• View in gallery

    Structure of ChimeriVax™-DEN viruses and genome locations of primers and probes used to detect RNA transcripts by a real-time reverse transcriptase-polymerase chain reaction. YF = yellow fever; C = capsid; prM = premembrane, E = envelope; NCR = non-coding region; DEN = dengue.

  • View in gallery

    Virus growth in C6/36 cells (single virus infections, multiplicity of infection [MOI] = 0.01 plaque-forming units [PFU]/ cell; tetravalent infection MOI = 0.01 PFU/cell of each chimeric virus, or total MOI = 0.04 PFU/cell). Virus titer shown is the mean titer ± SD (log10 RNA transcripts/mL) from three cell culture assays at each time point. The growth curves of the single ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN infections, shown together in D, are also shown in A-C as shaded dashed lines. The YF-VAX virus growth curve is shown in D for comparison. DEN = dengue; YF = yellow fever.

  • View in gallery

    Virus growth in intrathoracically (IT)-inoculated Aedes aegypti. Each mosquito was inoculated with approximately 2.5 log10 plaque-forming units (PFU) of virus in single infections or 1.9 log10 PFU of each serotype in the tetravalent chimeric virus infection. Virus titer shown is the mean titer ± SD (log10 RNA transcripts/ mosquito) from three mosquitoes collected at each time point. Growth of the each ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN IT inoculation, shown together in D, are also shown in A-C as shaded dashed lines. Growth of IT-inoculated YF-VAX virus is shown in D for comparison. DEN = dengue; YF = yellow fever.

  • View in gallery

    Virus growth in Aedes aegypti orally exposed to an artificial, infectious blood meal. Blood meal titers, as determined by Taqman (log10 RNA transcripts/mL): wild-type (wt) DEN-1 = 7.4, ChimeriVax™-DEN-1 = 8.1, wt DEN-3 = 7.0, ChimeriVax™-DEN-3 = 8.0, wt DEN-4 = 5.8., ChimeriVax™-DEN-4 = 7.8; each serotype in the ChimeriVax™-DEN 1, 2, 3, 4 virus mix = 7.3; YF-VAX = 7.4. Virus titers ± SD of each ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN blood meal, shown together in D, are also shown in A-C as shaded dashed lines. The time course of the mosquitoes receiving YF-VAX virus-laden blood meal is shown in D for comparison. DEN = dengue; YF = yellow fever.

  • 1

    Gubler DJ, 1988. Dengue. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Boca Raton, FL: CRC Press, 223–260.

  • 2

    Gubler DJ, 1998. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11 :480–496.

  • 3

    Koraka P, Zeller H, Niedrig M, Osterhaus AD, Groen J, 2002. Reactivity of serum samples from patients with a flavivirus infection measured by immunofluorescence assay and ELISA. Microbes Infect 4 :1209–1215.

    • Search Google Scholar
    • Export Citation
  • 4

    Gubler DJ, 1998. The global pandemic of dengue/dengue haemorrhagic fever: current status and prospects for the future. Ann Acad Med Singapore 27 :227–234.

    • Search Google Scholar
    • Export Citation
  • 5

    Division of Disease Prevention and Control CDP, 1997. Re-emergence of dengue in the Americas. Epidemiol Bull 18 :1–6.

  • 6

    Gubler DJ, 1998. Epidemic dengue and dengue hemorrhagic fever: a global public health problem in the 21st century. Scheld W, Armstrong D, Hughes J, eds. Emerging Infections. Washington, DC: American Society for Microbiology Press, 1–14.

  • 7

    Monath TP, 1994. Dengue: the risk to developed and developing countries. Proc Natl Acad Sci USA 91 :2395–2400.

  • 8

    Rothman AL, Ennis FA, 1999. Immunopathogenesis of dengue hemorrhagic fever. Virology 257 :1–6.

  • 9

    Porterfield JS, 1986. Antibody-dependent enhancement of viral infectivity. Adv Virus Res 31 :335–355.

  • 10

    Tirado SM, Yoon KJ, 2003. Antibody-dependent enhancement of virus infection and disease. Viral Immunol 16 :69–86.

  • 11

    Gubler DJ, Clark GG, 1995. Dengue/dengue hemorrhagic fever: the emergence of a global health problem. Emerg Infect Dis 1 :55–57.

  • 12

    Chambers TJ, Nestorowicz A, Mason PW, Rice CM, 1999. Yellow fever/Japanese encephalitis chimeric viruses: construction and biological properties. J Virol 73 :3095–3101.

    • Search Google Scholar
    • Export Citation
  • 13

    Guirakhoo F, Zhang ZX, Chambers TJ, Delagrave S, Arroyo J, Barrett AD, Monath TP, 1999. Immunogenicity, genetic stability, and protective efficacy of a recombinant, chimeric yellow fever-Japanese encephalitis virus (ChimeriVax-JE) as a live, attenuated vaccine candidate against Japanese encephalitis. Virology 257 :363–372.

    • Search Google Scholar
    • Export Citation
  • 14

    Monath TP, Soike K, Levenbook I, Zhang ZX, Arroyo J, Delagrave S, Myers G, Barrett AD, Shope RE, Ratterree M, Chambers TJ, Guirakhoo F, 1999. Recombinant, chimaeric live, attenuated vaccine (ChimeriVax) incorporating the envelope genes of Japanese encephalitis (SA14–14–2) virus and the capsid and nonstructural genes of yellow fever (17D) virus is safe, immunogenic and protective in non-human primates. Vaccine 17 :1869–1882.

    • Search Google Scholar
    • Export Citation
  • 15

    Guirakhoo R, Weltzin R, Chambers T, Zhang Z-X, Soike K, Ratterree M, Arroyo J, Georgakopoulos K, Catalan J, Monath T, 2000. Recombinant chimeric yellow fever-dengue type 2 virus is immunogenic and protective in nonhuman primates. J Virol 74 :5477–5485.

    • Search Google Scholar
    • Export Citation
  • 16

    Guirakhoo F, Arroyo J, Pugachev KV, Miller C, Zhang ZX, Weltzin R, Georgakopoulos K, Catalan J, Ocran S, Soike K, Ratterree M, Monath TP, 2001. Construction, safety, and immunogenicity in nonhuman primates of a chimeric yellow fever-dengue virus tetravalent vaccine. J Virol 75 :7290–7304.

    • Search Google Scholar
    • Export Citation
  • 17

    Arroyo J, Miller CA, Catalan J, Monath TP, 2001. Yellow fever vector live-virus vaccines. West Nile virus vaccine development. Trends Mol Med 7 :350–354.

    • Search Google Scholar
    • Export Citation
  • 18

    Arroyo J, Guirakhoo F, Fenner S, Zhang ZX, Monath TP, Chambers TJ, 2001. Molecular basis for attenuation of neurovirulence of a yellow fever virus/Japanese encephalitis virus chimera vaccine (ChimeriVax-JE). J Virol 75 :934–942.

    • Search Google Scholar
    • Export Citation
  • 19

    Monath TP, 2001. Prospects for development of a vaccine against the West Nile virus. Ann N Y Acad Sci 951 :1–12.

  • 20

    Monath TP, Arroyo J, Miller C, Guirakhoo F, 2001. West Nile virus vaccine. Curr Drug Targets Infect Disord 1 :37–50.

  • 21

    Monath TP, 1991. Yellow fever: Victor, Victoria? conqueror, conquest? Epidemics and research in the last forty years and prospects for the future. Am J Trop Med Hyg 45 :1–43.

    • Search Google Scholar
    • Export Citation
  • 22

    Marianneau P, Georges-Courbot M, Deubel V, 2001. Rarity of adverse effects after 17D yellow-fever vaccination. Lancet 358 :84–85.

  • 23

    Whitman L, 1939. Failure of Aedes aegypti to transmit yellow fever cultured virus (17D). Am J Trop Med 19 :19–26.

  • 24

    Bhatt TR, Crabtree MB, Guirakhoo F, Monath TP, Miller BR, 2000. Growth characteristics of the chimeric Japanese encephalitis virus vaccine candidate, ChimeriVax-JE (YF/JE SA14–14–2), in Culex tritaeniorhynchus, Aedes albopictus, and Aedes aegypti mosquitoes. Am J Trop Med Hyg 62 :480–484.

    • Search Google Scholar
    • Export Citation
  • 25

    Johnson BW, Chambers TV, Crabtree MB, Bhatt TR, Guirakhoo F, Monath TP, Miller BR, 2002. Growth characteristics of ChimeriVax-DEN-2 vaccine virus in Aedes aegypti and Aedes albopictus mosquitoes. Am J Trop Med Hyg 67 :260–265.

    • Search Google Scholar
    • Export Citation
  • 26

    Johnson BW, Chambers TV, Crabtree MB, Arroyo J, Monath TP, Miller BR, 2003. Growth characteristics of the veterinary vaccine candidate ChimeriVax™-West Nile (WN) virus in Aedes and Culex mosquitoes. Med Vet Entomol 17 :235–243.

    • Search Google Scholar
    • Export Citation
  • 27

    Guirakhoo F, Pugachev K, Arroyo J, Miller C, Zhang ZX, Weltzin R, Georgakopoulos K, Catalan J, Ocran S, Draper K, Monath TP, 2002. Viremia and immunogenicity in nonhuman primates of a tetravalent yellow fever-dengue chimeric vaccine: genetic reconstructions, dose adjustment, and antibody responses against wild-type dengue virus isolates. Virology 298 :146–159.

    • Search Google Scholar
    • Export Citation
  • 28

    Miller BR, Mitchell CJ, Ballinger ME, 1989. Replication, tissue tropisms and transmission of yellow fever virus in Aedes albopictus. Trans R Soc Trop Med Hyg 83 :252–255.

    • Search Google Scholar
    • Export Citation
  • 29

    Lanciotti RS, Kerst AJ, Nasci RS, Godsey MS, Mitchell CJ, Savage HM, Komar N, Panella NA, Allen BC, Volpe KE, Davis BS, Roehrig JT, 2000. Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 38 :4066–4071.

    • Search Google Scholar
    • Export Citation
  • 30

    Rosen L, Roseboom LE, Gubler DJ, Lien JC, Chaniotis BN, 1985. Comparative susceptibility of mosquito species and strains to oral and parenteral infection with dengue and Japanese encephalitis viruses. Am J Trop Med Hyg 34 :603–615.

    • Search Google Scholar
    • Export Citation
  • 31

    Miller BR, 1987. Increased yellow fever virus infection and dissemination rates in Aedes aegypti mosquitoes orally exposed to freshly grown virus. Trans R Soc Trop Med Hyg 81 :1011–1012.

    • Search Google Scholar
    • Export Citation
  • 32

    Weaver SC, Lorenz LH, Scott TW, 1993. Distribution of western equine encephalomyelitis virus in the alimentary tract of Culex tarsalis (Diptera: Culicidae) following natural and artificial blood meals. J Med Entomol 30 :391–397.

    • Search Google Scholar
    • Export Citation
  • 33

    Turell MJ, Spring AR, Miller MK, Cannon CE, 2002. Effect of holding conditions on the detection of West Nile viral RNA by reverse transcriptase-polymerase chain reaction from mosquito (Diptera: Culicidae) pools. J Med Entomol 39 :1–3.

    • Search Google Scholar
    • Export Citation
  • 34

    Kramer LD, Chiles RE, Do TD, Fallah HM, 2001. Detection of St. Louis encephalitis and western equine encephalomyelitis RNA in mosquitoes tested without maintenance of a cold chain. J Am Mosq Control Assoc 17 :213–215.

    • Search Google Scholar
    • Export Citation
  • 35

    Armstrong PM, Rico-Hesse R, 2001. Differential susceptibility of Aedes aegypti to infection by the American and Southeast Asian genotypes of dengue type 2 virus. Vector Borne Zoonotic Dis 1 :159–168.

    • Search Google Scholar
    • Export Citation
  • 36

    Gubler DJ, Rosen L, 1976. A simple technique for demonstrating transmission of dengue virus by mosquitoes without the use of vertebrate hosts. Am J Trop Med Hyg 25 :146–150.

    • Search Google Scholar
    • Export Citation
  • 37

    Durbin AP, Karron RA, Sun W, Vaughn DW, Reynolds MJ, Perreault JR, Thumar B, Men R, Lai CJ, Elkins WR, Chanock RM, Murphy BR, Whitehead SS, 2001. Attenuation and immunogenicity in humans of a live dengue virus type-4 vaccine candidate with a 30 nucleotide deletion in its 3′-untranslated region. Am J Trop Med Hyg 65 :405–413.

    • Search Google Scholar
    • Export Citation
  • 38

    Gubler DJ, Suharyono W, Tan R, Abidin M, Sie A, 1981. Viraemia in patients with naturally acquired dengue infection. Bull World Health Organ 59 :623–630.

    • Search Google Scholar
    • Export Citation
  • 39

    Chambers TJ, Hahn CS, Galler R, Rice CM, 1990. Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 44 :649–688.

    • Search Google Scholar
    • Export Citation
  • 40

    Lindenbach B, Rice C, 2001. Flaviviridae: the viruses and their replication. Knipe D, Howley P, eds. Fields Virology. Philadelphia: Lipincott William and Wilkins, 991–1043.

 

 

 

 

ANALYSIS OF THE REPLICATION KINETICS OF THE CHIMERIVAX™-DEN 1, 2, 3, 4 TETRAVALENT VIRUS MIXTURE IN AEDES AEGYPTI BY REAL-TIME REVERSE TRANSCRIPTASE–POLYMERASE CHAIN REACTION

View More View Less
  • 1 Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Fort Collins, Colorado; Acambis, Inc., Cambridge, Massachusetts

The vector competence of mosquitoes for chimeric viruses being developed as vaccines to protect against dengue (DEN) virus infection were evaluated in a cooperative agreement with Acambis, Inc. Chimeric viruses have been constructed that contain the premembrane (prM) and envelope (E) genes of each of the wild-type (wt) DEN virus serotypes, DEN-1, DEN-2, DEN-3, and DEN-4, in the yellow fever (YF) vaccine virus (strain 17D) YF-VAX backbone. It was previously shown that the replication profile of ChimeriVax™-DEN2 virus in Aedes albopictus C6/36 cells and in vivo in Ae. aegypti mosquitoes corresponded to that of YF-VAX virus; replication was restricted in C6/36 cells, and Ae. aegypti were poorly infected via an artificial infectious blood meal. Thus, there is very little risk of transmission by mosquitoes of ChimeriVax-DEN2 vaccine virus through the bite of a mosquito. However, because ChimeriVax™-DEN 1, 2, 3, 4 viruses will be administered to humans simultaneously, growth of a mixture of ChimeriVax™-DEN 1, 2, 3, 4 viruses was assessed in both C6/36 cells in culture and in the Ae. aegypti mosquito, which is the primary vector of both YF and DEN viruses. Mosquitoes were intrathoracically (IT) inoculated with virus or fed a virus-laden blood meal, and the replication kinetics of ChimeriVax™-DEN 1, 2, 3, 4 were compared with the wt DEN and YF-VAX viruses. A quantitative real-time reverse transcriptase-polymerase chain reaction assay was developed as a method to detect and differentiate replication of each of the four ChimeriVax™-DEN serotypes in the ChimeriVax™-DEN 1, 2, 3, 4 tetravalent mixture. Growth of the chimeric viruses in C6/36 cells and in IT-inoculated Ae. aegypti was lower than that of YF-VAX virus; in previous studies Ae. aegypti was shown to be refractory to infection by YF-VAX virus. The growth rate of each chimeric virus was similar whether it was a single serotype infection, or part of the tetravalent mixture, and no interference by one chimeric virus over another chimeric serotype was observed. ChimeriVax™-DEN viruses infected mosquitoes poorly via an infectious blood meal compared with wt DEN viruses. Therefore, it is unlikely that a mosquito feeding on a viremic vaccinee, would become infected with the chimeric viruses. Thus, there is very little potential for transmission by mosquitoes of the ChimeriVax-DEN vaccine viruses.

INTRODUCTION

Dengue fever (DF) and dengue hemorrhagic fever (DHF)/ dengue shock syndrome (DSS) are important human arboviral diseases caused by infection with one of four dengue (DEN) viruses, which are transmitted through the bite of an infected mosquito.1 Aedes aegypti is the primary mosquito vector; however, depending on the geographic region, other Aedes species are also important vectors.1,2 Dengue virus infections are of considerable public health importance because of the high morbidity and mortality associated with their now worldwide distribution.3 There are more than 100 million cases of DF, and hundreds of thousands of cases of DHF/DSS each year, and the incidence is increasing.4,5 Two-thirds of the world’s population, or 2.3 billion people, are at risk of becoming infected with DEN virus because the range of Aedes mosquitoes has expanded throughout the tropics and subtropics, where all four DEN virus serotypes are currently circulating.2,4,6,7

The DEN viruses are a group of four viruses in the genus Flavivirus designated DEN-1, DEN-2, DEN-3, and DEN-4.1 Although the viruses are closely related, they are antigenically distinct, and previous infection by one serotype does not confer protection against infection by a second serotype. Antibodies raised against the primary infection serotype are cross-reactive in the secondary infection, but not cross-protective.8,9 Thus, an individual may be infected with a second DEN virus serotype, and cross-reactive antibodies raised against the primary DEN virus infection may function to enhance the entry of the second DEN serotype virus into cells in a process called antibody-dependent enhancement,9,10 which is hypothesized to contribute to DHF/DSS.11 Therefore, in regions where all four DEN serotypes are co-circulating, a person may be exposed to all four serotypes in his or her lifetime. The cross-reactivity, antibody-dependent enhancement of infection, and pan-distribution of all four DEN virus serotypes are factors that have frustrated attempts to develop a DEN vaccine, which will have to be administered so that it simultaneously protects against all four DEN viruses.

Acambis, Inc. has developed recombinant vaccine viruses based on using the attenuated yellow fever (YF) vaccine virus 17D (YF-VAX) as a live vector.12 The genes encoding the premembrane (prM) and envelope (E) proteins of the YF-VAX virus have been replaced with those of heterologous flaviviruses, such as Japanese encephalitis (JE) virus;12–14 DEN-1, DEN-2, DEN-3, and DEN-4 viruses (Figure 1);15,16 and West Nile (WN) virus.15–20

YF-VAX is a live, attenuated virus that has been shown to be one of the safest, most effective vaccines developed to date, with more than 400 million doses administered over a 60-year period.21,22 It was developed by serial passage of wild-type (wt) Asibi YF virus in vertebrate cells and is attenuated in humans. Poor oral infectivity and replication of YF-VAX in mosquito vectors has been demonstrated in early and recent vector competence studies.23–26 However, introduction of heterologous genes into YF-VAX resulting in the ChimeriVax virus could potentially change the phenotypic characteristics of the virus.

A vaccine consisting of a tetravalent mix of ChimeriVax™-DEN-1, ChimeriVax™-DEN-2, ChimeriVax™-DEN-3, and ChimeriVax™-DEN-4 viruses, which will protect against infection by all four DEN virus serotypes, is currently in development (Acambis, Inc.). In nonhuman primates vaccinated with the ChimeriVax™-DEN 1, 2, 3, 4 tetravalent mixture, viremia is very low (peak titer of primary immunization 1.5 log10 plaque-forming units [PFU]/mL), yet good immune response is elicited against all four DEN virus serotypes.27 However, despite the low viremia, the potential for a competent vector mosquito to become infected with the chimeric virus through taking a blood meal on a viremic vaccinee needed to be evaluated.

In previous studies, mosquitoes were shown to be poorly infected orally with ChimeriVax™-JE, ChimeriVax™-DEN-2, and ChimeriVax™-WN viruses and growth was limited compared with the wt viruses in vector mosquito species when virus was introduced directly by inoculation.24–26 We report here growth kinetics of the ChimeriVax™-DEN 1, 2, 3, 4 tetravalent mixture of viruses in vitro in Ae. albopictus C6/36 cell culture and in vivo in Ae. aegypti mosquitoes, the primary vector of both YF and DEN viruses. Single infections of ChimeriVax™-DEN-1, ChimeriVax™-DEN-3, and ChimeriVax™-DEN-4 viruses were also carried out. The low infection and transmission potential of ChimeriVax™-DEN-2 virus by Ae. aegypti and Ae. albopictus mosquitoes was determined in earlier studies.25 Growth of the chimeric viruses in C6/36 cells and in mosquitoes either intrathoracically (IT) inoculated with virus or offered virus in an artificial infectious blood meal was compared with that of the corresponding wt DEN and YF-VAX viruses. As in the previous vector competence studies with ChimeriVax™ viruses, the chimeric DEN viruses assessed in this report were found to be phenotypically similar to YF-VAX, which is attenuated in mosquitoes, and their ability to infect mosquitoes via oral infection was reduced compared with the parental DEN viruses.

A real-time reverse transcriptase-polymerase chain reaction (RT-PCR) method of virus detection and quantification (Taqman) was developed to separately assay growth of each of the ChimeriVax™-DEN serotypes in the tetravalent mix. The Taqman assay detected virus titer both in vitro in the C6/36 cell culture growth curves, and also in individual, triturated mosquitoes.

The stability of the chimeric virus nucleotide sequence after replication in the mosquito was also determined. The prM and E gene regions of chimeric virus isolated from IT inoculated mosquitoes were sequenced and compared with the corresponding gene region of the chimeric virus inoculum.

MATERIALS AND METHODS

Virus preparation.

Aventis-Pasteur (Swiftwater, PA) YF vaccine YF-VAX (17D) (lot no. VA433AA) was reconstituted according to manufacturer’s instructions. Aliquots were prepared and stored at −70°C until used. Wild-type DEN-1 (strain PUO359), DEN-2 (strain PUO218), DEN-3 (strain PaH881/88), and DEN-4 (strain 1228) viruses and ChimeriVax™-DEN 1, 2, 3, and 4 viruses, obtained from Acambis Inc., were thawed once to prepare aliquots, and then stored at −70°C.16

Virus titer.

Individual mosquitoes were triturated by pestle in 1.7-mL tubes (Kontes Glass Co., Vineland, NJ) in 1 mL of BA-1 diluent (1× M-199 medium with Hanks’ salts, 0.05 M Tris, pH 7.6, 1% bovine albumin, 0.35 g/L of sodium bicarbonate, 100 units/mL of penicillin, 100 μg/mL of streptomycin, 1 μL/mL of fungizone). Mosquito suspensions were clarified by centrifugation at 8,000 rpm for 5 minutes. Virus titer was determined by double-overlay plaque assay in Vero cells as previously described.28

Real-time reverse transcription-polymerase chain reaction (TaqMan).

Primers and probes were designed with the PrimerExpress software package (PE Applied Biosystems, Foster City, CA) (Table 1). The TaqMan probes were labeled at the 5′ end with the FAM reporter dye and at the 3′ end with dark quencher. Taqman primers and probes were designed either to detect a unique, serotype-specific sequence in the prM and E region of a DEN virus, or a region in the YF 17D backbone that was common to all chimeric DEN viruses and to YF-VAX (Figure 1). Thus, each ChimeriVax™-DEN primer-probe set detected a single wt DEN virus and the corresponding chimeric DEN virus serotype. Heterologous chimeric DEN virus RNA was included as negative control in all single infection real-time RT-PCR assays. The YF 17D primers and probe detected all ChimeriVax™-DEN virus serotypes and YF-VAX virus. Wild-type DEN virus RNA was added as negative control in these assays. The RNA from tetravalent infections was subjected to four separate, single-serotype real-time RT-PCR assays, with YF-VAX virus serving as the negative control. The specificities of the primer-probe sets were determined as previously described.29 Total RNA for the real-time RT-PCR assay was extracted from 100 μL of the same mosquito suspension used to inoculate Vero cells for plaque titration, using the QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA) according to manufacturer’s instructions. Five microliters of RNA was combined with 50 pmol of each primer and 7.5 pmol of the FAM-labeled probed in a 50-μL total one-Step TaqMan RT-PCR (PE Applied Biosystems). Reverse transcription of 30 minutes at 50°C was followed by 45 cycles of amplification in an ABI Prism 7700 Sequence Detection System instrument (PE Applied Biosystems) according to manufacturer’s instructions for TaqMan RT-PCR conditions.

The number of infectious viral RNA transcripts was calculated by generating a standard curve from RNA isolated from uninfected mosquitoes, triturated with a known amount of seed virus, the titer of which was determined by plaque assay. The amount of infectious RNA is expressed as log10 RNA transcripts/mL, equivalent to a known log10 PFU/mL.29 To ensure that the correlation between PFU and RNA transcripts detected by Taqman was maintained, virus titer was determined by both plaque titration and Taqman whenever possible. Virus titers are expressed as equivalent log10 RNA transcripts in this report.

Growth curves.

The C6/36 cells (a cell line derived from Ae. albopictus) were obtained from stocks at the Division of Vector-Borne Infectious Diseases (DVBID) of the Centers for Disease Control and Prevention (CDC) (Fort Collins, CO) and grown at 28°C in Dulbecco’s Modified Eagle Medium (DMEM) with 10% fetal bovine serum (FBS), 1% each of nonessential amino acids and sodium pyruvate, 1% of 7.5% sodium bicarbonate, and 0.1% gentamicin. Infected C6/36 cells were maintained in 2% FBS medium. Three 25–cm2 flasks of C6/36 cells were infected with each virus at a multiplicity of infection of 0.01 PFU/cell. The pH was adjusted with sodium bicarbonate. Supernatant fluid was removed at 48-hour intervals for 10 days.

Mosquitoes.

Field-collected Ae. aegypti eggs from Puerto Rico were provided by the Dengue Branch of DVBID, CDC (San Juan, PR). A laboratory colony was established and maintained at the CDC in Fort Collins as previously described.25 The F4 generations of these mosquitoes were used in this study.

Intrathoracic inoculation of mosquitoes.

Mosquitoes were cold anesthetized and inoculated intrathoracically (IT) using a microcapillary needle that had been pulled to a point with a needle puller (Narishige, Tokyo, Japan). Approximately 0.34 μL of virus standardized to 6.0 log10 PFU/mL was injected into each mosquito (2.5 log10 PFU/mosquito; ChimeriVax™-DEN-1, 2, 3, 4, mixture, 1.9 log10 PFU of each serotype/mosquito). Inoculated mosquitoes were maintained in cartons at 27°C and a relative humidity of 80% and with 5% sugar water. Three mosquitoes per infection were removed at 48-hour intervals for 10 days; the remainder was collected at 14 days postinoculation. Mosquitoes were frozen at −70°C until assayed.

Oral infection of mosquitoes.

Mosquitoes were fed virus-laden artificial blood meals in hanging droplets.30 It was necessary to use fresh virus for blood meals.31 Wild-type DEN viruses were grown in C6/36 cells; because ChimeriVax™-DEN viruses did not grow well in C6/36 cells they were cultured in Vero cells. The infection threshold of artificial blood meals in mosquitoes requires a higher virus titer than natural infections.32 Therefore, in the oral infection experiments, the highest virus titer possible was used. Virus supernatant was collected 5–6 days after infection (70% cytopathic effect [CPE]) and clarified by centrifugation at 8,000 rpm at 4°C for 20 minutes. Defibrinated sheep’s blood (Colorado Serum Co., Denver, CO) was washed three times with ice-cold phosphate-buffered saline. Two parts fresh virus (7–8 log10 PFU/ mL) was mixed with two parts defibrinated sheep’s blood and one part 10% sucrose in FBS. Prior to administering the blood meal containing the chimeric tetravalent mixture, the titer of each chimeric virus was determined by Taqman, then mixed in equivalent amounts. The artificial blood meal was quickly heated to 37°C, then offered in hanging droplets to 7–10-day-old mosquitoes that had been starved for 24 hours. Mosquitoes were allowed to feed for 30 min, then were cold anesthetized and sorted. Fully engorged mosquitoes were collected and incubated at 27°C and a relative humidity of 80% with sugar water as previously described.25 Mosquitoes were collected at 48-hour intervals for 10 days and after the 14-day extrinsic incubation period, and were stored at −70°C until they were assayed for infection.

Sequence analysis of the prM and E genes in ChimeriVax™ - DEN viruses isolated from IT -inoculated mosquitoes.

Genomic sequences of the prM and E regions were obtained from seed viruses and from RNA isolated from single serotype infections of IT-inoculated mosquitoes for each of the ChimeriVax™-DEN viruses. Mosquito tissues were triturated in 1 mL of BA-1 diluent and clarified by centrifugation. Because of the low viral titer of the infected mosquitoes, no RT-PCR product could be amplified from these mosquitoes directly. Therefore, 100 μL of mosquito suspension was passed through a 0.2-μm filter (Corning Glass Works, Corning, NY) and used to inoculate a T-25 cm2 flask of Vero cells. Virus supernatant was collected at six days, ≈70% CPE, and RNA was extracted from 100 μL of the cell culture supernatant using the QIAamp viral RNA kit. The prM and E genes and surrounding the YF 17D gene region were amplified using the Titan One Tube RT-PCR Kit (Roche Diagnostics, Mannheim, Germany) and primers designed from the ChimeriVax-DEN virus sequence (forward position 413: 5′-ACGCCGTTCCCATGATGTTCTGAC-3′; reverse position 2557: 5′-CTTGTTCAGCCAGTCATCAGAGTC-3′). The resultant 2400-basepair DNA product was purified by gel electrophoresis followed by extraction from the gel using the QIAquick gel extraction kit (Qiagen) and sequenced using CEQ2000 Dye Terminator Cycle Sequencing with Quick Start kit (Beckman Coulter, Fullerton, CA). Sequencing reactions were analyzed on a Beckman Coulter CEQ8000 Genetic Analysis System.

RESULTS

Virus titers were calculated by a real time RT-PCR, and expressed as equivalent log10 RNA transcripts. The standard RNA used in the nucleic amplification assays was extracted from virus dilutions of a known titer, which had been determined by plaque assay. Infectious virus particles constitute only a portion of the total number of RNA transcripts in a sample, which include defective interfering particles and un-packaged viral RNA. The RNA transcripts have been detected in dead mosquitoes held at room temperature for up to 20 days, while infectious virus was not detected by plaque assay after 2–3 days.33,34 The ratio of noninfectious RNA transcripts to infectious virus particles may be even greater in mosquitoes inoculated with chimeric viruses, since the chimeric virus genome may be transcribed but fail to be processed and packaged correctly. Other researchers have used a known quantity of in vitro transcribed RNA in real-time RT-PCR assays to detect every RNA transcript, including noninfectious RNA.35 However, we were interested only in the portion of RNA transcripts that were infectious virus particles, and therefore equivalent log10 RNA transcript/mL were calculated from plaque titrations.

Virus growth in C6/36 cells.

The growth curves of single ChimeriVax™-DEN virus infections compared with wt DEN viruses are shown in Figure 2A-C. Growth of each of the ChimeriVax™-DEN serotypes in the tetravalent mixture infection is shown in Figure 2D, and, for comparison, in Figure 2A-C as dashed lines. The growth curve of YF-VAX virus is also shown for comparison in Figure 2D. The peak titers of ChimeriVax™-DEN-1 and ChimeriVax™-DEN-3 were 4.2 and 3.4 log10 RNA/mL, respectively, at 10 days, which were 3.8 and 2.6 logs lower than wt DEN-1 virus and DEN-3 virus peak titers. ChimeriVax™-DEN-4 virus grew to 5 log10 RNA/ mL, which was 1 log more than the peak titer of wt DEN-4 virus. The titer and growth rate of each chimeric serotype was similar whether it was a single infection, or part of the tetravalent mix (Figure 2). No interference by one chimeric virus with a faster growth rate over a slower-growing serotype was observed. Peak mean titers in the ChimeriVax™-DEN 1, 2, 3, 4 virus infection were 1–2.8 logs lower than the peak mean titer of 6.0 log10 RNA/mL YF-VAX virus (Figure 2D).

Virus replication in IT inoculated mosquitoes.

Mosquitoes were IT inoculated with either wt DEN-1, DEN-3, or DEN-4 viruses; single serotypes of ChimeriVax™-DEN-1, ChimeriVax™-DEN-3, or ChimeriVax™-DEN-4; a mixture with equal amounts of the four ChimeriVax™-DEN serotypes; or YF-VAX viruses. Figure 3A-C shows the geometric mean ± SD titer of three individual mosquitoes collected at 48-hour intervals following IT inoculation of single ChimeriVax™-DEN serotypes compared with wt DEN viruses; replication of each ChimeriVax™-DEN serotype IT inoculated into mosquitoes as a tetravalent mixture are included for comparison and shown as dashed lines. The growth of the four chimeric virus serotypes IT inoculated into mosquitoes as a tetravalent mixture is shown and compared with that of YF-VAX virus in Figure 3D. Mean peak titer at 10 days of ChimeriVax™-DEN-1 virus in IT-inoculated Ae. aegypti was 1.4 logs lower than the mean peak titer of wt DEN-1 virus. ChimeriVax-DEN3 reached a mean peak titer of 4.0 log10 RNA/mosquito at 10 days; wt DEN-3 virus mean peak titer at 4 days was 4.3 log10 RNA/mosquito. ChimeriVax-DEN-4 grew to higher titer than that of wt DEN-4 virus; the mean peak titer of ChimeriVax-DEN-4 virus was 3.9 log10 RNA/ mosquito at day 8 compared with the wt DEN-4 mean peak titer of 3.2 log10 RNA/mosquito at 10 days. Because of the small sample size, no statistical significance can be attributed to these time course experiments, but they do show the general difference in growth in mosquitoes between the wt DEN and chimeric viruses throughout the 10-day extrinsic incubation period.

The replication profiles of each of the chimeric viruses in Ae. aegypti IT inoculated with the tetravalent chimeric virus mix were similar to those of single infections. Mean peak virus titers of all four of the chimeric viruses in the mix were 0.9–2.2 logs lower than that of YF-VAX virus-infected mosquitoes, which reached a mean peak titer of 5.1 log10 RNA/ mosquito at day 6 (Figure 3D).

Virus replication and dissemination were also assayed in IT inoculated Ae. aegypti after a 14-day extrinsic incubation period (Table 2). Mosquito heads and bodies were assayed separately. Mosquitoes were defined as infected if viral RNA was detected in the bodies; disseminated infection was defined as the presence of viral RNA in head tissue. As single infections all viruses replicated in mosquitoes at 14 days, and all viruses disseminated to head tissue, except for ChimeriVax-DEN-1, which infected 96% of the mosquitoes at 14 days, and disseminated to head tissue in 88%.

Mean titers of chimeric viruses inoculated as a tetravalent mixture were similar to those of single serotype inoculations and 1.6–2.3 logs lower than the mean titer of YF-VAX virus (Table 2). Dissemination to head tissue occurred in 100% of the chimeric viruses, except for ChimeriVax-DEN-2 virus. The infection rates and mean titers of ChimeriVax-DEN-2 virus in single infections in a previous study and in the tetravalent mix were equivalent: 56% (1.8 ± 0.7 log10 RNA/ mosquito.25 Dissemination occurred in 36% (mean titer of positive mosquitoes = 1.4 ± 0.6 log10 PFU/mosquito) of mosquitoes inoculated with ChimeriVax-DEN-2 only25 versus 15% (mean titer of positive mosquitoes = 1.3 ± 0.1 log10 RNA/mosquito) of mosquitoes inoculated with the tetravalent mixture.

Oral infection of mosquitoes.

Mosquitoes were fed blood meals containing either wt DEN-1, DEN-3, or DEN-4; single serotypes of ChimeriVax™M-DEN-1, ChimeriVax™M-DEN-3, or ChimeriVax™M-DEN-4; a mixture with equal amounts of the four ChimeriVax™-DEN serotypes; or YF-VAX viruses. Virus titers of blood meals were as follows: wt DEN-1 = 7.4 log10 RNA transcripts/mL, ChimeriVax™-DEN-1 = 8.1 log10 RNA transcripts/mL, wt DEN-3 = 7.0 log10 RNA transcripts/mL, ChimeriVax™-DEN-3 = 8.0 log10 RNA transcripts/mL, wt DEN-4 = 5.8 log10 RNA transcripts/mL, ChimeriVax™-DEN-4 = 7.8 log10 RNA transcripts/mL, ChimeriVax™-DEN 1, 2, 3, 4 = 7.3 log10 RNA transcripts/ mL of each serotype, and YF-VAX = 7.4 log10 RNA transcripts/mL. In our hands, the peak titer of wt DEN-4 virus (strain 1228) grown in tissue culture was 6 log10 PFU/mL. However, wt DEN-4 virus was shown to competently infect mosquitoes despite the lower titer. Therefore, rather than standardize the titers of all the viruses, which would require dilution of the chimeric DEN viruses, the lower wt DEN-4 virus titer was considered adequate for oral infection experiments. Growth of virus in mosquitoes over a 10-day period following the blood meals is shown in Figure 4. Replication of single ChimeriVax™-DEN virus serotypes was compared with wt DEN viruses and the results are shown in Figure 4A-C. Growth curves of each of the chimeric DEN virus serotypes fed to mosquitoes in the tetravalent mixture are shown as shaded dashed lines in Figure 4A-C and together in Figure 4D. At 10 days, none of the mosquitoes fed a blood meal containing ChimeriVax™-DEN-3 virus remained infected (Figure 4B); one of three mosquitoes fed blood meals with ChimeriVax™-DEN-1 or ChimeriVax™-DEN-4 viruses were infected (Figure 4A and C). None of the mosquitoes were infected with any chimeric serotype contained in the tetravalent blood meal at 8 or 10 days following the blood meal (Figure 4D). The oral infection rates were significantly different between wt DEN viruses and ChimeriVax™-DEN viruses (P < 0.0001 by Fisher’s exact test for DEN-1, 3, and 4 viruses) (Table 3). Fourteen days post blood feeding 0–9% of the mosquitoes were still infected with one of the chimeric virus serotypes, compared with 10% of mosquitoes infected 14 days following a blood meal containing YF-VAX virus (Table 3).

Genomic sequences of the prM and E gene regions obtained from mosquitoes IT-inoculated with ChimeriVax™-DEN 1, 2, 3, or 4 viruses.

Viral RNA was isolated from chimeric virus inoculum and from mosquitoes that had been IT inoculated with chimeric viruses 14 days previously. To determine if any mutations occurred in the DEN virus genome region during replication in the mosquito, the prM and E genes from both the virus inoculum and mosquito isolate were sequenced and compared. No nucleotide differences from the seed virus were observed in the virus isolated from mosquitoes in any of the ChimeriVax™-DEN 1, 2, 3, or 4 viruses.

DISCUSSION

In an effort to develop vaccines to protect against infection by the DEN viruses, four chimeric viruses have been constructed that contain the prM and E genes of DEN-1, DEN-2, DEN-3, or DEN-4 viruses in the YF 17D virus backbone. The vaccine viruses will be administered in a tetravalent mixture to induce immunity to all four DEN virus serotypes simultaneously.16,27 As part of the vaccine development process, the ability of the chimeric viruses to grow in Ae. albopictus C6/36 tissue culture and to infect, replicate in, and be transmitted by the primary mosquito vector of both YF and DEN viruses, Aedes aegypti, was evaluated. A real-time RT-PCR was an effective, accurate method of detecting growth of a single ChimeriVax™-DEN virus serotype in the tetravalent mixture of chimeric viruses. No cross-reactivity was observed in the assay between the chimeric serotypes, even though the nucleotide sequences differed only in the prM and E regions.

Aedes aegypti are competent mosquito vectors of YF and DEN viruses. Artificial blood meals containing 5.8–8.0 log10 PFU/mL of wt DEN viruses offered to mosquitoes in hanging droplets infected 59–86% of the mosquitoes. In contrast, 10% of mosquitoes were infected with YF-VAX virus. The oral infection rate of the ChimeriVax-DEN viruses was lower, ranging from 0% to 9% in the tetravalent mixture. Because viremia in nonhuman primates vaccinated with ChimeriVax™-DEN 1, 2, 3, and 4 viruses was very low (peak mean titer following primary vaccination = 1.9 log10 PFU/ mL), there is very little probability that mosquitoes would become infected by taking a blood meal on a ChimeriVax™-DEN 1, 2, 3, 4 virus vaccinee.27

When introduced directly into C6/36 cells in vitro or into mosquito tissue by IT inoculation of adult Ae. aegypti mosquitoes, the ChimeriVax™-DEN 1, 2, 3, 4 viruses were able to infect cells and replicate, although less efficiently than YF-VAX virus. This was not unexpected since YF-VAX virus has been shown to grow in C6/36 mosquito tissue culture and in IT-inoculated Ae. aegypti and Ae. albopictus.24–26 In addition, it has been demonstrated that viruses can replicate in mosquito species that are not natural vectors when introduced via IT inoculation.36

To investigate whether one ChimeriVax™-DEN virus serotype replicated more efficiently than the other three virus serotypes in the tetravalent mixture, and possibly inhibited or altered replication of the other ChimeriVax™-DEN virus serotypes, mosquitoes were infected with single ChimeriVax™-DEN virus serotypes or with a mixture of the four chimeric viruses. When infected as a tetravalent mixture of equal titer, the growth curve of each chimeric virus serotype mirrored that of the single virus serotype infection; no interference by one chimeric virus serotype with a faster growth rate over a slower-growing virus serotype was observed. As with single infections, in the tetravalent mixture ChimeriVax™-DEN-2 virus had the lowest peak titer and ChimeriVax™-DEN-4 the highest.25

The peak titers of wt DEN-4 virus 1228 strain, from which the ChimeriVax™-DEN-4 virus was constructed, were lower than the titers of the other wt DEN viruses and of ChimeriVax™-DEN-4 virus in C6/36 cells and IT-inoculated mosquitoes. Moreover, viremia of the parental DEN-4 virus strain 1228 was also lower than the other wt DEN serotypes in nonhuman primate infections.16 Other researchers have observed the natural attenuation of DEN-4 virus in experimental infections of nonhuman primates and in natural infection in humans, and it has been hypothesized that DEN-4 virus infects hosts as secondary infections, through antibody-dependent enhancement of infection.37,38 However, it should be noted that Ae. aegypti were efficiently infected orally with the wt DEN-4 virus (86%) despite the low titer of the blood meal (5.8 log10 RNA/mL). In contrast, only 18% of the mosquitoes became infected following a blood meal containing 7.8 log10 RNA/mL of ChimeriVax™-DEN-4 virus (Table 3).

ChimeriVax™M viruses have now been evaluated in four mosquito studies. These include ChimeriVax™-JE virus in the JE mosquito vector Culex tritaeniorhynchus and the YF vectors Ae. aegypti and Ae. albopictus;24 ChimeriVax™-DEN-2 virus in YF and DEN vectors Ae. aegypti and Ae. albopictus;25 and ChimeriVax™-WN virus in WN vectors Cx. tritaeniorhynchus, Cx. quinquefasciatus, and Cx. nigripalpus and YF vectors Ae. aegypti and Ae. albopictus.26 Results of the experiments reported here and of the previous ChimeriVax™ virus-mosquito studies suggest that the ChimeriVax™ viruses are phenotypically similar to YF-VAX virus. YF-VAX is a live virus that is attenuated in humans and Aedes mosquitoes. Whitman showed in 1939 that YF 17D virus had limited replication activity in mosquito tissue, and was not transmitted by Ae. aegypti mosquitoes.23 Recent studies have confirmed the restricted replication of YF-VAX virus in mosquitoes.24–26 The attenuation of YF-VAX virus in mosquitoes was further supported by results of the experiments reported here.

In general, mosquitoes are not susceptible to oral infection by YF-VAX or ChimeriVax™ viruses. The titer of virus in the few individual mosquitoes that were infected by either YF-VAX or ChimeriVax™ virus was very low, usually less than 100 infectious particles, and the virus did not disseminate to head tissue of the mosquitoes. It is probable that a few midgut cells were permissive to infection and limited replication occurred, but that the virus was unable to pass out of the midgut and disseminate to other mosquito tissue.

The ability to replicate in mosquitoes was determined by the YF-VAX portion of the ChimeriVax™ virus. If the vector mosquito species was not a competent vector of YF, but was a species associated with transmission of the virus contributing the prM and E gene region, the ChimeriVax™ virus was still unable to replicate in mosquitoes, even when introduced directly by IT inoculation. For example, Culex spp. are important vectors of JE and WN viruses, but are not vectors of YF virus. In a laboratory setting, wt JE and WN viruses efficiently infected the Culex mosquitoes, replicating to high titers. However, YF-VAX, ChimeriVax™-JE, and ChimeriVax™-WN viruses did not replicate in Cx. tritaeniorhynchus or Cx. nigripalpus mosquitoes, even upon introduction via IT inoculation.24,26

The flavivirus envelope protein is involved in cell attachment and entry, and because the prM and E genes of ChimeriVax™ viruses have been replaced with those of a heterologous flavivirus, the tissue tropism of the chimeric virus might be expected to correspond to the phenotype of the E gene contributing virus.39,40 However, as mentioned earlier in this report, phenotypic characteristics of the ChimeriVax™ viruses, including the ability to replicate in mosquito tissue, were determined by the YF-VAX portion of the genome in mosquitoes. Mutations in the gene region coding for non-structural proteins are probably responsible for attenuation of YF-VAX, and thus ChimeriVax™ viruses in mosquitoes.

YF-VAX is a live attenuated vaccine virus that has been in use for more than 60 years, with no reports of natural mosquito infection or transmission. The ChimeriVax™ viruses have been shown to be similarly attenuated in mosquitoes, and thus vector mosquitoes would be expected to be refractory to infection by these ChimeriVax™ viruses.

Table 1

Oligonucleotide primers and probes used to detect ChimeriVax™-DEN and YF-VAX viruses by real-time RT-PCR*

PrimerSequence (5′–3′)Position
* DEN = dengue; YF = yellow fever; RT-PCR = reverse transcriptase–polymerase chain reaction.
ChimeriVax™-DEN-1ForwardGAATAGGCAACAGGGACTTCGT993
ProbeAGGACTGTCAGGAGCAACGTGGGTAGATGT1018
ReverseACGCAACTTCCATGTTCCAGTAC1071
ChimeriVax™-DEN-2ForwardCAGGTTATGGCACTGTCACGAT1506
ProbeCTCTCCGAGAACAGGCCTCGACTTCAA1534
ReverseCCATCTGCAGCAACACCATCTC1583
ChimeriVax™-DEN-3ForwardTGCGTGGGAGTAGGAAACAGA986
ProbeATTTTGTGGAAGGTCTGTC1008
ReverseACCACATCAACCCACGTAGCT1050
ChimeriVax™-DEN-4ForwardCTCTACTTCGAACCTATTGCATTGAA1140
ProbeCCTCGATATCAAACATAACCACGGCAACAA1167
ReverseGCTCTCCTTGCGTTGGACAT1217
YF-VAXForwardCCACTCATGAAATGTACTACGTGTCTG8292
ProbeAGCCCGCAGCAATGTCACATTTACTGT8320
ReverseGGAGGCGGGATGTTTGGT8366
Table 2.

Infection and dissemination rates of ChimeriVax™-DEN, wt DEN, and YF-VAX viruses in Aedes aegypti 14 days after IT inoculation*

VirusNo. infected (%)Mean titer†No. disseminated‡ (%)Mean titer†
* DEN = dengue; wt = wild type; YF = yellow fever; IT = intrathoracic.
† Mean titer ± SD (log10RNA/mosquito) of positive mosquitoes.
‡ Disseminated infection is defined as the presence of virus in head tissues 14 days postinoculation.
Wt DEN-124/24 (100)5.3 ± 0.421/21 (100)4.8 ± 0.4
ChimeriVax™-DEN123/24 (96)4.8 ± 0.27/8 (88)3.2 ± 0.4
Wt DEN-324/24 (100)3.2 ± 0.824/24 (100)2.7 ± 0.5
ChimeriVax™-DEN314/14 (100)2.2 ± 0.714/14 (100)1.2 ± 0.7
Wt DEN-421/21 (100)2.5 ± 0.321/21 (100)1.5 ± 0.2
ChimeriVax™-DEN414/14 (100)3.6 ± 0.214/14 (100)2.6 ± 0.3
ChimeriVax™-DEN tetravalent mix
    ChimeriVax™-DEN116/16 (100)3.5 ± 0.813/13 (100)2.5 ± 0.9
    ChimeriVax™-DEN29/16 (56)1.8 ± 0.72/13 (15)1.3 ± 0.1
    ChimeriVax™-DEN316/16 (100)2.5 ± 0.316/16 (100)1.5 ± 0.5
    ChimeriVax™-DEN415/15 (100)3.5 ± 0.515/15 (100)2.5 ± 0.5
YF-VAX17/17 (100)5.1 ± 0.414/14 (100)2.0 ± 0.6
Table 3

Oral infection rates of wt DEN, ChimeriVax™-DEN, and YF-VAX viruses in Aedes aegypti*

VirusNo. infected (%)PMean titer‡ (log10 RNA/mosquito)
* wt = wild type; DEN = dengue; YF = yellow fever. Blood meal virus titers as determined by Taqman (log10 RNA transcripts/mL): wt DEN-1 = 7.4, ChimeriVax™-DEN-1 = 8.1, wt DEN-3 = 7.0. ChimeriVax™-DEN-3 = 8.0, wt DEN-4 = 5.8, ChimeriVax-DEN-4 = 7.8; ChimeriVax-DEN1,2,3,4 mixture equilibrated to 7.3 log10 RNA/mL/serotype; YF-VAX = 7.4.
† Differences between wt DEN and ChimeriVax™-DEN infection rates, as calculated by Fisher’s exact text.
‡ Mean titer ± SD (log10 RNA/mosquito) of positive mosquitoes.
§ Viral RNA not detected in head tissue.
Wt DEN-128/47 (60)< 0.00013.8 ± 1.6
ChimeriVax™-DEN15/37 (14)§3.1 ± 1.8
Wt DEN-319/32 (59)< 0.00012.9 ± 1.4
ChimeriVax™-DEN30/21 (0)
Wt DEN-412/15 (86)< 0.00011.9 ± 0.9
ChimeriVax™-DEN47/39 (18)§1.9 ± 1.3
ChimeriVax™-DEN tetravalent mix
    ChimeriVax™-DEN12/23 (9)‡§< 0.00014.3
    ChimeriVax™-DEN21/23 (4)§0.2
    ChimeriVax™-DEN30/23 (0)
    ChimeriVax™-DEN41/23 (4)‡§< 0.00011.6
YF-VAX2/20 (10)§1.5
Figure 1.
Figure 1.

Structure of ChimeriVax™-DEN viruses and genome locations of primers and probes used to detect RNA transcripts by a real-time reverse transcriptase-polymerase chain reaction. YF = yellow fever; C = capsid; prM = premembrane, E = envelope; NCR = non-coding region; DEN = dengue.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 70, 1; 10.4269/ajtmh.2004.70.89

Figure 2.
Figure 2.

Virus growth in C6/36 cells (single virus infections, multiplicity of infection [MOI] = 0.01 plaque-forming units [PFU]/ cell; tetravalent infection MOI = 0.01 PFU/cell of each chimeric virus, or total MOI = 0.04 PFU/cell). Virus titer shown is the mean titer ± SD (log10 RNA transcripts/mL) from three cell culture assays at each time point. The growth curves of the single ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN infections, shown together in D, are also shown in A-C as shaded dashed lines. The YF-VAX virus growth curve is shown in D for comparison. DEN = dengue; YF = yellow fever.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 70, 1; 10.4269/ajtmh.2004.70.89

Figure 3.
Figure 3.

Virus growth in intrathoracically (IT)-inoculated Aedes aegypti. Each mosquito was inoculated with approximately 2.5 log10 plaque-forming units (PFU) of virus in single infections or 1.9 log10 PFU of each serotype in the tetravalent chimeric virus infection. Virus titer shown is the mean titer ± SD (log10 RNA transcripts/ mosquito) from three mosquitoes collected at each time point. Growth of the each ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN IT inoculation, shown together in D, are also shown in A-C as shaded dashed lines. Growth of IT-inoculated YF-VAX virus is shown in D for comparison. DEN = dengue; YF = yellow fever.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 70, 1; 10.4269/ajtmh.2004.70.89

Figure 4.
Figure 4.

Virus growth in Aedes aegypti orally exposed to an artificial, infectious blood meal. Blood meal titers, as determined by Taqman (log10 RNA transcripts/mL): wild-type (wt) DEN-1 = 7.4, ChimeriVax™-DEN-1 = 8.1, wt DEN-3 = 7.0, ChimeriVax™-DEN-3 = 8.0, wt DEN-4 = 5.8., ChimeriVax™-DEN-4 = 7.8; each serotype in the ChimeriVax™-DEN 1, 2, 3, 4 virus mix = 7.3; YF-VAX = 7.4. Virus titers ± SD of each ChimeriVax™-DEN serotype in the tetravalent ChimeriVax™-DEN blood meal, shown together in D, are also shown in A-C as shaded dashed lines. The time course of the mosquitoes receiving YF-VAX virus-laden blood meal is shown in D for comparison. DEN = dengue; YF = yellow fever.

Citation: The American Journal of Tropical Medicine and Hygiene Am J Trop Med Hyg 70, 1; 10.4269/ajtmh.2004.70.89

Authors’ addresses: Barbara W. Johnson, Trudy V. Chambers, Mary B. Crabtree, and Barry R. Miller, Division of Vector-Borne Infectious Diseases, National Center for Infectious Diseases, Centers for Disease Control and Prevention, Rampart Road, Foothills Campus, Fort Collins, CO 80521, Telephone: 970-266-3543, Fax: 970-221-6476, E-mail: bfj9@cdc.gov. Farshad Guirakhoo and Thomas P. Monath, Acambis, Inc., 38 Sidney Street, Cambridge, MA 02139.

Financial support: This work was supported by an Industry Challenge Grant (1 UC 1 AI-49517-01) from the National Institute of Allergy and Infectious Diseases, National Institutes of Health, and by Aventis Pasteur. Barbara W. Johnson was supported by an American Society of Microbiology/National Center for Infectious Diseases postdoctoral research fellowship. Trudy V. Chambers was supported by an Acambis/CDC cooperative agreement.

REFERENCES

  • 1

    Gubler DJ, 1988. Dengue. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Boca Raton, FL: CRC Press, 223–260.

  • 2

    Gubler DJ, 1998. Dengue and dengue hemorrhagic fever. Clin Microbiol Rev 11 :480–496.

  • 3

    Koraka P, Zeller H, Niedrig M, Osterhaus AD, Groen J, 2002. Reactivity of serum samples from patients with a flavivirus infection measured by immunofluorescence assay and ELISA. Microbes Infect 4 :1209–1215.

    • Search Google Scholar
    • Export Citation
  • 4

    Gubler DJ, 1998. The global pandemic of dengue/dengue haemorrhagic fever: current status and prospects for the future. Ann Acad Med Singapore 27 :227–234.

    • Search Google Scholar
    • Export Citation
  • 5

    Division of Disease Prevention and Control CDP, 1997. Re-emergence of dengue in the Americas. Epidemiol Bull 18 :1–6.

  • 6

    Gubler DJ, 1998. Epidemic dengue and dengue hemorrhagic fever: a global public health problem in the 21st century. Scheld W, Armstrong D, Hughes J, eds. Emerging Infections. Washington, DC: American Society for Microbiology Press, 1–14.

  • 7

    Monath TP, 1994. Dengue: the risk to developed and developing countries. Proc Natl Acad Sci USA 91 :2395–2400.

  • 8

    Rothman AL, Ennis FA, 1999. Immunopathogenesis of dengue hemorrhagic fever. Virology 257 :1–6.

  • 9

    Porterfield JS, 1986. Antibody-dependent enhancement of viral infectivity. Adv Virus Res 31 :335–355.

  • 10

    Tirado SM, Yoon KJ, 2003. Antibody-dependent enhancement of virus infection and disease. Viral Immunol 16 :69–86.

  • 11

    Gubler DJ, Clark GG, 1995. Dengue/dengue hemorrhagic fever: the emergence of a global health problem. Emerg Infect Dis 1 :55–57.

  • 12

    Chambers TJ, Nestorowicz A, Mason PW, Rice CM, 1999. Yellow fever/Japanese encephalitis chimeric viruses: construction and biological properties. J Virol 73 :3095–3101.

    • Search Google Scholar
    • Export Citation
  • 13

    Guirakhoo F, Zhang ZX, Chambers TJ, Delagrave S, Arroyo J, Barrett AD, Monath TP, 1999. Immunogenicity, genetic stability, and protective efficacy of a recombinant, chimeric yellow fever-Japanese encephalitis virus (ChimeriVax-JE) as a live, attenuated vaccine candidate against Japanese encephalitis. Virology 257 :363–372.

    • Search Google Scholar
    • Export Citation
  • 14

    Monath TP, Soike K, Levenbook I, Zhang ZX, Arroyo J, Delagrave S, Myers G, Barrett AD, Shope RE, Ratterree M, Chambers TJ, Guirakhoo F, 1999. Recombinant, chimaeric live, attenuated vaccine (ChimeriVax) incorporating the envelope genes of Japanese encephalitis (SA14–14–2) virus and the capsid and nonstructural genes of yellow fever (17D) virus is safe, immunogenic and protective in non-human primates. Vaccine 17 :1869–1882.

    • Search Google Scholar
    • Export Citation
  • 15

    Guirakhoo R, Weltzin R, Chambers T, Zhang Z-X, Soike K, Ratterree M, Arroyo J, Georgakopoulos K, Catalan J, Monath T, 2000. Recombinant chimeric yellow fever-dengue type 2 virus is immunogenic and protective in nonhuman primates. J Virol 74 :5477–5485.

    • Search Google Scholar
    • Export Citation
  • 16

    Guirakhoo F, Arroyo J, Pugachev KV, Miller C, Zhang ZX, Weltzin R, Georgakopoulos K, Catalan J, Ocran S, Soike K, Ratterree M, Monath TP, 2001. Construction, safety, and immunogenicity in nonhuman primates of a chimeric yellow fever-dengue virus tetravalent vaccine. J Virol 75 :7290–7304.

    • Search Google Scholar
    • Export Citation
  • 17

    Arroyo J, Miller CA, Catalan J, Monath TP, 2001. Yellow fever vector live-virus vaccines. West Nile virus vaccine development. Trends Mol Med 7 :350–354.

    • Search Google Scholar
    • Export Citation
  • 18

    Arroyo J, Guirakhoo F, Fenner S, Zhang ZX, Monath TP, Chambers TJ, 2001. Molecular basis for attenuation of neurovirulence of a yellow fever virus/Japanese encephalitis virus chimera vaccine (ChimeriVax-JE). J Virol 75 :934–942.

    • Search Google Scholar
    • Export Citation
  • 19

    Monath TP, 2001. Prospects for development of a vaccine against the West Nile virus. Ann N Y Acad Sci 951 :1–12.

  • 20

    Monath TP, Arroyo J, Miller C, Guirakhoo F, 2001. West Nile virus vaccine. Curr Drug Targets Infect Disord 1 :37–50.

  • 21

    Monath TP, 1991. Yellow fever: Victor, Victoria? conqueror, conquest? Epidemics and research in the last forty years and prospects for the future. Am J Trop Med Hyg 45 :1–43.

    • Search Google Scholar
    • Export Citation
  • 22

    Marianneau P, Georges-Courbot M, Deubel V, 2001. Rarity of adverse effects after 17D yellow-fever vaccination. Lancet 358 :84–85.

  • 23

    Whitman L, 1939. Failure of Aedes aegypti to transmit yellow fever cultured virus (17D). Am J Trop Med 19 :19–26.

  • 24

    Bhatt TR, Crabtree MB, Guirakhoo F, Monath TP, Miller BR, 2000. Growth characteristics of the chimeric Japanese encephalitis virus vaccine candidate, ChimeriVax-JE (YF/JE SA14–14–2), in Culex tritaeniorhynchus, Aedes albopictus, and Aedes aegypti mosquitoes. Am J Trop Med Hyg 62 :480–484.

    • Search Google Scholar
    • Export Citation
  • 25

    Johnson BW, Chambers TV, Crabtree MB, Bhatt TR, Guirakhoo F, Monath TP, Miller BR, 2002. Growth characteristics of ChimeriVax-DEN-2 vaccine virus in Aedes aegypti and Aedes albopictus mosquitoes. Am J Trop Med Hyg 67 :260–265.

    • Search Google Scholar
    • Export Citation
  • 26

    Johnson BW, Chambers TV, Crabtree MB, Arroyo J, Monath TP, Miller BR, 2003. Growth characteristics of the veterinary vaccine candidate ChimeriVax™-West Nile (WN) virus in Aedes and Culex mosquitoes. Med Vet Entomol 17 :235–243.

    • Search Google Scholar
    • Export Citation
  • 27

    Guirakhoo F, Pugachev K, Arroyo J, Miller C, Zhang ZX, Weltzin R, Georgakopoulos K, Catalan J, Ocran S, Draper K, Monath TP, 2002. Viremia and immunogenicity in nonhuman primates of a tetravalent yellow fever-dengue chimeric vaccine: genetic reconstructions, dose adjustment, and antibody responses against wild-type dengue virus isolates. Virology 298 :146–159.

    • Search Google Scholar
    • Export Citation
  • 28

    Miller BR, Mitchell CJ, Ballinger ME, 1989. Replication, tissue tropisms and transmission of yellow fever virus in Aedes albopictus. Trans R Soc Trop Med Hyg 83 :252–255.

    • Search Google Scholar
    • Export Citation
  • 29

    Lanciotti RS, Kerst AJ, Nasci RS, Godsey MS, Mitchell CJ, Savage HM, Komar N, Panella NA, Allen BC, Volpe KE, Davis BS, Roehrig JT, 2000. Rapid detection of West Nile virus from human clinical specimens, field-collected mosquitoes, and avian samples by a TaqMan reverse transcriptase-PCR assay. J Clin Microbiol 38 :4066–4071.

    • Search Google Scholar
    • Export Citation
  • 30

    Rosen L, Roseboom LE, Gubler DJ, Lien JC, Chaniotis BN, 1985. Comparative susceptibility of mosquito species and strains to oral and parenteral infection with dengue and Japanese encephalitis viruses. Am J Trop Med Hyg 34 :603–615.

    • Search Google Scholar
    • Export Citation
  • 31

    Miller BR, 1987. Increased yellow fever virus infection and dissemination rates in Aedes aegypti mosquitoes orally exposed to freshly grown virus. Trans R Soc Trop Med Hyg 81 :1011–1012.

    • Search Google Scholar
    • Export Citation
  • 32

    Weaver SC, Lorenz LH, Scott TW, 1993. Distribution of western equine encephalomyelitis virus in the alimentary tract of Culex tarsalis (Diptera: Culicidae) following natural and artificial blood meals. J Med Entomol 30 :391–397.

    • Search Google Scholar
    • Export Citation
  • 33

    Turell MJ, Spring AR, Miller MK, Cannon CE, 2002. Effect of holding conditions on the detection of West Nile viral RNA by reverse transcriptase-polymerase chain reaction from mosquito (Diptera: Culicidae) pools. J Med Entomol 39 :1–3.

    • Search Google Scholar
    • Export Citation
  • 34

    Kramer LD, Chiles RE, Do TD, Fallah HM, 2001. Detection of St. Louis encephalitis and western equine encephalomyelitis RNA in mosquitoes tested without maintenance of a cold chain. J Am Mosq Control Assoc 17 :213–215.

    • Search Google Scholar
    • Export Citation
  • 35

    Armstrong PM, Rico-Hesse R, 2001. Differential susceptibility of Aedes aegypti to infection by the American and Southeast Asian genotypes of dengue type 2 virus. Vector Borne Zoonotic Dis 1 :159–168.

    • Search Google Scholar
    • Export Citation
  • 36

    Gubler DJ, Rosen L, 1976. A simple technique for demonstrating transmission of dengue virus by mosquitoes without the use of vertebrate hosts. Am J Trop Med Hyg 25 :146–150.

    • Search Google Scholar
    • Export Citation
  • 37

    Durbin AP, Karron RA, Sun W, Vaughn DW, Reynolds MJ, Perreault JR, Thumar B, Men R, Lai CJ, Elkins WR, Chanock RM, Murphy BR, Whitehead SS, 2001. Attenuation and immunogenicity in humans of a live dengue virus type-4 vaccine candidate with a 30 nucleotide deletion in its 3′-untranslated region. Am J Trop Med Hyg 65 :405–413.

    • Search Google Scholar
    • Export Citation
  • 38

    Gubler DJ, Suharyono W, Tan R, Abidin M, Sie A, 1981. Viraemia in patients with naturally acquired dengue infection. Bull World Health Organ 59 :623–630.

    • Search Google Scholar
    • Export Citation
  • 39

    Chambers TJ, Hahn CS, Galler R, Rice CM, 1990. Flavivirus genome organization, expression, and replication. Annu Rev Microbiol 44 :649–688.

    • Search Google Scholar
    • Export Citation
  • 40

    Lindenbach B, Rice C, 2001. Flaviviridae: the viruses and their replication. Knipe D, Howley P, eds. Fields Virology. Philadelphia: Lipincott William and Wilkins, 991–1043.

Save