• View in gallery

    Localization of the dengue virus recombinant polypeptides according to their position in the dengue virus type 2 genome, along with results of polypeptide expression and purification. C = capsid; M = membrane; E = envelope; NS = nonstructural.

  • View in gallery

    A, Expression of several dengue virus type 2 (DENV-2) polypeptides induced by isopropyl-β-d-thiogalactoside and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Lane MW, molecular weight standard (Gibco-BRL, Gaithersburg, MD). Non-induced (lanes 1, 3, 5, 7, and 9) and induced (lanes 2, 4, 6, 8, and 10) Escherichia coli cultures containing high-expression recombinant plasmids pD2-3 (E), pD2-7 (NS1), pD2-10 (NS3), pD2-18 (NS5), and pD2-20 (NS5), respectively. Non-induced (lanes 11, 13, 15, 17, and 19) and induced (lanes 12, 14, 16, 18 and 20) E. coli cultures containing moderate-to-low-expression recombinant plasmids pD2-1 (C), pD2-2 (prM), pD2-4 (E), pD2-9 (NS2B), and pD2-19 (NS5), respectively. E = envelope; NS = nonstructural; C = capsid; prM = premembrane. The arrowheads indicate the positions f the induced DENV-2 polypeotides. B, Purification of pD2-3 (E) polypeptide. After SDS-PAGE analysis of expression, purification of hexahistidine-tagged polypeptides was performed by nickel affinity chromatography under denaturing conditions. MW, Molecular weight standard (Gibco-BRL); lane 1, non-induced E. coli culture containing recombinant plasmid pD2-3 (E); lane 2, E. coli induced for one hour with isopropyl-β-d-thiogalactoside (IPTG); lane 3, E. coli induced for three hours with IPTG; lane 4, flow-through; lane 5, wash; lanes 6–13, elutions 1–8.

  • View in gallery

    Western blot analysis of sera from representative patients positive for infection with dengue virus, A, Dengue patient number 62871. MW, molecular weight standard (Gibco-BRL, Gaithersburg, MD); lane 1, pD2-3; lane 2, pD2-7; lane 3, pD2-10; lane 4, pD2-20, lane 5, purified E protein; lane 6, purified NS1 protein; lane 7, bovine serum albumin; lane 8, Escherichia coli M15 lysate. E = envelope; NS = nonstructural. B, Dengue patient number 63277. MW, molecular weight standard (Gibco-BRL); lane 1, pD2-3; lane 2, pD2-7; lane 3, pD2-20; lane 4, purified E protein; lane 5, purified NS1 protein; lane 6, bovine serum albumin; lane 7, E. coli M15 lysate; lane 8, purified E protein. Values on the left side of each blot are in kilodaltons.

  • View in gallery

    IgG antibody response in dengue patients and control groups to the recombinant polypeptide pD2-3 as determined by an enzyme-linked immunosorbent assay. Absorbance (optical density [OD] at 405 nm) values are shown for reactions with serum samples from DENV IgM- and IgG-positive patients (Group A), from acute and convalescent (Conv.) paired sera from DENV-1-, DENV-2-, or DENV-3-infected patients (Group B), from healthy individuals (Group C), and from yellow fever (YF)-, measles-, and rubella-infected patients (Groups D, E, and F, respectively). The cut-off value is represented by the dotted horizontal line. pos. = positive.

  • 1

    Heinz FX, Collet MS, Purcell RH, Gould EA, Howard CR, Hounghton M, Moormann RJ, Rice CM, Thiel HJ, 2000. Virus Taxonomy. Family Flaviviridae. Van Regenmortel CM, Fauquet DHL, Bishop EB, Cartens MK, Lemon SM, Maniloff MA, Mayo DJ, Pringle CR, Wikner RB, eds. Seventh Report of the International Committee on Taxonomy of Virus. San Diego, CA: Academic Press, 859–878.

  • 2

    Lindenbach BD, Rice CM, 2001. Flaviviridae: the viruses and their replication. Knipe DM, Howley PM, eds. Fields Virology. Philadelphia: Lippincott Williams and Wilkins, 991–1041.

  • 3

    Burke DS, Monath TP, 2001. Flaviviruses. Knipe DM, Howley PM, eds. Fields Virology. Philadelphia: Lippincott Williams and Wilkins, 1043–1126.

  • 4

    Gubler DJ, 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol 10 :100–103.

    • Search Google Scholar
    • Export Citation
  • 5

    da Silva JB Jr, Siqueira JB Jr, Coelho GE, Giovanini E, Vilarinhos PTR, Pimenta FG Jr, 2002. Dengue in Brazil: current situation and prevention and control activities. Epidemiol Bull 23 :3–6.

    • Search Google Scholar
    • Export Citation
  • 6

    Mandl CW, Guirakhoo F, Holzman H, Heinz FX, Kunz C, 1989. Antigenic structure of the flavivirus envelope protein E at the molecular level, using tick-born encephalitis virus as a model. J Virol 63 :564–571.

    • Search Google Scholar
    • Export Citation
  • 7

    SeThoe SY, Ng MM, Ling AE, 1999. Retrospective study of Western blot profiles in immune sera of natural dengue virus infections. J Med Virol 57 :322–330.

    • Search Google Scholar
    • Export Citation
  • 8

    Valdes K, Alvarez M, Pupo M, Vazquez S, Rodriguez R, Guzman MG, 2000. Human dengue antibodies against structural and nonstructural proteins. Clin Diagn Lab Immunol 7 :856–857.

    • Search Google Scholar
    • Export Citation
  • 9

    Gibbons RV, Vaughn DW, 2002. Dengue: an escalating problem. BMJ 324 :1563–1566.

  • 10

    Morens DM, 1994. Antibody-dependent enhancement of infection and the pathogenesis of viral disease. Clin Infect Dis 19 :500–512.

  • 11

    Halstead SB, 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239 :476–481.

  • 12

    Gubler DJ, 1998. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11 :480–496.

  • 13

    WHO, 1997. Dengue Haemorrhagic Dever: Diagnosis, Treatment, Prevention and Control. Geneva: World Health Organization.

  • 14

    Vorndam AV, Kuno G, 1997. Laboratory diagnosis of dengue virus infection. Gubler DJ, Kuno G, eds. Dengue and Dengue Hemorrhagic Fever. New York: CAB International, 313–333.

  • 15

    Kuno G, Cropp CB, Wong-Lee J, Gubler DJ, 1998. Evaluation of an IgM immunoblot kit for dengue diagnosis. Am J Trop Med Hyg 59 :757–762.

  • 16

    Sang CT, Hoon LS, Cuzzubbo A, Devine P, 1998. Clinical evaluation of a rapid immunochromatographic test for the diagnosis of dengue virus infection. Clin Diagn Lab Immunol 5 :407–409.

    • Search Google Scholar
    • Export Citation
  • 17

    Palmer CJ, King SD, Cuadrado RR, Perez E, Baum M, Ager AL, 1999. Evaluation of the MRL diagnostics dengue fever virus IgM capture ELISA and the PanBio rapid immunochromatographic test for diagnosis of dengue fever in Jamaica. J Clin Microbiol 37 :1600–1601.

    • Search Google Scholar
    • Export Citation
  • 18

    Vaughn DW, Nisalak A, Solomon T, Kalayanarooj S, Nguyen MD, Kneen R, Cuzzubbo A, Devine PL, 1999. Rapid serologic diagnosis of dengue virus infection using a commercial capture ELISA that distinguishes primary and secondary infections. Am J Trop Med Hyg 60 :693–698.

    • Search Google Scholar
    • Export Citation
  • 19

    Lam KS, Ew CL, Mitchell JL, Cuzzubbo AJ, Devine PL, 2000. Evaluation of a capture screening enzyme-linked immunosorbent assay for combined determination of immunoglobulin M and G antibodies produced during dengue infection. Clin Diagn Lab Immunol 7 :850–852.

    • Search Google Scholar
    • Export Citation
  • 20

    Wu SJ, Paxton H, Hanson B, Kung CG, Chen TB, Rossi C, Vaughn DW, Murphy GS, Hayes CG, 2000. Comparison of two rapid diagnostic assays for detection of immunoglobulin M antibodies to dengue virus. Clin Diagn Lab Immunol 7 :106–110.

    • Search Google Scholar
    • Export Citation
  • 21

    Igarashi A, 1978. Isolation of a Singh’s Aedes albopictus cell clone sensitive to dengue and chikungunya viruses. J Gen Virol 40 :531–544.

    • Search Google Scholar
    • Export Citation
  • 22

    Gubler DJ, Kuno G, Sather GE, Velez M, Oliver A, 1984. Mosquito cell cultures and specific monoclonal antibodies in surveillance for dengue viruses. Am J Trop Med Hyg 33 :158–165.

    • Search Google Scholar
    • Export Citation
  • 23

    dos Santos FB, Miagostovich MP, Nogueira RM, Edgil D, Schatzmayr HG, Riley LW, Harris E, 2002. Complete nucleotide sequence analysis of a Brazilian dengue virus type 2 strain. Mem Inst Oswaldo Cruz 97 :991–995.

    • Search Google Scholar
    • Export Citation
  • 24

    Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV, 1992. Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 30 :545–551.

    • Search Google Scholar
    • Export Citation
  • 25

    Nogueira RM, Miagostovich MP, Lampe E, Souza RW, Zagne SM, Schatzmayr HG, 1993. Dengue epidemic in the state of Rio de Janeiro, Brazil, 1990-1: co-circulation of dengue 1 and dengue 2 serotypes. Epidemiol Infect 111 :163–170.

    • Search Google Scholar
    • Export Citation
  • 26

    Miagostovich MP, Nogueira RM, dos Santos FB, Schatzmayr HG, Araujo ES, Vorndam V, 1999. Evaluation of an IgG enzyme-linked immunosorbent assay for dengue diagnosis. J Clin Virol 14 :183–189.

    • Search Google Scholar
    • Export Citation
  • 27

    Harris E, Roberts TG, Smith L, Selle J, Kramer LD, Valle S, Sandoval E, Balmaseda A, 1998. Typing of dengue viruses in clinical specimens and mosquitoes by singletube multiplex reverse transcriptase PCR. J Clin Microbiol 36 :2634–2639.

    • Search Google Scholar
    • Export Citation
  • 28

    Laemmli UK, 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 :680–685.

  • 29

    Mason PW, Zugel MU, Semproni AR, Fournier MJ, Mason TL, 1990. The antigenic structure of dengue type 1 virus envelope and NS1 proteins expressed in Escherichia coli.J Gen Virol 71 :2107–2114.

    • Search Google Scholar
    • Export Citation
  • 30

    Fonseca BAL, Khoshnood K, Shope RE, Mason PW, 1991. Flavivirus, type-specific antigens produced from fusions of a portion of the E protein gene with the Escherichia coli trpE gene. Am J Trop Med Hyg 44 :500–508.

    • Search Google Scholar
    • Export Citation
  • 31

    Megret F, Hugnot JP, Falconar A, Gentry MK, Morens DM, Murray JM, Schlesinger JJ, Wright PJ, Young P, van Regenmortel MH, Deubel V, 1992. Use of recombinant fusion proteins and monoclonal antibodies to define linear and discontinuous antigenic sites on the dengue virus envelope glycoprotein. Virology 187 :480–491.

    • Search Google Scholar
    • Export Citation
  • 32

    Trirawatanapong T, Chandran B, Putnak R, Padmanabhan R, 1992. Mapping of a region of dengue virus type-2 glycoprotein required for binding by a neutralizing monoclonal antibody. Gene 116 :139–150.

    • Search Google Scholar
    • Export Citation
  • 33

    Srivastava AK, Putnak JR, Warren RL, Hoke CH Jr, 1995. Mice immunized with a dengue type 2 virus E and NS1 fusion protein made in Escherichia coli are protected against lethal dengue virus infection. Vaccine 13 :1251–1258.

    • Search Google Scholar
    • Export Citation
  • 34

    Sugrue RJ, Cui T, Xu Q, Fu J, Chan YC, 1997. The production of recombinant dengue virus E protein using Escherichia coli and Pichia pastoris.J Virol Methods 69 :159–169.

    • Search Google Scholar
    • Export Citation
  • 35

    Simmons M, Porter KR, Escamilla J, Graham R, Watts DM, Eckels KH, Hayes CG, 1998. Evaluation of recombinant dengue viral envelope B domain protein antigens for the detection of dengue complex-specific antibodies. Am J Trop Med Hyg 58 :144–151.

    • Search Google Scholar
    • Export Citation
  • 36

    Staropoli I, Frenkiel MP, Megret F, Deubel V, 1997. Affinity-purified dengue-2 virus envelope glycoprotein induces neutralizing antibodies and protective immunity in mice. Vaccine 15 :1946–1954.

    • Search Google Scholar
    • Export Citation
  • 37

    Kelly EP, Greene JJ, King AD, Innis BL, 2000. Purified dengue 2 virus envelope glycoprotein aggregates produced by baculovirus are immunogenic in mice. Vaccine 18 :2549–2559.

    • Search Google Scholar
    • Export Citation
  • 38

    Garcia G, Vaughn DW, DelAngel RM, 1997. Recognition of synthetic oligopeptides from nonstructural proteins NS1 and NS3 of dengue-4 virus by sera from dengue virus-infected children. Am J Trop Med Hyg 56 :466–470.

    • Search Google Scholar
    • Export Citation
  • 39

    Cuzzubbo AJ, Endy TP, Nisalak A, Kalayanarooj S, Vaughn DW, Ogata SA, Clements DE, Devine P, 2001. Use of recombinant envelope proteins for serological diagnosis of dengue virus infection in an immunochromatographic assay. Clin Di-agn Lab Immunol 8 :1150–1155.

    • Search Google Scholar
    • Export Citation
  • 40

    Wu HC, Huang YL, Chao TT, Jan JT, Huang JL, Chiang HY, King CC, Shaio MF, 2001. Identification of B-cell epitope of dengue virus type 1 and its application in diagnosis of patients. J Clin Microbiol 39 :977–982.

    • Search Google Scholar
    • Export Citation
  • 41

    Huang JL, Huang JH, Shyu RH, Teng CW, Lin YL, Kuo MD, Yao CW, Shaio MF, 2001. High-level expression of recombinant dengue viral NS-1 protein and its potential use as a diagnostic antigen. J Med Virol 65 :553–560.

    • Search Google Scholar
    • Export Citation
  • 42

    Ludolfs D, Schilling S, Altenschimidt J, Schmitz H, 2002. Serological differentiation of infections with dengue virus serotypes 1 to 4 by using recombinant antigens. J Clin Microbiol 40 :4317–4320.

    • Search Google Scholar
    • Export Citation
  • 43

    Makino Y, Tadano M, Saito M, Maneekarn N, Sittisombut N, Sirisanthana V, Poneprasert B, Fukunaga T, 1994. Studies on serological cross-reaction in sequential flavivirus infections. Microbiol Immunol 38 :951–955.

    • Search Google Scholar
    • Export Citation
  • 44

    Calisher CH, Karabatsos N, Dalrymple JM, Shope RE, Porterfield JS, Westaway EG, Brandt WE, 1989. Antigenic relationships between flaviviruses as determined by cross- neutralization tests with polyclonal antisera. J Gen Virol 70 :37–43.

    • Search Google Scholar
    • Export Citation
 
 
 

 

 
 
 

 

 

 

 

 

 

ANALYSIS OF RECOMBINANT DENGUE VIRUS POLYPEPTIDES FOR DENGUE DIAGNOSIS AND EVALUATION OF THE HUMORAL IMMUNE RESPONSE

View More View Less
  • 1 Departamento de Virologia, Instituto Oswaldo Cruz, Rio de Janeiro, Brazil; Division of Infectious Diseases, School of Public Health, University of California, Berkeley, California

Dengue is a serious cause of morbidity and mortality in tropical areas worldwide. We cloned and expressed recombinant polypeptides spanning the entire genome of a Brazilian dengue virus type 2 (DENV-2) strain in contiguous segments to generate antigens for dengue diagnosis and evaluation of the human humoral immune response. When analyzed by Western blot and an enzyme-linked immunosorbent assay (ELISA) using human sera, the most reactive polypeptide (pD2-3(E)) was located in the N-terminal portion of the envelope protein. The sensitivity of an IgG-ELISA using pD2-3(E) versus mouse brain antigen was 100% with convalescent sera and 79% with acute sera, with a specificity of 100%. Sera from patients infected with other DENV serotypes recognized pD2-3(E) equally well, whereas sera positive for yellow fever, rubella, and measles showed little or no reactivity. Using this novel approach, we identified a candidate antigen to facilitate diagnosis of DENV infections and observed a surprising variability in antibody patterns in the clinical response to DENV infections.

INTRODUCTION

Dengue virus (DENV) is a mosquito-borne flavivirus that is responsible for a major, rapidly expanding public health problem in many areas of the world, particularly in south/southeast Asia and Central and South America. The four serotypes (DENV-1, DENV-2, DENV-3, and DENV-4) are closed related yet antigenically distinct1,2 and resemble other flaviviruses such as yellow fever virus, West Nile virus, St. Louis encephalitis virus, and Japanese encephalitis virus. Infection with DENV causes a spectrum of clinical disease ranging from an acute debilitating, self-limited febrile illness, dengue fever (DF), to a life-threatening syndrome, dengue hemorrhagic fever (DHF). Approximately 50 million cases of DF and more than 250,000 cases of DHF occur annually.3 The risk of DHF is increased when dengue is hyperendemic, with the simultaneous circulation of multiple DENV serotypes within a population. Furthermore, the incidence and geographic distribution of dengue is growing alarmingly.4 In Brazil, dengue epidemics have been occurring annually since 1986, with more than two million cases reported, resulting from DENV-1 and/or DENV-2, and most recently, DENV-3 epidemics.5

The flaviviruses contain a positive-sense RNA genome that is translated as a single polyprotein and post-translationally cleaved into three structural proteins, capsid (C), premembrane (prM), and envelope (E), and seven nonstructural proteins, NS1, NS2A, NS2B, NS3, NS4A, NS4B, and NS5. The RNA genome is packaged in an icosahedral capsid, and the nucleocapsid is surrounded by a lipid bilayer containing the E and M proteins.2 The E protein is considered to be the immunodominant protein,6 but some studies have shown that in natural DENV infections, C-prM and prM as well as E are immunogenic and elicit long-lasting antibodies.7 The presence of antibodies against nonstructural proteins has also been demonstrated, Valdes and others8 found that antibodies to NS1 and NS3 were detected mainly in secondary cases while antibodies to E and NS5 were consistently detected in both primary and secondary cases.

Both primary and secondary DENV infections result in a spectrum of clinical disease, including asymptomatic infection, nonspecific febrile illness, mild or debilitating classic dengue fever with or without hemorrhagic manifestations, DHF, and dengue shock syndrome.9 These varied clinical manifestations may be influenced by a particular pattern of humoral or cell-mediated immune response by the host. The presence of antibodies against one serotype correlates with protection against another infection with the same serotype, but is thought to increase the risk of DHF upon infection with a different serotype.10,11 In this study, we generated recombinant polypeptides spanning the entire DENV-2 genome and analyzed the pattern of humoral immune response using DENV-positive sera from Brazil.

While dengue can be diagnosed in the acute phase by detection of the virus via virus isolation or a reverse transcription-polymerase chain reaction (RT-PCR), most routine diagnosis relies on serologic methods.12 The hemagglutination inhibition assay is the reference standard, but is cumbersome and labor-intensive.13 The most commonly used diagnostic assay is the IgM enzyme-linked immunosorbent assay (ELISA); IgG-ELISAs are also useful for diagnosis and determination of immune status (i.e., primary versus secondary infection).14 Recently, other immunoassays for the diagnosis of DENV infections have become commercially available, including dipsticks, enzyme immunoassays, immunochromatographic cards, and dot-blot assays.15–20

Dengue diagnosis in many endemic countries is hindered by the high cost of commercial diagnostic kits and inaccessibility of reagents. In-house ELISAs require viral antigen, which is produced in limited quantities in cell culture or in suckling mouse brain, but is insufficient for the large-scale serologic screening sometimes necessitated by the epidemic spread of dengue. The use of recombinant antigen eliminates the problems associated with the standardization of DENV antigen prepared in mouse brain or cell culture and avoids the laborious procedures associated with these methods. Here, we have analyzed the human humoral immune response to recombinant polypeptides spanning the entire DENV-2 genome using DENV-positive serum samples from Brazil and have identified a candidate diagnostic antigen.

MATERIALS AND METHODS

Virus strain and clinical specimens.

The DENV-2 strain BR64022/98 used in this study was obtained from the collection of the Flavivirus Laboratory, Department of Virology, Oswaldo Cruz Institute, FIOCRUZ (Rio de Janeiro, Brazil). The strain was isolated in 1998 from the serum of a patient with DF by inoculation into the Aedes albopictus C6/36 cell line21 and was identified by immunofluorescence using type-specific monoclonal antibodies.22 It belongs to the “Jamaica” genotype, as determined by alignment of the full-length sequence.23 The serum samples used in the study were obtained from the collection of the Flavivirus Laboratory, Department of Virology, Oswaldo Cruz Institute, FIOCRUZ (Rio de Janeiro, Brazil). Cases were confirmed as DENV positive by virus isolation,21 RT-PCR,24 IgM antigen capture ELISA,25 and/or IgG-ELISA.26 Six groups of sera were used. Group A was composed of a panel of DENV IgM-positive serum samples (n = 16) with IgG titers ranging from 1:640 to 1:655,360, as determined by a standard IgG-ELISA. Group B was composed of acute and convalescent paired sera from 10 patients (n = 20) and a single sample (n = 1) that were DENV antibody positive (IgM and/or IgG) and from which DENV-1, DENV-2, or DENV-3 had been isolated. Group C was composed of serum samples (n = 24) that were shown to be negative for IgM and IgG antibodies to DENV by a standard IgG-ELISA and an IgM antigen capture ELISA using mouse brain–derived dengue viral antigen and virus isolation. Group D was composed of serum samples (n = 12) that had been previously shown to be positive for IgM antibody to yellow fever virus and negative for IgM antibody to DENV by the methods described earlier and serum samples (n = 10) from individuals vaccinated against yellow fever. Group E was composed of serum samples (n = 10) from patients positive for measles. Group F was composed of serum samples (n = 10) from patients positive for rubella. The virus strains and clinical specimens were used as anonymous samples taken from specimens that had been previously collected by the Brazilian Ministry of Health.

Primer design.

Synthetic oligonucleotide primer pairs were designed to amplify overlapping fragments of approximately 500 base pairs spanning the complete DENV-2 genome.23 Oligonucleotide primer sequences and thermocycling conditions used to amplify DENV-2 fragments are shown in Table 1. To design the primers, full-length DENV nucleotide sequences from strains Jamaica 1409 (1983) accession number M20558, New Guinea C (1944) #AF038403, Thailand 16681 (1964) #U87411, and Thailand K10010 (1994) #AF100460 were retrieved from the National Center for Bio-technology Information (Bethesda, MD) database and were aligned using GeneJockey Software (Biosoft, Inc., Ferguson, MO).

Extraction of RNA and RT-PCR amplification.

Viral RNA was extracted from the supernatant of infected cells according to the method of Harris and others.27 The fragments were amplified in an RT-PCR mixture that contained 50 mM KCl, 10 mM Tris (pH 8,5), 0.1% Triton X-100, 0.01% gelatin, each of the four deoxynucleotide triphosphates at a concentration of 200 μM, 1.5 mM MgCl2, 5 mM dithiotreitol, primers at a final concentration of 10 μM, 0.025 units of Rous-associated virus 2 transcriptase (Amersham Corporation, Arlington Heights, VA) per microliter of reaction and 0.025 units of Taq DNA polymerase (AmpliTaq; Perkin-Elmer Corporation, Foster City, CA) per microliter of reaction. Five microliters of the extracted RNA were reverse transcribed at 42°C for 60 minutes, followed directly by 40 cycles of amplification consisting of 94°C for 30 seconds, annealing at 60-65°C for one minute, and 72°C for two minutes, and a final extension at 72°C for 10 minutes. Amplification was conducted using a Model 2400 thermal cycler (Perkin-Elmer, Norwalk, CT) or PTC-200-60 thermo cycler (MJ Research, Inc., Water-town, MA).

Construction of plasmids expressing DENV-2 polypeptides.

To express DENV-2 recombinant polypeptides, the DNA fragments amplified by RT-PCR were cloned into TA vector pCR 2.1 (Invitrogen, Carlsbad, CA) according to the manufacturer’s instructions. The inserts were then subcloned into expression vectors pQE30, 31, and 32 (QiaExpressionist; Qiagen, Valencia, CA) in frame with the hexahistidine tag of the vector. After verification by sequencing using the BigDye Terminator Cycle Sequencing kit under conditions recommended by the manufacturer (Applied Biosystems, Foster City, CA), the resulting plasmids were transformed intoEscherichia coli M15 (pRep4) (QiaExpressionist; Qiagen) for the expression of the recombinant polypeptides.

Sequencing of recombinant polypeptides clones.

Plasmids containing the recombinant DENV polypeptides were sequenced in both directions using the BigDye Terminator Cycle Sequencing Ready Reaction kit (Perkin-Elmer Applied Biosystems, Foster City, CA), 3.2 pmol of primers T7 (AAT-ACGACTCACTATAG) and M13 Reverse (AACAGC-TATGACCATG) combined with 0.5 μg of plasmid DNA. Twenty-five cycles were performed at 96°C for 30 seconds, 50°C for one minute, and 60°C for four minutes, as recommended by the manufacturer. After purification, the DNA was dried in a vacuum centrifuge, resuspended in 20 μL of template suppression reagent, heated for two minutes at 95°C, and kept on ice until 10 μL was loaded on the Applied Biosystems Prism 310 sequencer using performance-optimized polymer 6 (Perkin-Elmer, Applied Biosystems).

Expression of recombinant polypeptides in E. coli.

To express the recombinant polypeptides, we grew a single colony of E. coli M15 (pREP4) containing the indicated plasmid in Luria-Bertania medium in the presence of 100 μg/mL of ampicillin and 25 μg/mL of kanamycin overnight at 37°C and 225 rpm. The cultures were diluted 1:50 in super broth medium (25 grams of tryptone, 15 grams of yeast extract, 5 grams of NaCl, and 900 mL of double-distilled water) with antibiotics (100 μg/mL of ampicillin and 25 μg/mL of kanamycin) and grown at 37°C and 225 rpm until they reached the optimum absorbance at an optical density (OD) at 600 nm, at which point they were induced by the addition of 1 mM isopropyl-β-d-thiogalactoside. To analyze the expression of DENV recombinant polypeptides, samples were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12% polyacrylamide gel according to the method of Laemmli.28

Purification of expressing recombinant polypeptides.

After analysis of expression by SDS-PAGE, purification of hexahistidine-tagged polypeptides was performed by nickel affinity chromatography under denaturing conditions using Ni-NTA agarose (Qiagen). After expression, 100–800 mL of cell suspension were harvested by centrifugation at 4,000 × g for 20 minutes, and the pellet was stored at −70°C until use. The pellet was lysed by the addition of lysis buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 8.0) with 1 mM phenylmethylsulfonyl fluoride and sonicated at 80 watts with 20 15-second bursts. The lysate was centrifuged at 10,000 × g for 10 minutes at 4°C to pellet cellular debris. Ni-NTA aga-rose was added to the clarified lysate, and the suspension was mixed for one hour at 4°C. After incubation, the suspension was loaded onto an Econo column (Bio-Rad Laboratories, Hercules, CA), and the bound polypeptide was washed three times with wash buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 6.3) and eluted with elution buffer (100 mM NaH2PO4, 10 mM Tris-HCl, 8 M urea, pH 8.0, 500 mM imidazole). The eluted polypeptides were dialyzed in 1× phosphate-buffered saline (PBS), pH 7.4, and the protein concentration was measured using the Bradford assay (Bio-Rad Laboratories).

Immunoblot analysis.

The DENV-2 recombinant polypeptides expressed in E. coli were analyzed for their reactivity to antibodies to DENV present in human sera by Western blot. Briefly, 2 μg/mL of each purified polypeptide was denatured for five minutes, subjected to electrophoresis on a 12% SDS-polyacrylamide gel, and transferred to a 0.45-μm pore size nitrocellulose membrane (Bio-Rad Laboratories) for 30 minutes at 100 volts in transblot buffer (20 mM Tris, 150 mM glycine). The membrane was washed three times in TBS buffer (10 mM Tris-HCl, pH 8.0, 150 mM NaCl) for five minutes at room temperature and then blocked overnight with 3% bovine serum albumin in TBS buffer at 4°C. On the following day, the membrane was washed twice with TBS buffer and once with TBS buffer plus 0.05% Tween 20. Serum samples were diluted 1:100 with blocking buffer and incubated with membranes for one hour at room temperature. After incubation, membranes were washed as described earlier, and horseradish peroxidase-conjugated rabbit antihuman IgG + IgM + IgA diluted 1:1,000 was added and allowed to incubate for one hour at room temperature. The washing steps were repeated, luminol (Sigma Chemical Co., St. Louis, MO) substrate was added, and the membrane was exposed to x-ray film.

Enzyme-linked immunosorbent assay.

A standard IgG-ELISA was carried out according to the method described by Miagostovich and others.26 For the IgG-ELISA based on the recombinant polypeptides, 96-well microtiter plates (Immulon; Dynatech Industries, Inc., Chantilly, VA) were washed three times in 1× PBS, pH 7.4, and then coated with 75 μL of pD2-3 recombinant polypeptide (0.5 μg/well) diluted in 1× PBS, pH 7.4. The plates were incubated overnight at 4°C. Subsequently, the plates were washed six times in 1× PBS, pH 7.4, blocked in blocking buffer (PBS, pH 7.4, 3.5% normal goat serum, 0.05% Tween 20) and incubated for one hour at 37°C. The washing step was repeated as described earlier and 100 μL of serum diluted 1:40 in dilution buffer (PBS, pH 7.4, 1.5% non-fat dry milk was added. For the sensitivity analysis using other recombinant polypeptides, a two-fold serial dilution of the sera was performed. Plates were incubated for one hour at 37°C and then washed six times in 1× PBS, pH 7.4. Forty microliters of horseradish peroxidase-conjugated anti-human IgG (Sigma Chemical Co.) diluted 1:2,000 in dilution buffer was added. After incubation for one hour at 37°C, the plates were washed six times with 1× PBS, pH 7.4, and 100 μL/well of 2,2-azino-di-3-ethyl-benzthiazoline sulfonate (ABTS) substrate solution (Kirkergaard and Perry Laboratories, Gaithersburg, MD) was added. The plates were incubated for 30 minutes at room temperature for color development, and the OD was measured at 405 nm. Each serum sample was tested in duplicated wells that were uncoated or coated with the recombinant polypeptide, and negative and positive control sera were included in each plate. The cut-off OD value for seropositivity was set at ≥ 0.20 since the mean adjusted OD + three standard deviations for the negative control sera was consistently below this value.

RESULTS

Cloning and sequencing of DENV-2 recombinant polypeptides.

Primers were designed to amplify ~500-basepair fragments in contiguous overlapping segments across the entire sequence of the BR64022/98 DENV-2 genome (10.7 kb). The amplified fragments are shown schematically in Figure 1. The fragments were cloned into the pCR2.1 vector and sequenced in both directions.23

Expression and purification of recombinant polypep-tides.

To express the BR64022/98 recombinant polypeptides, the cloned DNA fragments were transferred into pQE expression vectors, and in-frame insertion of the cloned DENV-2 DNA was confirmed by sequencing. To assess the toxicity of the expressed polypeptide, cell growth was monitored via measurement of the OD at 600 nm before and after induction. A time-course analysis of the polypeptide expression was performed as well to optimize the expression of the constructs. Twelve (60%) of 20 cloned DNA sequences could be expressed with the E. coli inducible system. Six of the constructs, pD2-3 (E), pD2-7 (NS1), pD2-10 (NS3), pD2-13 (NS3/4A), pD2-18 (NS5), and pD2-20 (NS5), demonstrated high levels of expression (Figure 2A, lanes 2, 4, 6, 8, 10, and 20) and were purified by nickel-affinity chromatography (Figure 2B). Others, such as pD2-1 (C), pD2-2 (prM), pD2-4 (E), pD2-9 (NS2B), pD2-11 (NS3), and pD2-19 (NS5), did not yield high enough expression levels for purification (Figure 2A, lanes 12, 14, 16, and 18). The size of the recombinant polypeptides obtained was between 20 and 25 kD, as predicted from the size of the cloned DNA fragments. Expression was not observed from the clones pD2-5 (E), pD2-6 (NS1), pD2-8 (NS2A), pD2-12 (NS3), pD2-14 (NS4A/4B), pD2-15 (NS4B), pD2-16 (NS5), and pD2-17 (NS5).

Human humoral response to DENV-2 polypeptides.

The reactivity of the six purified recombinant polypeptides was further evaluated by Western blot and IgG-ELISAs with sera obtained from Brazilian patients with laboratory-confirmed DENV infections. A total of sixteen serum samples (Group A) with IgG titers ranging from 1:640 to 1:655,360 were tested (Table 2). Western blot analysis showed that 11 (69%) of these samples recognized the pD2-3 (E) recombinant polypeptide, one serum specimen recognized pD2-7 (NS1), and one reacted with pD2-18 (NS5). The Western blot in Figure 3 shows the reactivity of sera from patients positive for DENV infection to the pD2-3 (E) recombinant polypeptide. The same panel of sera (Group A) was tested by IgG-ELISA, and 15 (94%) of the 16 sera recognized pD2-3. When the reactivity of the samples towards each of the other recombinant polypeptides was evaluated by IgG-ELISA individually, 6 (40%) of 15 reacted with pD2-7 (NS1) and pD2-20 (NS5), 4 (26%) of 15 reacted with pD2-10 (NS3), and 3 (20%) of 15 reacted with pD2-13 (NS3/4A). Seven different patterns of humoral immune response towards the different purified polypeptides were observed.

Since pD2-3 (E) was the most reactive polypeptide by both methods used, combinations of the different polypeptides with pD2-3 (E) were also tested by IgG-ELISA to assess any increase in sensitivity of detection as measured by the titer obtained. No significant difference was observed in the reactivity of the serum samples tested towards pD2-3 (E) alone versus pD2-3 (E) mixed with the other purified recombinant polypeptides: (pD2-7 (NS1), pD2-10 (NS3), pD2-13 (NS3/4A), and pD2-20 (N5).

Evaluation of the humoral immune response to pD2-3 (E).

Because of its highly immunogenic nature, pD2-3 (E) was further evaluated in both a native (IgG-ELISA) and a denatured form (Western blot analysis). To investigate the serotype specificity of pD2-3 (E), we analyzed 10 paired sera and one single serum sample in which the serotype had been previously identified by virus isolation (Group B). It was found that sera from patients infected with any of the three serotypes (DENV-1, DENV-2, and DENV-3) recognized pD2-3 recombinant polypeptide by both IgG-ELISA and Western blot (Table 3). Western blotting showed that pD2-3 detected 45% (9 of 20) and 80% (12 of 15) of the infections in acute and convalescent sera, respectively, when we analyzed Groups A and B (Tables 2 and 3). Compared with a standard IgG-ELISA using DENV antigen prepared in suckling mouse brain, the overall sensitivity of IgG-ELISA using pD2-3 for antigen in those Groups was 79% (15 of 19) with acute sera and 100% (15 of 15) with convalescent sera (Tables 2 and 3).

Twenty-four sera (Group C) previously confirmed to be negative for DENV infection were analyzed and none of them reacted to pD2-3 (E) by either the Western blot or IgG-ELISA (specificity =100%). To assess potential cross-reactivity with other flavivirus and patients with other exanthematic diseases, we analyzed 12 sera containing antibodies induced by exposure to yellow fever virus (Group D), 10 sera from individuals with measles (Group E), and 10 sera from patients with rubella (Group F). Some reactivity to pD2-3 (E) by the IgG-ELISA was observed when we tested the yellow fever cases; however, no reactivity was observed with sera positive for measles or rubella (Figure 4).

DISCUSSION

As a novel approach to generate recombinant DENV antigen, we evaluated the human humoral response to recombinant DENV polypeptides with respect to antigen source, infecting serotype, and protein conformation (denatured versus native). We have identified a minimal highly immunogenic polypeptide that can be expressed in large quantities in E. coli and easily purified.

We screened polypeptides from the entire DENV-2 genome for reactivity against human DENV-positive sera and found that the most immunoreactive polypeptide was a fragment in the N-terminal of the E protein (pD2-3 (E)). This is not surprising since many viruses induce the strongest immune response to structural proteins expressed on the surface of the virion. The DENV E protein is the major surface protein, and epitopes that induce protective antibodies are located within this protein.6 We also found that several but not all sera recognized epitopes in NS1 and NS5; this is consistent with reports that antibodies to NS1, NS3, and NS5 could be detected in sera from patients infected with DENV.8

The DENV antigen is often the limiting reagent in DENV diagnostic assays, and its large-scale preparation is hindered by the cumbersome and expensive methods involving suckling mouse brain or cell culture. Additionally, these methods result in crude extracts of variable quality with numerous nonspecific antigens. Cloning and expression of viral genes provides a straightforward alternative approach, simplifying purification and large-scale production. Previous studies have demonstrated that the E protein expressed in E. coli contains many of the neutralizing epitopes found in the mature DENV29–32 and can protect mice against lethal challenge with the virus.33 The E protein and its fragments have been expressed using both prokaryotic34,35 and eukaryotic systems.34,36,37 These results suggest that recombinant E polypeptide expressed in E. coli can provide an effective antigen for use as diagnostic reagent (Table 4).35,38–42

A limitation of this study was that not all cloned DENV fragments could be expressed in E. coli. With careful choice of host strain and growth conditions, 60% of our cloned recombinant polypeptides could be expressed. The lack of expression or low levels of expression of the other DNA fragments might be due to the fact that the expressed polypeptides were toxic or unstable; for instance, most of the polypeptides corresponding to the small DENV hydrophobic proteins (NS2A, NS4A, and NS4B) were not expressed in E. coli. Another explanation is that certain expression constructs could not be maintained during cell growth. Six of the polypeptides presented high levels of expression; these were purified, and their reactivity was evaluated against panels of human sera. Importantly, all of the purified polypeptides that were tested did generate a pattern of humoral immune response. Thus, it is likely that if more DENV polypeptides were tested, additional and more complex patterns of antibody response would be observed. Interestingly, differential humoral responses were revealed by the different patterns of recognition of viral proteins epitopes. Such patterns could potentially serve as markers or correlates of clinical manifestations in the current infection or a new infection with another DENV serotype.

In regions where two or more flaviviruses co-circulate, serodiagnosis is difficult due to the high serologic cross-reactivity among different flavivirus,43 even when plaque reduction neutralization tests (PRNTs), are used, which are considered to be the least cross-reactive among the serologic assays.44 Although PRNTs would be the method of choice for type-specific diagnosis, they are so time-consuming, expensive, and labor-intensive that routine use is not feasible in most situations. Thus, another rationale for this study was to attempt to identify a serotype-specific recombinant antigen. Our results demonstrate equal reactivity to pD2-3 (E) with sera infected with the four serotypes. Although we were unable to identify a serotype-specific polypeptide, this recombinant antigen will be very useful as a diagnostic reagent for dengue diagnosis precisely because this polypeptide was recognized by antibodies raised against all the serotypes tested. Some reactivity was obtained with sera containing antibodies to yellow fever virus from positive cases and borderline values or no reactivities were observed in cases from patients vaccinated against yellow fever, attesting to the specificity of the pD2-3 (E) antigen. No reactivity was observed in cases positive for measles and rubella using this recombinant polypeptide.

To evaluate the most immunogenic form of pD2-3 (E), the polypeptide was tested in a native conformation (using the IgG-ELISA) and in denatured form (Western blot). The sensitivity was substantially higher using the IgG-ELISA with the E polypeptide in non-denaturing conditions. Importantly, IgG-ELISA is a rapid, straightforward assay, much more suited for high-throughput processing than the Western blot. Lastly, we observed greater reactivity to pD2-3 (E) with convalescent sera (100% by IgG-ELISA) compared with acute sera (79%). This is to be expected since antibody titers to an infecting agent increase over time, and paired sera including convalescent serum are indicated by standard guidelines for serologic diagnosis.13

The pD2-3 (E) recombinant polypeptide identified in this study was found to be a potentially useful diagnostic antigen that is easy to prepare and suitable for mass production. Since the cost of most commercial kits for dengue diagnosis is prohibitive for many dengue-endemic countries, the in-house production of recombinant polypeptides could provide a safe and valuable resource for DENV serodiagnosis. In addition, we documented a surprising number of different patterns of humoral immune response to the different DENV-2 polypeptides, suggesting that a larger study examining the patterns of response to an array of DENV polypeptides and their correlation with clinical manifestations would be worthwhile.

Table 1

Oligonucleotide primers and thermocycling conditions used for amplification by a reverse transcriptase–polymerase chain reaction

PrimerSequence 5 → 3Genome position*Annealing temperature (1 minute)Recombinant plasmidFragment size (base pairs)
* Genome positions according to the sequence of Jamaican strain 1409/83 (GenBank accession number M20558).
D2-1CAGATCTCTGATGAATAACCAACG87–11062°CpD2-1515
D2-2GGGGACACTTGTACGTGATTGT580–601
D2-3CAATCACGTACAAGTGTCCCCT581–60263°CpD2-2514
D2-4CAGTACTTCCTTAGGGTGGCA1095–1115
D2-5CCTGCCACCCTAAGGAAGTACT1093–111465°CpD2-3492
D2-6GCAGGTCTAGGAACCATTGCCT1564–1585
D2-7GGTTCCTAGAACTGCCRT1571–158860°CpD2-4503
D2-8CGGCTCTACTCCTATGATGAT2068–2088
D2-9GCCGGGACAATTGAAGCTCAA2085–210560°CpD2-5504
D2-10GATYCCACAAATKCCCTCT2592–2573
D2-11GAGGGMATTTGTGGRATCCGCT2575–259661°CpD2-6476
D2-12GAGGCTTTCTCTATCTTCCAT3048–3068
D2-13GCACTCAATGACACATGGA3034–305262°CpD2-7498
D2-14GTTTCGTTCCTACTCGGGTCCT3547–3567
D2-15GACCCGAGTAGGAACGAAACAT3549–357060°CpD2-8518
D2-16GATTGAGACCYTTGATYGTCAATGAT4062–4084
D2-17GCATTGACRATCAARGGTCTCA4060–408161°CpD2-9501
D2-18CTCCATCTTCCAGTTCAGCCTT4564–4585
D2-19GGAAAGGCTGAACTGGAAGATGGA4561–458463°CpD2-10471
D2-20CGATCTCTGGGTTGTCTTCAA5036–5056
D2-21TCGGGGATCCGGCATTGAAGACAACCCAGAGAT5022–505461°CpD2-11501
D2-22AACTGCAGGAACGTTCAGGGATTTCTCT5530–5557
D2-23GAAATCCCTGAACGTTCRTGGA5533–555461°CpD2-12508
D2-24GGTATTCGCCATCAATGGCATGGA6068–6091
D2-25CGTGAAAARGTGGATGCCATTGA6058–608063°CpD2-13522
D2-26GATCCCTCCTGTGACTGTAGCCA6557–6579
D2-27CTGGCTACAGTCACAGGAGGGAT6556–657865°CpD2-14523
D2-28GGGGAACTCCGATGTCCATCTT7081–7102
D2-29CAAAGATGGACATCGGAGT7079–709760°CpD2-15490
D2-30GTCTCTCCTATGTTGCCAGTT7572–7592
D2-31GAACTGGCAACATAGGAGAGA7571–759163°CpD2-16470
D2-32GGACTCTGAGTGTTCGTCCTGCTT8039–8063
D2-33GGACGAACACTCAGAGTCCTTA8044–806563°CpD2-17499
D2-34CCAAGGTTTTGTCAGCAGCCT8545–8565
D2-35CTGCTGACAAAACCTTGGGA8548–856761°CpD2-18507
D2-36CTCTCTGGAGAACCAGTGATCTT9050–9072
D2-37GATCACTGGTTCTCCAGAGAGAA9052–907460°CpD2-19507
D2-38GGTTTCACAACACAATCATCT9555–9575
D2-39GGCCATCAGTGGAGATGATT9543–956260°CpD2-20508
D2-40GTATGGGATTTCCTCCCATGATT10061–10083
Table 2

Analysis of DENV-2 polypeptides by Western blot and IgG ELISA using serum samples with laboratory-confirmed DENV infections (Group A)*

Western blotIgG-ELISAIgG-ELISA
Dengue patientSerum sample (day)IgM-ELISAStandard IgG-ELISA (titer)pD2-3Other polypeptides†
* ELISA = enzyme-linked immunosorbent assay; Pos = positive; Neg = negative; Conv. = convalescent; NS = nonstructural.
† Purified recombinant polypeptides tested: pD2-7 (NS1), pD2-10 (NS3), pD2-13 (NS3/4A), pD2-20 (NS5).
‡ Not available.
§ Not done.
63923−‡Pos1/655,360PosPosNeg
63277Acute (day 7)Pos1/163,840PosPosNeg
62871Conv. (day 8)Pos1/163,840PosPos−§
62680−‡Pos1/163,840PosPospD2-20
61532Acute (day 6)Pos1/163,840PosPosNeg
62281Acute (day 5)Pos1/163,840PosPosNeg
60000Acute (day 7)Pos1/163,840PosPospD2-7
63278Acute (day 3)Pos1/40,960NegNegNeg
63518Conv. (day 9)Pos1/40,960PosPospD2-7; pD2-10; pD2-20
63545Conv. (day 8)Pos1/40,960PosPospD2-7; pD2-10; pD2-13; pD2-20
63925Conv. (day 8)Pos1/40,960PosPosPD2-7; pD2-20
61548Conv. (day 8)Pos1/10,240NegPosNeg
60022Acute (day 7)Pos1/10,240PosPosNeg
61544Acute (day 7)Pos1/2,560NegPospD2-13
60050Acute (day 5)Pos1/640PosPospD2-7; pD2-10; pD2-20
63139Acute (day 3)Pos1/640NegPospD2-7; pD2-10; pD2-13; pD2-20
Table 3

Evaluation of recombinant polypeptide pD2-3 by Western blot and IgG ELISA with acute and convalescent paired sera from patients positive for DENV-1, DENV-2, or DENV-3 infections (Group B)*

Dengue patientInfecting serotypeSerumIgM-ELISAStandard IgG-ELISA (titer)Western blotIgG-ELISA
* ELISA = enzyme-linked immunosorbent assay; DENV = dengue virus; Neg = negative; Pos = positive.
† Day not available.
‡ Not done.
69334DENV-1Acute (day 1)Neg1/160NegPos
70059Convalescent (day 15)Pos1/163,840PosPos
73152DENV-1Acute (day 2)Neg1/2,560NegPos
73472Convalescent (day 46)Pos1/163,840NegPos
72604DENV-1Acute (day 3)Neg1/40NegPos
73170Convalescent (day 17)Pos1/163,840PosPos
72707DENV-1Acute (day 3)Neg1/160NegNeg
73278Convalescent (day 17)Pos1/10,240NegPos
72590DENV-2Acute (day 1)Neg1/160PosNeg
73186Convalescent†Pos1/40,960PosPos
72324DENV-2Acute (day 2)Neg1/640NegPos
72641Convalescent (day 16)Pos1/163,840PosPos
72357DENV-3Acute (day 2)Neg1/160NegPos
72691Convalescent (day 14)Pos1/163,840PosPos
73821DENV-3Acute (day 3)Neg1/2,560PosPos
73889Convalescent (day 14)Pos1/163,840PosPos
74077DENV-3Acute (day 1)Neg1/640PosNeg
74140Convalescent (day 15)Pos1/163,840PosPos
74001DENV-3Acute (day 4)Neg1/160NegPos
74076Convalescent (day 17)Pos1/163,840PosPos
73492DENV-3Acute (day 5)Pos1/163,840Pos−‡
Table 4

Comparison of DENV peptides and recombinant proteins used in assays for the detection of human antibodies to DENV*

Previous studiesAntigen usedAssayCross-reactivitySensitivity (%)Specificity (%)
* DENV = dengue virus; NS = nonstructural; ELISA = enzyme-linked immunosorbent assay; E = envelope; NR = not reported; Rec. = recombinant.
† Immunochromatographic test.
‡ Primary cases and secondary cases, respectively.
§ Acute sera and convalescent sera, respectively.
Garcia and others, 199738DENV-4 NS1 peptidesIgG ELISADENV-1, 2, 3, 4NRNR
DENV-4 NS3 peptidesIgG ELISADENV-1, 3, 4NRNR
Simmons and others, 199835DENV-1, 2, 3 and 4 rec. E proteinIgG ELISADENV-1, 2, 3NRNR
DENV-1, 2, 3 and 4 rec. E proteinIgM ELISADENV-1, 2, 3NRNR
Cuzzubbo and others, 200139DENV-1, 2, 3 and 4 rec. E proteinIgG + IgM ICT†NR9086
Wu and others, 200140DENV-1 NS1 peptideIgG + IgM ELISADENV-195100
Huang and others, 200141DENV-2 rec. NS1 proteinIgG ELISADENV-1, 2, 3, 488, 100‡NR
DENV-2 rec. NS1 proteinIgM ELISADENV-1, 2, 3, 4
Ludolfs and others, 200242DENV-1, 2, 3 and 4 B domain of rec. E proteinImmunoblotNone94 (DENV-1 and 2) 100 (DENV-3 and 4)96.5
This studyDENV-2 rec. polypeptideIgG ELISADENV-1, 2, 379, 100§100
Figure 1.
Figure 1.

Localization of the dengue virus recombinant polypeptides according to their position in the dengue virus type 2 genome, along with results of polypeptide expression and purification. C = capsid; M = membrane; E = envelope; NS = nonstructural.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 71, 2; 10.4269/ajtmh.2004.71.144

Figure 2.
Figure 2.

A, Expression of several dengue virus type 2 (DENV-2) polypeptides induced by isopropyl-β-d-thiogalactoside and analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Lane MW, molecular weight standard (Gibco-BRL, Gaithersburg, MD). Non-induced (lanes 1, 3, 5, 7, and 9) and induced (lanes 2, 4, 6, 8, and 10) Escherichia coli cultures containing high-expression recombinant plasmids pD2-3 (E), pD2-7 (NS1), pD2-10 (NS3), pD2-18 (NS5), and pD2-20 (NS5), respectively. Non-induced (lanes 11, 13, 15, 17, and 19) and induced (lanes 12, 14, 16, 18 and 20) E. coli cultures containing moderate-to-low-expression recombinant plasmids pD2-1 (C), pD2-2 (prM), pD2-4 (E), pD2-9 (NS2B), and pD2-19 (NS5), respectively. E = envelope; NS = nonstructural; C = capsid; prM = premembrane. The arrowheads indicate the positions f the induced DENV-2 polypeotides. B, Purification of pD2-3 (E) polypeptide. After SDS-PAGE analysis of expression, purification of hexahistidine-tagged polypeptides was performed by nickel affinity chromatography under denaturing conditions. MW, Molecular weight standard (Gibco-BRL); lane 1, non-induced E. coli culture containing recombinant plasmid pD2-3 (E); lane 2, E. coli induced for one hour with isopropyl-β-d-thiogalactoside (IPTG); lane 3, E. coli induced for three hours with IPTG; lane 4, flow-through; lane 5, wash; lanes 6–13, elutions 1–8.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 71, 2; 10.4269/ajtmh.2004.71.144

Figure 3.
Figure 3.

Western blot analysis of sera from representative patients positive for infection with dengue virus, A, Dengue patient number 62871. MW, molecular weight standard (Gibco-BRL, Gaithersburg, MD); lane 1, pD2-3; lane 2, pD2-7; lane 3, pD2-10; lane 4, pD2-20, lane 5, purified E protein; lane 6, purified NS1 protein; lane 7, bovine serum albumin; lane 8, Escherichia coli M15 lysate. E = envelope; NS = nonstructural. B, Dengue patient number 63277. MW, molecular weight standard (Gibco-BRL); lane 1, pD2-3; lane 2, pD2-7; lane 3, pD2-20; lane 4, purified E protein; lane 5, purified NS1 protein; lane 6, bovine serum albumin; lane 7, E. coli M15 lysate; lane 8, purified E protein. Values on the left side of each blot are in kilodaltons.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 71, 2; 10.4269/ajtmh.2004.71.144

Figure 4.
Figure 4.

IgG antibody response in dengue patients and control groups to the recombinant polypeptide pD2-3 as determined by an enzyme-linked immunosorbent assay. Absorbance (optical density [OD] at 405 nm) values are shown for reactions with serum samples from DENV IgM- and IgG-positive patients (Group A), from acute and convalescent (Conv.) paired sera from DENV-1-, DENV-2-, or DENV-3-infected patients (Group B), from healthy individuals (Group C), and from yellow fever (YF)-, measles-, and rubella-infected patients (Groups D, E, and F, respectively). The cut-off value is represented by the dotted horizontal line. pos. = positive.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 71, 2; 10.4269/ajtmh.2004.71.144

Authors’ addresses: Flavia Barreto dos Santos, Marize Pereira Miagostovich, Rita Maria Ribeiro Noguiera, and Hermann Gonçalves Schatzmayr, Department of Virology Oswaldo Cruz Institute, FIOCRUZ, Av. Brasil, 4365, Manguinhos, Caixa Postal 926, CEP 21045-900 Rio de Janeiro, Brazil, Telephone: 55-21-2598-4373, Fax: 55-21-2598-4491. Lee W. Riley and Eva Harris, Division of Infectious Diseases, School of Public Health, University of California, 140 Warren Hall, Berkeley, CA 94720-7360, Telephone: 510-642-4845, Fax: 510-642-6350, E-mail: eharris@socrates.berkeley.edu.

Acknowledgments: We are grateful to Brendan Flannery for advice regarding protein expression and purification.

Financial support: This research was supported by Fogarty International Center grant TW 00905. Marize Pereira Miagostovich, Rita Maria Ribeiro Noguiera, and Hermann Gonçalves Schatzmayr were fellows of CNPq (Conselho Nacional de Desenvolvimento Científico e Tecnológico grant 40.0164/98-1).

REFERENCES

  • 1

    Heinz FX, Collet MS, Purcell RH, Gould EA, Howard CR, Hounghton M, Moormann RJ, Rice CM, Thiel HJ, 2000. Virus Taxonomy. Family Flaviviridae. Van Regenmortel CM, Fauquet DHL, Bishop EB, Cartens MK, Lemon SM, Maniloff MA, Mayo DJ, Pringle CR, Wikner RB, eds. Seventh Report of the International Committee on Taxonomy of Virus. San Diego, CA: Academic Press, 859–878.

  • 2

    Lindenbach BD, Rice CM, 2001. Flaviviridae: the viruses and their replication. Knipe DM, Howley PM, eds. Fields Virology. Philadelphia: Lippincott Williams and Wilkins, 991–1041.

  • 3

    Burke DS, Monath TP, 2001. Flaviviruses. Knipe DM, Howley PM, eds. Fields Virology. Philadelphia: Lippincott Williams and Wilkins, 1043–1126.

  • 4

    Gubler DJ, 2002. Epidemic dengue/dengue hemorrhagic fever as a public health, social and economic problem in the 21st century. Trends Microbiol 10 :100–103.

    • Search Google Scholar
    • Export Citation
  • 5

    da Silva JB Jr, Siqueira JB Jr, Coelho GE, Giovanini E, Vilarinhos PTR, Pimenta FG Jr, 2002. Dengue in Brazil: current situation and prevention and control activities. Epidemiol Bull 23 :3–6.

    • Search Google Scholar
    • Export Citation
  • 6

    Mandl CW, Guirakhoo F, Holzman H, Heinz FX, Kunz C, 1989. Antigenic structure of the flavivirus envelope protein E at the molecular level, using tick-born encephalitis virus as a model. J Virol 63 :564–571.

    • Search Google Scholar
    • Export Citation
  • 7

    SeThoe SY, Ng MM, Ling AE, 1999. Retrospective study of Western blot profiles in immune sera of natural dengue virus infections. J Med Virol 57 :322–330.

    • Search Google Scholar
    • Export Citation
  • 8

    Valdes K, Alvarez M, Pupo M, Vazquez S, Rodriguez R, Guzman MG, 2000. Human dengue antibodies against structural and nonstructural proteins. Clin Diagn Lab Immunol 7 :856–857.

    • Search Google Scholar
    • Export Citation
  • 9

    Gibbons RV, Vaughn DW, 2002. Dengue: an escalating problem. BMJ 324 :1563–1566.

  • 10

    Morens DM, 1994. Antibody-dependent enhancement of infection and the pathogenesis of viral disease. Clin Infect Dis 19 :500–512.

  • 11

    Halstead SB, 1988. Pathogenesis of dengue: challenges to molecular biology. Science 239 :476–481.

  • 12

    Gubler DJ, 1998. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11 :480–496.

  • 13

    WHO, 1997. Dengue Haemorrhagic Dever: Diagnosis, Treatment, Prevention and Control. Geneva: World Health Organization.

  • 14

    Vorndam AV, Kuno G, 1997. Laboratory diagnosis of dengue virus infection. Gubler DJ, Kuno G, eds. Dengue and Dengue Hemorrhagic Fever. New York: CAB International, 313–333.

  • 15

    Kuno G, Cropp CB, Wong-Lee J, Gubler DJ, 1998. Evaluation of an IgM immunoblot kit for dengue diagnosis. Am J Trop Med Hyg 59 :757–762.

  • 16

    Sang CT, Hoon LS, Cuzzubbo A, Devine P, 1998. Clinical evaluation of a rapid immunochromatographic test for the diagnosis of dengue virus infection. Clin Diagn Lab Immunol 5 :407–409.

    • Search Google Scholar
    • Export Citation
  • 17

    Palmer CJ, King SD, Cuadrado RR, Perez E, Baum M, Ager AL, 1999. Evaluation of the MRL diagnostics dengue fever virus IgM capture ELISA and the PanBio rapid immunochromatographic test for diagnosis of dengue fever in Jamaica. J Clin Microbiol 37 :1600–1601.

    • Search Google Scholar
    • Export Citation
  • 18

    Vaughn DW, Nisalak A, Solomon T, Kalayanarooj S, Nguyen MD, Kneen R, Cuzzubbo A, Devine PL, 1999. Rapid serologic diagnosis of dengue virus infection using a commercial capture ELISA that distinguishes primary and secondary infections. Am J Trop Med Hyg 60 :693–698.

    • Search Google Scholar
    • Export Citation
  • 19

    Lam KS, Ew CL, Mitchell JL, Cuzzubbo AJ, Devine PL, 2000. Evaluation of a capture screening enzyme-linked immunosorbent assay for combined determination of immunoglobulin M and G antibodies produced during dengue infection. Clin Diagn Lab Immunol 7 :850–852.

    • Search Google Scholar
    • Export Citation
  • 20

    Wu SJ, Paxton H, Hanson B, Kung CG, Chen TB, Rossi C, Vaughn DW, Murphy GS, Hayes CG, 2000. Comparison of two rapid diagnostic assays for detection of immunoglobulin M antibodies to dengue virus. Clin Diagn Lab Immunol 7 :106–110.

    • Search Google Scholar
    • Export Citation
  • 21

    Igarashi A, 1978. Isolation of a Singh’s Aedes albopictus cell clone sensitive to dengue and chikungunya viruses. J Gen Virol 40 :531–544.

    • Search Google Scholar
    • Export Citation
  • 22

    Gubler DJ, Kuno G, Sather GE, Velez M, Oliver A, 1984. Mosquito cell cultures and specific monoclonal antibodies in surveillance for dengue viruses. Am J Trop Med Hyg 33 :158–165.

    • Search Google Scholar
    • Export Citation
  • 23

    dos Santos FB, Miagostovich MP, Nogueira RM, Edgil D, Schatzmayr HG, Riley LW, Harris E, 2002. Complete nucleotide sequence analysis of a Brazilian dengue virus type 2 strain. Mem Inst Oswaldo Cruz 97 :991–995.

    • Search Google Scholar
    • Export Citation
  • 24

    Lanciotti RS, Calisher CH, Gubler DJ, Chang GJ, Vorndam AV, 1992. Rapid detection and typing of dengue viruses from clinical samples by using reverse transcriptase-polymerase chain reaction. J Clin Microbiol 30 :545–551.

    • Search Google Scholar
    • Export Citation
  • 25

    Nogueira RM, Miagostovich MP, Lampe E, Souza RW, Zagne SM, Schatzmayr HG, 1993. Dengue epidemic in the state of Rio de Janeiro, Brazil, 1990-1: co-circulation of dengue 1 and dengue 2 serotypes. Epidemiol Infect 111 :163–170.

    • Search Google Scholar
    • Export Citation
  • 26

    Miagostovich MP, Nogueira RM, dos Santos FB, Schatzmayr HG, Araujo ES, Vorndam V, 1999. Evaluation of an IgG enzyme-linked immunosorbent assay for dengue diagnosis. J Clin Virol 14 :183–189.

    • Search Google Scholar
    • Export Citation
  • 27

    Harris E, Roberts TG, Smith L, Selle J, Kramer LD, Valle S, Sandoval E, Balmaseda A, 1998. Typing of dengue viruses in clinical specimens and mosquitoes by singletube multiplex reverse transcriptase PCR. J Clin Microbiol 36 :2634–2639.

    • Search Google Scholar
    • Export Citation
  • 28

    Laemmli UK, 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227 :680–685.

  • 29

    Mason PW, Zugel MU, Semproni AR, Fournier MJ, Mason TL, 1990. The antigenic structure of dengue type 1 virus envelope and NS1 proteins expressed in Escherichia coli.J Gen Virol 71 :2107–2114.

    • Search Google Scholar
    • Export Citation
  • 30

    Fonseca BAL, Khoshnood K, Shope RE, Mason PW, 1991. Flavivirus, type-specific antigens produced from fusions of a portion of the E protein gene with the Escherichia coli trpE gene. Am J Trop Med Hyg 44 :500–508.

    • Search Google Scholar
    • Export Citation
  • 31

    Megret F, Hugnot JP, Falconar A, Gentry MK, Morens DM, Murray JM, Schlesinger JJ, Wright PJ, Young P, van Regenmortel MH, Deubel V, 1992. Use of recombinant fusion proteins and monoclonal antibodies to define linear and discontinuous antigenic sites on the dengue virus envelope glycoprotein. Virology 187 :480–491.

    • Search Google Scholar
    • Export Citation
  • 32

    Trirawatanapong T, Chandran B, Putnak R, Padmanabhan R, 1992. Mapping of a region of dengue virus type-2 glycoprotein required for binding by a neutralizing monoclonal antibody. Gene 116 :139–150.

    • Search Google Scholar
    • Export Citation
  • 33

    Srivastava AK, Putnak JR, Warren RL, Hoke CH Jr, 1995. Mice immunized with a dengue type 2 virus E and NS1 fusion protein made in Escherichia coli are protected against lethal dengue virus infection. Vaccine 13 :1251–1258.

    • Search Google Scholar
    • Export Citation
  • 34

    Sugrue RJ, Cui T, Xu Q, Fu J, Chan YC, 1997. The production of recombinant dengue virus E protein using Escherichia coli and Pichia pastoris.J Virol Methods 69 :159–169.

    • Search Google Scholar
    • Export Citation
  • 35

    Simmons M, Porter KR, Escamilla J, Graham R, Watts DM, Eckels KH, Hayes CG, 1998. Evaluation of recombinant dengue viral envelope B domain protein antigens for the detection of dengue complex-specific antibodies. Am J Trop Med Hyg 58 :144–151.

    • Search Google Scholar
    • Export Citation
  • 36

    Staropoli I, Frenkiel MP, Megret F, Deubel V, 1997. Affinity-purified dengue-2 virus envelope glycoprotein induces neutralizing antibodies and protective immunity in mice. Vaccine 15 :1946–1954.

    • Search Google Scholar
    • Export Citation
  • 37

    Kelly EP, Greene JJ, King AD, Innis BL, 2000. Purified dengue 2 virus envelope glycoprotein aggregates produced by baculovirus are immunogenic in mice. Vaccine 18 :2549–2559.

    • Search Google Scholar
    • Export Citation
  • 38

    Garcia G, Vaughn DW, DelAngel RM, 1997. Recognition of synthetic oligopeptides from nonstructural proteins NS1 and NS3 of dengue-4 virus by sera from dengue virus-infected children. Am J Trop Med Hyg 56 :466–470.

    • Search Google Scholar
    • Export Citation
  • 39

    Cuzzubbo AJ, Endy TP, Nisalak A, Kalayanarooj S, Vaughn DW, Ogata SA, Clements DE, Devine P, 2001. Use of recombinant envelope proteins for serological diagnosis of dengue virus infection in an immunochromatographic assay. Clin Di-agn Lab Immunol 8 :1150–1155.

    • Search Google Scholar
    • Export Citation
  • 40

    Wu HC, Huang YL, Chao TT, Jan JT, Huang JL, Chiang HY, King CC, Shaio MF, 2001. Identification of B-cell epitope of dengue virus type 1 and its application in diagnosis of patients. J Clin Microbiol 39 :977–982.

    • Search Google Scholar
    • Export Citation
  • 41

    Huang JL, Huang JH, Shyu RH, Teng CW, Lin YL, Kuo MD, Yao CW, Shaio MF, 2001. High-level expression of recombinant dengue viral NS-1 protein and its potential use as a diagnostic antigen. J Med Virol 65 :553–560.

    • Search Google Scholar
    • Export Citation
  • 42

    Ludolfs D, Schilling S, Altenschimidt J, Schmitz H, 2002. Serological differentiation of infections with dengue virus serotypes 1 to 4 by using recombinant antigens. J Clin Microbiol 40 :4317–4320.

    • Search Google Scholar
    • Export Citation
  • 43

    Makino Y, Tadano M, Saito M, Maneekarn N, Sittisombut N, Sirisanthana V, Poneprasert B, Fukunaga T, 1994. Studies on serological cross-reaction in sequential flavivirus infections. Microbiol Immunol 38 :951–955.

    • Search Google Scholar
    • Export Citation
  • 44

    Calisher CH, Karabatsos N, Dalrymple JM, Shope RE, Porterfield JS, Westaway EG, Brandt WE, 1989. Antigenic relationships between flaviviruses as determined by cross- neutralization tests with polyclonal antisera. J Gen Virol 70 :37–43.

    • Search Google Scholar
    • Export Citation
Save