INTRODUCTION
Diarrheal diseases are a leading cause of morbidity and mortality in developing countries. Besides the classic pathogens Shigella, Salmonella, Yersinia, Vibrio, and Campylobacter spp., at least five different categories of Escherichia coli may cause diarrhea worldwide: enterotoxigenic E. coli (ETEC), enterohemorrhagic E. coli (EHEC), enteropathogenic E. coli (EPEC), enteroinvasive E. coli (EIEC), and enteroaggregative E. coli (EAEC). The associated clinical pictures comprise childhood and traveler’s diarrhea (ETEC), bloody diarrhea and hemolytic uremic syndrome (EHEC), infantile diarrhea (EPEC), and bacillary dysentery-like diarrhea (EIEC). Enteroaggregative E. coli have been associated with acute and persistent diarrhea in children and adults in industrial and developing countries in Europe, America, Asia, and Africa.1–5
Diarrheagenic E. coli produce toxins or possess certain virulence traits. Enterotoxigenic E. coli and EHEC produce toxins, i.e., heat-labile (LT) and/or heat-stable toxin (ST) and shiga-like toxins I and II (SLT I/II), respectively. Enteroinvasive E. coli typically invade and destroy the bowel mucosa. Enteropathogenic E. coli damage the bowel mucosa with characteristic attaching and effacing lesions mediated by a protein encoded by a gene called the attaching and effacing locus (eal). The epidemiology and pathogenicity of EAEC are less clear, but are associated with the presence of a large 60-kD plasmid encoding different virulence factors and toxins. Enteroaggregative E. coli are distinct in their adherence pattern with a so-called stack-brick adherence to Hep-2 cells.6 In addition, EAEC may harbor additional virulence factors including fimbriae I and II (AAFI and AAFII), an ST-like enterotoxin (EAST), and a plasmid-encoded heat-labile toxin (PET) that are involved in aggregation and pathogenesis of associated diarrhea.6
The aim of the present study was to investigate the presence and the frequency of diarrheagenic E. coli in children with diarrhea in Gabon. Stool samples of 150 children with diarrhea were cultured for E. coli, which were then screened for EPEC, EIEC, EHEC, ETEC, and EAEC using a polymerase chain reaction (PCR) and cell culture. When diarrheagenic E. coli were detected, further characterization for virulence factors and resistance patterns was carried out.
PATIENTS AND METHODS
Patients.
Stool specimens were collected from 150 children who presented to the outpatient clinic of the Albert-Schweitzer-Hospital in Lambaréné, Gabon with diarrhea in autumn of 1997. The Ethics Committee of the International Foundation of the Albert Schweitzer Hospital, Lambaréné, Gabon reviewed and approved the study. The parents were asked for and provided informed consent for participation of their children in the study. A case of diarrhea was defined as a history of more than one stool of liquid consistency, or three or more stools of loose consistency, during the previous 24 hours. Severe diarrhea was defined as more than three watery stools plus signs of dehydration (reduced consciousness, sunken eyes, dryness of mucous membranes, thirst, skin turgor). Symptoms including indicators of gastroenteritis (vomiting, abdominal pain, blood in the stools) were recorded on charts. Fever was defined as an oral temperature > 37.8°C. Children whose diarrhea could be attributed to classic pathogens including Salmonella, Shigella, or Campylobacter spp. or gross infestation of parasites were excluded from the study. A thick blood smear was prepared for all children. When Plasmodium falciparum malaria was diagnosed in the blood smear children received a standard treatment regimen with sulfadoxine/pyrimethamine (Fansidar®; F. Hoffmann La Roche, Basel, Switzerland).
Microbiologic methods.
Fresh stools specimens obtained from patients were macroscopically examined for blood and mucus. Samples from these stools were placed into the Cary-Blair transport medium, which was refrigerated on the day of collection and transported within seven days to Austria. There, all specimens were cultured for E. coli and, to exclude classic bacterial pathogens, for Salmonella, Shigella, Vibrio cholerae, and Campylobacter spp. using standard methods.
Five individual lactose-fermenting colonies resembling E. coli were then inoculated into brain heart infusion broth with 2% glycerol added, and the samples were stored at −70°C. In five patients no colony resembling E. coli was isolated from the stool sample.
Polymerase chain reaction assays.
The PCR for diarrheagenic E. coli were performed only in patients whose stools grew E. coli. To detect EHEC, ETEC, EIEC, and EPEC, PCR assays were performed using the primers shown in Table 1. To detect EAEC, a cell culture technique and five PCR assays were performed. DNA was isolated from whole organisms by boiling. Bacteria were harvested from an overnight broth culture, suspended in 1 mL of sterile water, and incubated at 100°C for 10 minutes. Following centrifugation of the lysate, 1 μL of the supernatant was used in the PCRs. For the PCR mixes, each of the primers was used at a concentration of 0.1 mM, with 0.2 mM of each deoxynucleoside triphosphate, 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2, and one unit of Taq DNA polymerase (PCR Core Kit, Roche Applied Science, Mannheim, Germany). For further characterization of EAEC, PCRs to detect genes of the EAEC-associated plasmid pCVD432, the aggregative adherence fimbriae I and II genes (AAFI/II), the S-like enterotoxin EAST, and the autotransporter enterotoxin PET were performed using the primer pairs listed in Table 1.
HEp-2 adherence assay to detect EAEC.
The patterns of adherence of EAEC were examined by a method described by Nataro and others.7 Briefly, HEp-2 cells were grown overnight in 50% confluent monolayers on glass cover slips in 24-well tissue cultures dishes. After the spent medium was discarded, 50 μL of overnight Luria broth bacterial culture plus 1 mL of fresh Eagle’s minimal essential medium (GIBCO/BRL, Gaithersburg, MD) with 0.5% d-mannose was added to each well and incubated for three hours at 37°C in an atmosphere of 5% CO2. After incubation, cells were washed twice with phosphate-buffered saline, fixed with 70% methanol for five minutes, and stained with 10% Giemsa for 15 minutes. Cover slips were examined under oil immersion light microscopy for the characteristic stacked brick aggregation on HEp-2 cells by two microscopists. The reference strains, RKI 17-2 for EAEC, DSM 8698 for EPEC, and ATCC 25922 for non-pathogenic E. coli, served as controls.
Antibiotic susceptibility testing.
Antimicrobial susceptibility testing was performed using the Bauer-Kirby method according to protocols of the National Committee for Clinical Laboratory Standards (Wayne, PA). The E. coli strain ATCC 25922 was included as a quality control in all assays.
Statistical analysis.
The data were analyzed with SSPS version 11.0 software (SPSS, Inc., Chicago, IL). Percentages were compared using a Pearson chi-square test for dependent samples or Fisher’s exact test when appropriate. Means were compared using the Student’s t-test for dependent samples.
RESULTS
One hundred fifty children (69 males and 81 females, median age = 2 years, age range = 1 month to 11 years) with diarrhea were included. In one patient, S. enteridis was isolated, and in five patients E. coli were not cultured from the stool samples. These six patients were excluded from further analysis.
Overall, 57 EAEC and seven ETEC were detected in 725 E. coli colonies tested. In two patients, EAEC and ETEC were concomitant pathogens, detected from different colonies of the same patient. Isolates of EIEC, EHEC, and EPEC were not detected. In 82 patients, no pathogenic E. coli was identified. The demography and the clinical symptoms of the patients are shown in Table 2. Most children (n = 91) had mild to moderate diarrhea, 47 had severe diarrhea, and five had bloody diarrhea. The incidence of bloody or severe diarrhea and vomiting in patients with EAEC was not different from the incidence of these symptoms in patients with ETEC, malaria, or without any pathogen. An increased body temperature > 37.8°C was present in 66 patients and was not different in patients with EAEC, ETEC, or malaria (mean = 37.7°C, 38.0°C, and 38.2°C, respectively).
Isolates of EAEC was detected in 57 patients by the HEp-2 cell assay. The cell assay was not applicable in one patient because the assay repeatedly resulted in total cytolysis. Thirty-seven children with EAEC were between six months and two years old; only five children were younger than six months of age. These infants were exclusively breastfed. Isolates of EAEC was not significantly more frequent in children with malaria than in children without malaria. To characterize EAEC, we looked for the presence of the pCVD432 plasmid and other virulence factors: the adhesion-associated fimbriae AAF I and II and the toxins EAST and PET. The fimbriae AAF I and AAF II and the toxins EAST and PET were detected in children with and without EAEC (Table 3). The presence of the pCVD432 plasmid and the EAST toxin were significantly associated with the typical appearance of EAEC in the HEp-2 cell assay (P < 0.05). Although detected only in few patients, the presence of the AAF fimbriae I (aagA) and II (aafA) were more likely in patients with EAEC than in those with non-EAEC (odds ratio [OR] = 4.1, 95% confidence interval [CI] = 0.5–38.6 and OR = 2.3, 95% CI = 1.0–5.3, respectively). The presence of the PET toxin was also associated with EAEC and significantly more common in children with EAEC than in children without EAEC (42 of 57 [74%] versus 43 of 82 [53%]; P < 0.05). The sensitivity and specificity of the HEp-2 cell assay were 33% and 100% for pCVD432 plasmid, 59% and 75% for EAST, and 94% and 83% for both, respectively. The EAEC isolates exhibited increased resistance to ampicillin, trimethoprim, and tetracycline (Table 4).
Isolates of ETEC was detected in five patients as the singular pathogen and in another two patients in addition to EAEC. Children with ETEC were significantly older than children with EAEC (Table 2; P < 0.05). Only one patient with ETEC had severe and bloody diarrhea. Although three children with ETEC had a fever up to 40.4°C, none of these children with ETEC had malaria. In 29 children, the thick blood smear revealed P. falciparum (median parasitemia = 12,288 parasites/μL).
DISCUSSION
Enteroaggregative E. coli is a diarrheal pathogen of emerging importance. However, there are still questions about EAEC epidemiology and pathogenesis. These type of E. coli harbor 60-kD plasmids (pCVD432) encoding toxins and virulence factors that vary in intensity and combination worldwide.8 It has been hypothesized that the combination of these genes increases strain virulence.9–11 The varying presence of the different virulence factors indicates heterogeneity of the EAEC isolates.9 The EAST toxin was present in 22.1% of children with diarrhea in Nigeria, in 38.8% in Iran, and in 59% of the children in the present study.12,13 In another study the fimbriae AAF I and II and the PET toxin were most frequently detected and associated with diarrhea and inflammation.8,10 In the present study, the pCVD432, PET, and EAST sequences were detected in 19, 42, and 34 patients, respectively, in whom EAEC was detected by the HEp-2 test, and were significantly associated with EAEC. However, as previously described, EAST and PET were also detected in 11 of 82 (13%) and 43 of 82 (53%) patients without EAEC, respectively.14 The toxins EAST and PET seem to be common in the E. coli population and not restricted to EAEC. However, they are more common in EAEC, and their contribution to EAEC virulence and diarrhea is still unclear. There was no significant association between malaria and EAEC. The pCVD432 plasmid, which is one of the characteristics of EAEC, can be detected either by hybridization or PCR. The PCR assay with primers derived from the probe sequence has a sensitivity and specificity similar to that of the original probe assay.15 The correlation of the pCVD432 PCR and HEp-2 cell assay was confirmed in children with acute diarrhea in Calcutta.16 In the present study, the combined PCR detection of pCVD432 and EAST resulted in a sensitivity and specificity of 94% and 83%, respectively. Although the HEp-2 test is still the method of choice, the PCR may be used to detect characteristics of EAEC in a population when the frequency of the respective virulence factors is known.
Although EAEC have been associated with diarrhea in children in Africa, the role of EAEC in diarrhea has been controversial.9,17,18 In studies from Djibouti and Bangladesh, EAEC were not significantly associated with diarrhea.17,19 However, in children between six months and 12 years of age, EAEC were significantly associated with diarrhea.9,18 In the present study, EAEC were detected in 57 of 150 children with diarrhea. Similar to the results of the study of Okeke and others,9 other diarrheagenic E. coli were rarely detected (ETEC in seven patients) or not at all. Likewise, diarrhea due to EAEC was more common in children older than six months of age. The explanation may be that children less than six months old are usually breastfed in the Lambaréné region.20 In the present study, all children up to six months of age (n = 37) were exclusively breastfed. Enterotoxigenic E. coli were established as causative pathogen of diarrhea in developing and developed countries.6,18 In the present study, ETEC was detected in only seven children. Diarrhea due to ETEC was accompanied by high fever. It was surprising that a patient had bloody diarrhea with ETEC; thus, another pathogen must have been missed since ETEC do not cause damage to the mucosa. However, due to the small number of patients, a significant association between fever and ETEC cannot be demonstrated, even when corrected for the two patients who had a concurrent infection with EAEC.
Isolates of EAEC exhibited increased resistance to standard antibiotics such as ampicillin, trimethoprim, and tetracycline, as previously reported.9,10 It has been explained that the increased antibiotic resistance was due to a readiness for transfer of antibiotic resistance via conjugation probably encoded by the pCVD plasmid.10
In conclusion, diarrheagenic E. coli contribute to the burden of diarrhea of Gabonese children. Isolates of EAEC were found in 57 of 150 Gabonese children with diarrhea with a peak incidence between those six months to two years of age. These EAEC displayed increased resistance against standard antibiotics such as ampicillin, tetracycline, and trimethoprim. Other characteristics and virulence markers in this population were the presence of the plasmid pCVD432 and the toxins PET and EAST.
Polymerase chain reaction (PCR) primers used in this study*
| Pathogen | Gene | Size of product (basepairs) | PCR primers | Reference strain | Reference |
|---|---|---|---|---|---|
| * ETEC = enterotoxigenic Escherichia coli; EAEC = enteroaggregative E coli; EHEC = enterohemorrhagic E. coli; EPEC = enteropathogenic E. coli; EIEC = enteroinvasive E. coli. | |||||
| ETEC | Heat-labile toxin (LT) | 450 | a) CGCGACAGATTATACCGTGC | ATCC 37218 | 21 |
| b) CGGTCTCTATATTCCCTGCTGTT | |||||
| Heat-stable toxin (ST) | 190 | a) TTTTT(AC)TTTCTGTATT(AG)TCTT | ATCC 43896 | 21 | |
| b) CACCCGGTACA(AC)GCAGGATT | |||||
| EAEC | pCVD432 | 630 | a) CTGGCGAAAGACATCAT | RKI17-2 | 15 |
| b) CAATGTATAGAAATCCGCTGTT | |||||
| Heat-stable enterotoxin (EAST) | 116 | a) TGCCATCAACACAGTATATCC | 5 | ||
| b) TAGGATCCTCAGGTCGCGAGTGACGGC | |||||
| Plasmid-encoded heat-labile toxin (pet) | 599 | a) GACCATGACCTATACCGACAGC | 22 | ||
| b) CCGATTTCTCAAACTCAAGACC | |||||
| Fimbriae AAFI (aggA) | 457 | a) TTAGTCTTCTACTTTATTAT | 23 | ||
| b) AAATTAATTCCGGCATGG | |||||
| Fimbriae AAF II (aafA) | 633 | a) AGCCTGTTCCGTTCTTCC | 24 | ||
| b) ACCTCTGTCACTGTGTATCACC | |||||
| EHEC | Shiga-like toxin I (SLT-I) | 894 | a) CAGTTAATGTGGTGGCGAAG | CCUG 19197 | 25 |
| b) CTGCTAATACTTCTGCGCATC | |||||
| Shiga-like toxin II (STL-II) | 478 | a) CTTCGGTATCCTATTCCCGG | CCUG 29199 | 25 | |
| b) GGATGCATCTCTGGTCATTG | |||||
| EPEC | Attaching and effacing locus (eaf) | 397 | a) CAGGGTAAAAGAAAGATGATAA | DSM 8698 | 26 |
| b) TATGGGGACGTATTATCA | |||||
| EIEC | Invasion-associated locus (ial) | 320 | a) CTGGATGGTATGGTGAGG | ATCC 8704 | 27 |
| b) GGAGGCCAATTATTTCC | |||||
Demographic data of the study population*
Frequencies of phenotypes and virulence factors among the enteroaggregative Escherichia coli*
Antibiotic susceptibility enteroaggregative Escherichia coli
| Antibiotic | Susceptible no. (%) |
|---|---|
| Ampicillin | 18 (32) |
| Cefamandole | 50 (87) |
| Cefotaxime | 57 (100) |
| Imipenem | 57 (100) |
| Gentamicin | 57 (100) |
| Tetracycline | 14 (25) |
| Trimethoprim | 24 (42) |
| Ciprofloxacin | 57 (100) |
Authors’ addresses: Elisabeth Presterl, Ralph H. Zwick, Sonja Reichmann, Alexander Aichelburg, and Wolfgang Graninger, Department of Medicine I, Division of Infectious Diseases, University of Vienna, AKH, Waehringer Guertel 18-20, 1090 Vienna, Austria, Telephone: 431-40400-4440, Fax: 43-1-40400-4418, E-mails: elisabeth.presterl@akh-wien.ac.at, sonja.reichmann@akh-wien.ac.at, and wolfgang.graninger@akh-wien.ac.at. Stefan Winkler, Department of Medicine I, Division of Infectious Diseases, University of Vienna, AKH, Waehringer Guertel 18-20, 1090 Vienna, Austria, and Medical Research Unit, Albert Schweitzer Hospital, Lambaréné, Gabon, Telephone: 43-1-40400-4440, Fax: 43-1-40400-4418, E-mail: stefan.winkler@akh-wien.ac.at. Peter G. Kremsner, Department of Parasitology, Institute for Tropical Medicine, University of Tuebingen, Wilhelmstraße 27, 72074 Tübingen, Germany and Medical Research Unit, Albert Schweitzer Hospital, Lambaréné, Gabon, Telephone: 49-7071/ 29-8 71 79, Fax: 49-70 71/ 29-51 89, E-mail: peter.kremsner@uni-tuebingen.de.
Financial support: This study was supported by the Austrian Society of Chemotherapy.
REFERENCES
- 1↑
Bhatnagar S, Bhan MK, Sommerfelt H, Sazawal S, Kumar R, Saini S, 1993. Enteroaggregative Escherichia coli may be a new pathogen causing acute and persistent diarrhea. Scand J Infect Dis 25 :579–583.
- 2
Gascon J, Vargas M, Quinto L, Corachan M, Jimenez de Anta MT, Vila J, 1998. Enteroaggregative Escherichia coli strains as a cause of traveler’s diarrhea: a case-control study. J Infect Dis 177 :1409–1412.
- 3
Oberhelman RA, Laborde D, Mera R, Starszak E, Saunders P, Mirza A, Bessinger GT, Hull A, 1998. Colonization with enteroadherent, enterotoxigenic and enterohemorrhagic Escherichia coli among day-care center attendees in New Orleans, Louisiana. Pediatr Infect Dis J 17 :1159–1162.
- 4
Presterl E, Nadrchal R, Wolf D, Rotter M, Hirschl AM, 1999. Enteroaggregative and enterotoxigenic Escherichia coli among isolates from patients with diarrhea in Austria. Eur J Clin Microbiol Infect Dis 18 :209–212.
- 5↑
Savarino SJ, Fasano A, Watson J, Martin BM, Levine MM, Guandalini S, Guerry P, 1993. Enteroaggregative Escherichia coli heat-stable enterotoxin 1 represents another subfamily of E. coli heat-stable toxin. Proc Natl Acad Sci USA 90 :3093–3097.
- 7↑
Nataro JP, Deng Y, Maneval DR, German AL, Martin WC, Levine MM, 1992. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect Immun 60 :2297–2304.
- 8↑
Jiang ZD, Greenberg D, Nataro JP, Steffen R, DuPont HL, 2002. Rate of occurrence and pathogenic effect of enteroaggregative Escherichia coli virulence factors in international travelers. J Clin Microbiol 40 :4185–4190.
- 9↑
Okeke IN, Lamikanra A, Czeczulin J, Dubovsky F, Kaper JB, Nataro JP, 2000. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in southwest Nigeria. J Infect Dis 181 :252–260.
- 10↑
Greenberg DE, Jiang ZD, Steffen R, Verenker MP, DuPont HL, 2002. Markers of inflammation in bacterial diarrhea among travelers, with a focus on enteroaggregative Escherichia coli pathogenicity. J Infect Dis 185 :944–949.
- 11↑
Czeczulin JR, Whittam TS, Henderson IR, Navarro-Garcia F, Nataro JP, 1999. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli.Infect Immun 67 :2692–2699.
- 12↑
Okeke IN, Lamikanra A, Steinruck H, Kaper JB, 2000. Characterization of Escherichia coli strains from cases of childhood diarrhea in provincial southwestern Nigeria. J Clin Microbiol 38 :7–12.
- 13↑
Bouzari S, Jafari MN, Shokouhi F, Parsi M, Jafari A, 2000. Virulence-related DNA sequences and adherence patterns in strains of enteropathogenic Escherichia coli.FEMS Microbiol Lett 185 :89–93.
- 14↑
Vila J, Gene A, Vargas M, Gascon J, Latorre C, Jimenez de Anta MT, 1998. A case-control study of diarrhoea in children caused by Escherichia coli producing heat-stable enterotoxin (EAST-1). J Med Microbiol 47 :889–891.
- 15↑
Schmidt H, Knop C, Franke S, Aleksic S, Heesemann J, Karch H, 1995. Development of PCR for screening of enteroaggregative Escherichia coli.J Clin Microbiol 33 :701–705.
- 16↑
Dutta S, Pal S, Chakrabarti S, Dutta P, Manna B, 1999. Use of PCR to identify enteroaggregative Escherichia coli as an important cause of acute diarrhoea among children living in Calcutta, India. J Med Microbiol 48 :1011–1016.
- 17↑
Mikhail IA, Fox E, Haberberger RL, Ahmed MH, Abbatte EA, 1990. Epidemiology of bacterial pathogens associated with infectious diarrhea in Djibouti. J Clin Microbiol 28 :956–961.
- 18↑
Ogunsanya TI, Rotimi VO, Adenuga A, 1994. A study of the aetiological agents of childhood diarrhoea in Lagos, Nigeria. J Med Microbiol 40 :10–14.
- 19↑
Albert MJ, Faruque AS, Faruque SM, Sack RB, Mahalanabis D, 1999. Case-control study of enteropathogens associated with childhood diarrhea in Dhaka, Bangladesh. J Clin Microbiol 37 :3458–3464.
- 20↑
Luckner D, Lell B, Greve B, Lehman LG, Schmidt-Ott RJ, Matousek P, Herbich K, Schmid D, Mba R, Kremsner PG, 1998. No influence of socioeconomic factors on severe malarial anaemia, hyperparasitaemia or reinfection. Trans R Soc Trop Med Hyg 92 :478–481.
- 21↑
Stacy-Phipps S, Mecca JJ, Weiss JB, 1995. Multiplex PCR assay and simple preparation method for stool specimens detect enterotoxigenic Escherichia coli DNA during course of infection. J Clin Microbiol 33 :1054–1059.
- 22↑
Eslava C, Navarro-Garcia F, Czeczulin JR, Henderson IR, Cravioto A, Nataro JP, 1998. Pet, an autotransporter enterotoxin from enteroaggregative Escherichia coli.Infect Immun 66 :3155–3163.
- 23↑
Vila J, Vargas M, Henderson IR, Gascon J, Nataro JP, 2000. Enteroaggregative Escherichia coli virulence factors in traveler’s diarrhea strains. J Infect Dis 182 :1780–1783.
- 24↑
Elias WPJ, Czeczulin JR, Henderson IR, Trabulsi LR, Nataro JP, 1999. Organization of biogenesis genes for aggregative adherence fimbria II defines a virulence gene cluster in enteroaggregative Escherichia coli. J Bacteriol 181 :1779–1785.
- 25↑
Olsvik O, Strockbine NA, 1993. PCR detection of heat-stable, heat-labile, and shiga-like toxin genes in Escherichia coli. Persing DH, Smith TF, Tenover FC, White TC, eds. Diagnostic Molecular Microbiology. Washington, DC: American Society for Microbiology Press, 271–276.
- 26↑
Franke J, Franke S, Schmidt H, Schwarzkopf A, Wieler LH, Baljer G, Beutin L, Karch H, 1994. Nucleotide sequence analysis of enteropathogenic Escherichia coli (EPEC) adherence factor probe and development of PCR for rapid detection of EPEC harboring virulence plasmids. J Clin Microbiol 32 :2460–2463.
- 27↑
Schoolnik GK, 1993. PCR detection of Shigella species and enteroinvasive Escherichia coli. Persing DH, Smith HR, Tenover FC, White TC, eds. Diagnostic Molecular Microbiology. Washington, DC: American Society for Microbiology Press, 277–281.