Zoonotic malaria remains a public health concern, posing a major threat to malaria elimination in Southeast Asia.1 In Malaysia, where human malaria transmission has been steadily controlled through long-term public health efforts to the point of elimination, the prevalence of zoonotic malaria has increased.2,3 Although Plasmodium knowlesi causes most reported cases of zoonotic malaria, several cases of zoonotic P. cynomolgi infection have been reported in both Peninsular and East Malaysia,4–6 Thailand, and Cambodia.7–9 Interestingly, P. cynomolgi human infections are commonly reported as co-infections with P. knowlesi.6–8
Plasmodium cynomolgi and P. knowlesi share natural monkey hosts, including the long-tailed (Macaca fascicularis) and pig-tailed (Macaca nemestrina) macaques,10 which share an overlapping geographic distribution across large areas of Southeast Asia.10 Plasmodium cynomolgi and P. knowlesi co-infections are common in macaques and mosquitos.11–13 Importantly, within M. fascicularis populations in Southeast Asia, P. cynomolgi is more prevalent and widely distributed than any other macaque Plasmodium species (Plasmodium inui, Plasmodium fieldi, and Plasmodium coatneyi), albeit with some geographical heterogeneity in Plasmodium species composition.14
Morphologically, P. cynomolgi asexual stages are indistinguishable from those of the human parasite P. vivax under standard light microscopy diagnosis.10 In addition, both species are genetically similar, with P. cynomolgi DNA cross-reacting with the primers in the commonly used P. vivax–specific nested 18S small subunit ribosomal ribonucleic acid (ssu rRNA) assay, although P. cynomolgi–specific primers do not amplify P. vivax.4,8 Like P. vivax, human infection with P. cynomolgi could also result in the formation of the dormant hypnozoite liver stage that causes relapses seen in natural macaque hosts.10 Owing to a limited number of studies and technical diagnostic constraints, even with molecular tools, it is unclear if the occurrence and potential public health threat of zoonotic P. cynomolgi is largely underreported.
In this study, we aimed to detect P. cynomolgi infections retrospectively from patients with symptomatic Plasmodium species infections enrolled in previous studies in Sabah, Malaysia.
To increase the likelihood of detecting P. cynomolgi, we selected available samples from a geographically representative subset of patients with uncomplicated malaria from ongoing hospital-based malaria surveillance studies in Sabah, Malaysia.15–17 Plasmodium species–specific PCR assays on these samples had previously been conducted for P. knowlesi, P. vivax, P. falciparum, P. malariae, and Plasmodium ovale spp. and reported as part of mandatory state-reference laboratory testing on all microscopy-positive case notifications,18 with an initial molecular screening step for Plasmodium genus not conducted.
Samples included 1) those that were PCR positive for single P. knowlesi, P. vivax, P. falciparum, or P. malariae infections and 2) those that were positive for malaria by routine hospital-based microscopy but negative by Plasmodium species–specific PCR (assumed false-positive for notification purposes).
Whole blood samples were collected in Ethylenediaminetetraacetic acid tubes and kept cool until stored at −80°C. To accurately identify Plasmodium species, genomic DNA was extracted from thawed whole blood using QIAamp 96 DNA Mini Blood Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Extracted DNA of confirmed malaria cases with previously conducted PCR19,20 was amplified using a nested PCR assay targeting the 18S ssu rRNA gene, with the nest 1 targeting the Plasmodium genus (rPLU1 and rPLU5 primer), followed by a P. cynomolgi species–specific (CY2F and CY4R primer) nest 2, with an expected limit of detection of approximately 2 parasites/µL.21 (Table 1).
Plasmodium cynomolgi–specific primers
| PCR | Primers | Primer sequence (5′–3′) | Annealing Temp | Reference |
|---|---|---|---|---|
| Nest 1 | rPLU1 | TCAAAGATTAAGCCATGCAAGTGA | 58°C | Snounou and Singh22 |
| rPLU5 | CCTGTTGTTGCCTTAAACTTC | – | – | |
| Nest 2 | CY2F | GATTTGCTAAATTGCGGTCG | 66°C | Lee et al.12 |
| CY4R | CGGTATGATAAGCCAGGGAAGT | – | – |
PCR = polymerase chain reaction.
Nested PCR amplifications were performed for 35 cycles in both rounds with the following cycling conditions: 4 minutes at 94°C for initial denaturation, 30 seconds at 94°C for denaturation, 1 minute at 58°C and 66°C for first and second PCR rounds, respectively, for annealing, and 2 minutes and 1 minute at 72°C for first and second PCR rounds, respectively, for extension, followed by 4 minutes at 72°C for the final extension. Positive P. cynomolgi control amplification was confirmed using 1.5% agarose gel electrophoresis with SYBR™ Safe (Invitrogen, Carlsbad, CA) and viewed using a Molecular Imager® Gel Doc® XR system (Bio-Rad, Hercules, CA). The donated positive P. cynomolgi DNA control included in the assay was derived from an infected macaque source.
There were 2,103 malaria samples included for P. cynomolgi co-infection screening from across all 26 administrative districts in Sabah and the island federal territory of Labuan, in addition to two patients from neighboring Lawas District in Sarawak, Malaysia, from 2010 to 2021. The median number of microscopy-diagnosed malaria cases included from each year was 174 (interquartile range [IQR]: 94–236). The highest number of samples was from the districts of Kota Marudu (17%) and Kudat (16%), followed by Pitas (12%) and Keningau (8%). The median number of available malaria samples from each district was 31 (IQR: 7–93), with eight districts contributing fewer than 10 samples each.
The screened samples comprised 1,425 (68%) P. knowlesi infections, followed by 293 (14%) P. falciparum, 256 (12%) P. vivax, 31 (1%) P. malariae, and 100 (5%) microscopy-positive and PCR species–specific negative (Table 2). Plasmodium cynomolgi was not detected in any of the samples tested. Both positive and negative controls for P. cynomolgi demonstrated appropriate results on gel electrophoresis, supporting reliable conduct of the assay.
Demographic and clinical details
| Variable | Plasmodium Species–Specific PCR Result | |||||
|---|---|---|---|---|---|---|
| Plasmodium knowlesi | Plasmodium vivax | Plasmodium falciparum | Plasmodium malariae | Negative* | Total | |
| Number Tested, N (%) | 1,425 (68) | 254 (12) | 293 (14) | 31 (1) | 100 (5) | 2,103 (100) |
| Male Sex, N (%) | 1,159 (81) | 185 (73) | 223 (76) | 23 (74) | 75 (71) | 1,660 (79) |
| Age, Median Years, (IQR) [range] | 35 (24–49) [2–98] | 24 (14–35) [1–79] | 27 (17–40) [3–78] | 21 (12–28) [5–60] | 25 (16–44) [1–86] | 32 (21–47) [1–98] |
| Parasite Count/µL, Geometric Mean (95% CI), [range] | 1,160 (1,033–1,302) [≤40–792,567] | 3,265 (2,762–3,869) [46–84,403] | 8,087 (6,402–10,214) [≤40–959,383] | 1,324 (753–2,328) [71–12,615] | 623 (491–789) [50–22,222] | – |
IQR = interquartile range; PCR = polymerase chain reaction.
Negative for species-specific PCR, positive on routine microscopy.
In this zoonotic malaria surveillance study, no P. cynomolgi infections were detected in previously confirmed Plasmodium species infections or in those negative on species-specific PCR with likely false-positive microscopy results. Plasmodium cynomolgi infections were not seen despite a large number of geographically diverse samples screened, a range of both low and high parasite counts within each Plasmodium species group, and the addition of a high-risk group of documented microscopy-positive patients with febrile illness negative on species-specific malaria PCR assays. Positive and negative controls worked well, suggesting that the assay used was robust and supported the validity of these findings to the threshold for detection of the assay.
Zoonotic infection with P. cynomolgi is considered a potential public health risk because of the wide distribution of natural macaque hosts with a parasite reservoir maintained by a dormant hypnozoite stage. Although human cases of P. cynomolgi infection have been described,4–6 including in two asymptomatic individuals from 867 samples from a cross-sectional survey conducted in northern Sabah,5 our study did not find evidence of P. cynomolgi infection from a broader geographical area in symptomatic microscopy-positive patients in Sabah.
Several reasons could be attributed to the lack of P. cynomolgi infections found in this study. The prevalence of zoonotic P. cynomolgi infection could be considerably lower than our sample size was powered to accurately detect. Reported human P. cynomolgi infections are undoubtedly of substantially lower prevalence compared with that of P. knowlesi infection in Sabah.5,6 Our findings are consistent with an absence of P. cynomolgi infections in a large longitudinal surveillance study in the Betong Division of Sarawak,23 which contrasted with the detection of small numbers of P. cynomolgi (co-infected with P. knowlesi) in six of 1,047 (0.6%) samples from patients with malaria at Kapit Hospital in Sarawak.6 Nonetheless, human co-infections with P. cynomolgi may still be present in Sabah at parasite densities below the detection limit of our PCR assay. Future regional surveillance for zoonotic malaria may be aided by using total nucleic acid preservation media and reverse transcription to improve the lower detection limit.21
The infectivity of P. cynomolgi in humans is greatly reduced compared with that of its natural hosts owing to its strict preferential target for human reticulocytes expressing both transferrin receptor 1 and Duffy antigen/chemokine receptor.24 In malariometric studies in western Cambodia using high-volume ultra-sensitive PCR, parasitemia was significantly lower in 11 individuals with asymptomatic P. cynomolgi infection (geometric mean 3,604 parasites/mL, upper range 26,923 parasites/mL) compared with eight individuals with asymptomatic P. knowlesi infection (geometric mean 52,488 parasites/mL); thus, the majority of P. cynomolgi infections in Cambodia were below the detection threshold of the assay used in the current study.8 It is also possible that interspecies competition, particularly against P. knowlesi, impaired P. cynomolgi growth within humans and the mosquito vector. Although mixed zoonotic malaria parasites are frequently detected in both infected macaques and mosquito vectors,11,13 P. knowlesi has the shortest life cycle among primate malarias, which, in addition to more efficient red blood cell invasion, may provide a growth replication advantage over P. cynomolgi. Of note, Plasmodium species co-infections may also lead to a higher parasitemia of one of the infecting species (a commensal effect), as demonstrated with P. malariae.25 Further studies are required to fully explore interactions between P. cynomolgi and P. knowlesi during the mosquito and human life cycles.
Overall, our study did not find evidence of widespread zoonotic P. cynomolgi transmission contributing to microscopy-positive infections in Sabah, Malaysia.
ACKNOWLEDGMENTS
We thank the study participants, the Infectious Disease Society Kota Kinabalu Sabah malaria research team, and the Sabah State Health Department. We thank the Director General, Ministry of Health, Malaysia for permission to publish this article. We thank Bruce Russell and Rossarin Suwanarusk for provision of the P. cynomolgi–positive control sample.
REFERENCES
- 1.↑
Fornace KM, Drakeley CJ, Lindblade KA, Jelip J, Ahmed K, 2023. Zoonotic malaria requires new policy approaches to malaria elimination. Nat Commun 14: 5750.
- 3.↑
William T, Rahman HA, Jelip J, Ibrahim MY, Menon J, Grigg MJ, Yeo TW, Anstey NM, Barber BE, 2013. Increasing incidence of Plasmodium knowlesi malaria following control of P. falciparum and P. vivax malaria in Sabah, Malaysia. PLoS Negl Trop Dis 7: e2026.
- 4.↑
Ta TH, Hisam S, Lanza M, Jiram AI, Ismail N, Rubio JM, 2014. First case of a naturally acquired human infection with Plasmodium cynomolgi. Malar J 13: 68.
- 5.↑
Grignard L, Shah S, Chua TH, William T, Drakeley CJ, Fornace KM, 2019. Natural human infections with Plasmodium cynomolgi and other malaria species in an elimination setting in Sabah, Malaysia. J Infect Dis 220: 1946–1949.
- 6.↑
Raja TN, Hu TH, Kadir KA, Mohamad DSA, Rosli N, Wong LL, Hii KC, Simon Divis PC, Singh B, 2020. Naturally acquired human Plasmodium cynomolgi and P. knowlesi infections, Malaysian Borneo. Emerg Infect Dis 26: 1801–1809.
- 7.↑
Putaporntip C, Kuamsab N, Pattanawong U, Yanmanee S, Seethamchai S, Jongwutiwes S, 2021. Plasmodium cynomolgi co-infections among symptomatic malaria patients, Thailand. Emerg Infect Dis 27: 590–593.
- 8.↑
Imwong M, et al., 2019. Asymptomatic natural human infections with the simian malaria parasites Plasmodium cynomolgi and Plasmodium knowlesi. J Infect Dis 219: 695–702.
- 9.↑
Anstey NM, Grigg MJ, 2019. Zoonotic malaria: The better you look, the more you find. J Infect Dis 219: 679–681.
- 10.↑
Coatney GR, Collins WE, Warren M, Contacos PG, 1971. The Primate Malarias. Rockville, MD: National Institute of Allergy and Infectious Diseases, National Center for Infectious Diseases.
- 11.↑
Yusuf NM, et al., 2022. Plasmodium spp. in macaques, Macaca fascicularis, in Malaysia, and their potential role in zoonotic malaria transmission. Parasite 29: 32.
- 12.↑
Lee K-S, Divis PCS, Zakaria SK, Matusop A, Julin RA, Conway DJ, Cox-Singh J, Singh B, 2011. Plasmodium knowlesi: Reservoir hosts and tracking the emergence in humans and macaques. PLoS Pathog 7: e1002015.
- 13.↑
Maeno Y, 2017. Molecular epidemiology of mosquitoes for the transmission of forest malaria in south-central Vietnam. Trop Med Health 45: 27.
- 14.↑
Zhang X, Kadir KA, Quintanilla-Zariñan LF, Villano J, Houghton P, Du H, Singh B, Smith DG, 2016. Distribution and prevalence of malaria parasites among long-tailed macaques (Macaca fascicularis) in regional populations across Southeast Asia. Malar J 15: 450.
- 15.↑
Cooper DJ, et al., 2020. Plasmodium knowlesi malaria in Sabah, Malaysia, 2015–2017: Ongoing increase in incidence despite near-elimination of the human-only Plasmodium species. Clin Infect Dis Off Publ Infect Dis Soc Am 70: 361–367.
- 16.↑
Barber BE, William T, Grigg MJ, Menon J, Auburn S, Marfurt J, Anstey NM, Yeo TW, 2013. A prospective comparative study of knowlesi, falciparum, and vivax malaria in Sabah, Malaysia: High proportion with severe disease from Plasmodium knowlesi and Plasmodium vivax but no mortality with early referral and artesunate therapy. Clin Infect Dis Off Publ Infect Dis Soc Am 56: 383–397.
- 17.↑
Grigg MJ, et al., 2018. Age-related clinical spectrum of Plasmodium knowlesi malaria and predictors of severity. Clin Infect Dis Off Publ Infect Dis Soc Am 67: 350–359.
- 18.↑
Nuin NA, et al., 2020. Comparative evaluation of two commercial real-time PCR kits (QuantiFastTM and abTESTM) for the detection of Plasmodium knowlesi and other Plasmodium species in Sabah, Malaysia. Malar J 19: 306.
- 19.↑
Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, Thaithong S, Brown KN, 1993. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol 61: 315–320.
- 20.↑
Imwong M, Tanomsing N, Pukrittayakamee S, Day NPJ, White NJ, Snounou G, 2009. Spurious amplification of a Plasmodium vivax small-subunit RNA gene by use of primers currently used to detect P. knowlesi. J Clin Microbiol 47: 4173–4175.
- 21.↑
Braima KA, et al., 2024. Improved limit of detection for zoonotic Plasmodium knowlesi and P. cynomolgi surveillance using reverse transcription for total nucleic acid preserved samples or dried blood spots. medRxiv. https://doi.org/10.1101/2024.04.04.24305339.
- 22.↑
Snounou G, Singh B, 2002. Nested PCR analysis of Plasmodium parasites. Methods Mol Med 72: 189–203.
- 23.↑
Siner A, Liew S-T, Kadir KA, Mohamad DSA, Thomas FK, Zulkarnaen M, Singh B, 2017. Absence of Plasmodium inui and Plasmodium cynomolgi, but detection of Plasmodium knowlesi and Plasmodium vivax infections in asymptomatic humans in the Betong division of Sarawak, Malaysian Borneo. Malar J 16: 417.
- 24.↑
Kosaisavee V, et al., 2017. Strict tropism for CD71+/CD234+ human reticulocytes limits the zoonotic potential of Plasmodium cynomolgi. Blood 130: 1357–1363.
- 25.↑
Holzschuh A, Gruenberg M, Hofmann NE, Wampfler R, Kiniboro B, Robinson LJ, Mueller I, Felger I, White MT, 2022. Co-infection of the four major Plasmodium species: Effects on densities and gametocyte carriage. PLoS Negl Trop Dis 16: e0010760.