parasitol 73 :469–480.
- 21↑
Lee EAM, Flanagan KL, Odihiambo K, Reece WHH, Potter C, Bailey R, Marsh K, Pinder M, Hill AVS, Plebanski M, 2001. Identification of frequenly recognized dimorphic T-cell epitopes in Plasmodium falciparum merozoite surface protein-1 in west and east Africans: Lack of correlation of immune recognition and allelic prevalence. Am J Trop Med Hyg 64 :194–203.
- 22↑
Snewin VA, Herrera M, Sanchez G, Scherf A, Langsley G, Herrera S, 1991. Polymorphism of the alleles of the merozoite surface antigens MSA1 and MSA2 in Plasmodium falciparum wild isolates from Colombia. Mol Biomed Parasitol 49 :265–276.
- 23↑
Montoya L, Maestre A, Carmona J, Lopes D, Do Rosario V, Blair S, 2003. Plasmodium falciparum: diversity studies of isolates from two Colombian regions with different endemicity. Exp Parasitol 104 :14–19.
- 24↑
Ntoumi F, Contamin H, Rogier C, Bonneloy S, Trape JF, Merceteau-Puijalon O, 1995. Age-dependent carriage of multiple Plasmodium falciparum merozoite surface Antigen-2 alleles in asymptomatic malaria infections. Am J Trop Med Hyg 52 :81–88.
- 25↑
Takahata N, Nei M, 1990. Allelic geneology under over-dominant and frequency-dependent selection and polymorphism of major histocompatiblity complex loci. Genetics 124 :967–978.
- 26↑
Hughes AL, 1992. Positive selection and interallelic recombination at the merozoite surface antigen-1 (MSA-1) locus of Plasmodium falciparum.Mol Biol Evol 9 :381–393.
- 27↑
Ferreira MU, Kaneko O, Masatsugu K, Qing L, Kawamoto F, Tanabe K, 1998d. Allelic diversity at the merozoite surface protein-1 (MSP-1) locus in natural Plasmodium falciparum populations: a brief overview. Mem Inst Oswaldo Cruz 93 :631–638.
- 28↑
Ferreira MU, Ribeiro WL, Tonon AP, Kawamoto F, Rich SM, 2003. Sequence diversity and evolution of the malaria vaccine candidate merozoite surface protein-1 (MSP-1) of Plasmodium falciparum.Gene 304 :65–75.