INTRODUCTION
Carbapenem-resistant Klebsiella pneumoniae (CRKP) infection is rapidly emerging as a life-threatening nosocomial disease in many countries. In 2016, the WHO was asked to create a priority list of antibiotic-resistant bacteria to support research and development of effective drugs. As expected, CRKP was listed as one of the critical priority bacteria,1 whereas carbapenem-resistant Enterobacterales was listed as an urgent threat by the U.S. Centers for Disease Control and Prevention. According to the China Antimicrobial Surveillance Network, carbapenem resistance among K. pneumoniae increased significantly from 18.6% to 64.1% in 2018. From 2005 to 2018, the resistance rates of K. pneumoniae to imipenem and meropenem increased from 3.0% to 25% and 2.9% to 26.3%, respectively.2 Mortality rates for CRKP infections are higher than those for patients infected with carbapenem-susceptible K. pneumoniae (CSKP); pooled mortality was 42.1% among 2,462 patients infected with CRKP versus 21.2% in those infected with CSKP.3,4 Prudent use of antimicrobials, reflected also in the choice of antimicrobial combinations for treatment as well as efficient in-hospital control practices including meticulous hand hygiene, cleaning, and disinfection, are needed to control the spread of CRKP within hospitals.5,6
In clinical practice, decontamination and disinfection are the most important intervention measures to prevent bacterial spread. Disinfectants are widely acknowledged for removing microorganisms from the surface of objects and transmission media. Over the years, the excessive use of disinfectants has imposed selective pressure on strains, causing a wide distribution of disinfectant resistance genes.7 Many disinfectant resistance genes have been confirmed in multidrug-resistant bacteria, such as qacA/B, qacE, qacEΔ1, qacG, qacJ, cepA, arcA, and kdeA.8 In gram-negative bacteria, the plasmid-encoded qacE, qacEΔ1, qacF, and qacG genes of the SMR family are associated with quarternary ammonium compound protection. Among them, qacEΔ1 seems to be widely disseminated.9 Another mechanism of biocide tolerance is related to the chromosomally encoded cepA exporter, which confers chlorhexidine protection in K. pneumoniae.10 However, the emergence of disinfectant resistance has become a severe threat to safety and health and to the rational allocation of resources. The genes cepA and qacEΔ1 are closely associated with decreasing antiseptic susceptibility in strains of K. pneumoniae.8,11
There is still a lack of multicenter study on CRKP resistance to disinfectants in Wuhan, China. Therefore, the aim of this study was to identify the genetic characterization of these genes in CRKP and to investigate the diversity of the gene cassettes.
MATERIALS AND METHODS
Bacterial strains.
From June 2018 to March 2019, we collected a total of 74 nonduplicate clinical isolates of CRKP from six hospitals in Wuhan, the capital of Hubei province, China. The CRKP strains were defined as having a minimum inhibitory concentration (MIC) greater than 4 µg/mL for imipenem and meropenem or greater than 2 µg/mL for ertapenem. The isolates were obtained from various clinical specimens, including sputum, urine, blood, secretion, and drainage. Three of the hospitals were tertiary hospitals, including Wuhan No. 1 Hospital (31 isolates), Hubei Maternal and Child Health Care Hospital (18 isolates), and Wuhan Fourth Hospital (4 isolates). The remaining three hospitals were secondary hospitals, including Huangpi People’s Hospital (13 isolates), Wuhan Hankou Hospital (5 isolates), and the First People’s Hospital of Jiangxia District (3 isolates). Isolate identification and antimicrobial susceptibility testing were performed by laboratory personnel of the respective hospitals, and bioinformation of all strains was reviewed by using the Vitek 2 Compact System (bioMérieux, Lyons, France) in the laboratory of the Wuhan Center for Disease Control and Prevention. The CRKP strains were stored in brain heart infusion broth supplemented with 20% glycerol at −20°C for further analysis. Escherichia coli ATCC25922 and Salmonella H9812 were taken as quality control strains for susceptibility testing and pulsed-field gel electrophoresis (PFGE), respectively.
The study was approved by the Ethics Committee of the Wuhan Center for Disease Control and Prevention (WHCDCIRB-K-2021038).
Antimicrobial susceptibility testing.
Antimicrobial susceptibilities for all isolates were initially detected by using gram-negative susceptibility cards on the Vitek 2 Compact System. We evaluated the susceptibility of 18 antibiotics, including ampicillin, amoxicillin/clavulanic acid, piperacillin, cefazolin, ceftazidime, ceftriaxone, cefepime, aztreonam, ertapenem, imipenem, meropenem, amikacin, gentamicin, ciprofloxacin, levofloxacin, tetracycline, nitrofurantoin, and trimethoprim/sulfamethoxazole. Susceptibility testing results were interpreted according to the criteria recommended by the Clinical and Laboratory Standards Institute.12
Real-time polymerase chain reaction (PCR).
We designed primers for the well-known disinfectant resistance genes qacEΔ1 and cepA by using Primer5.0 software (PREMIER Biosoft, Palo Alto, CA), according to the various gene sequences published in the GenBank database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). All real-time PCR primers and probes targeting sequences used in this study are listed in Table 1. We extracted bacterial DNA from CRKP isolates by using a bacterial DNA extraction kit (Qiagen, Beijing, China). Real-time PCR (Roche, Lightcycler 480, Basel, Switzerland) conditions were set as follows: 95°C for 10 minutes, followed by 40 sequential cycles of 95°C for 10 seconds, 58°C for 30 seconds, and 72°C for 1 second. QacEΔ1-producing K. pneumoniae HP6 and cepA-carrying K. pneumoniae HK14 acted as positive controls. QacEΔ1-/cepA-negative isolate (K. pneumoniae FY35) and distilled water were negative and blank controls, respectively.
Real-time PCR primers and probe for amplifying disinfectant resistance genes
| Gene | Objects | Sequences and modifications (5′→3′) |
|---|---|---|
| qacEΔ1 | Primer-F | CAGCCATTGCCTGGTTGC |
| Primer-R | CGCAGCGACTTCCACGAT | |
| Probe | FAM-CCATACCTACAAAGCCCCACGCATC-BHQ1 | |
| cepA | Primer-F | GCGGGCGGATATGCTTCATT |
| Primer-R | ATGCCAGCCGTACCAGGATA | |
| Probe | FAM-ATGATGAACGGCGCCATTCTGGTGGCG-BHQ1 |
F = forward; PCR = polymerase chain reaction; R = reverse.
Pulsed-field gel electrophoresis.
The genotypes of CRKP isolates co-harboring qacEΔ1 and cepA were determined by PFGE analysis. Pulsed-field gel electrophoresis analysis was performed as previously described using the XbaI restriction endonuclease (TAKARA, Shiga, Japan). The running parameters were set as follows: an initial pulse of 6 seconds, a final pulse of 36 seconds, at 6 V/cm for 18.5 hours at 14°C. The gels were analyzed using BioNumerics version 7.6 (Applied Maths, Sint-Martens-Latem, Belgium), and cluster analysis and phylogenetic trees were subsequently prepared. The similarity of the PFGE banding patterns was calculated using the Dice coefficient, and isolates with a PFGE profile exhibiting more than 80% similarity were considered closely related strains.13
Data analysis.
Data analysis was conducted using IBM SPSS version 22.0 software (SPSS Inc., Chicago, IL) and BioNumerics version 7.6 (Applied Maths). Categorical variables were summarized by absolute frequencies and percentages and continuous variables by medians and ranges. The χ2 test and Fisher’s exact test were used to compare proportions, where appropriate. All tests were two-tailed, and P values less than 0.05 were considered statistically significant.
RESULTS
Bacterial isolates.
A total of 74 CRKP isolates were collected from 74 inpatients. The median age of the patients was 69.5 years, with the youngest patient being a 16-day-old baby and the eldest being a 93-year-old patient. Of the 74 isolates, 21 were collected from three secondary hospitals, and 53 were from three tertiary hospitals. Forty-nine isolates were from the intensive care unit (ICU), 15 isolates from the medical ward, three isolates from the surgical ward, and seven isolates from the pediatric ward. Most of the isolates were recovered from sputum (45.9%, 34/74), followed by urine (14.9%, 11/74), and blood (12.2%, 9/74).
Antimicrobial susceptibility.
Table 2 shows the results of antimicrobial susceptibility. The rates of resistance to carbapenems were 93.2% for ertapenem, 90.5% for imipenem, and 87.8% for meropenem, with all isolates being resistant to at least one carbapenem antibiotic. The CRKP isolates exhibited high rates of resistance to the majority of antibiotics, with resistance rates exceeding 90%. The rate of susceptibility to tetracycline was only 52.7%.
Antimicrobial susceptibility testing results of the 74 CRKP isolates
| Antibiotics | Susceptibility testing (%) | ||
|---|---|---|---|
| Resistant | Intermediate | Susceptible | |
| Ampicillin | 74 (100) | 0 | 0 |
| Amoxicillin/clavulanic acid | 71 (95.9) | 1 (1.4) | 2 (2.7) |
| Piperacillin | 68 (91.9) | 2 (2.7) | 4 (5.4) |
| Cefazolin | 72 (97.3) | 0 | 2 (2.7) |
| Ceftazidime | 70 (94.6) | 0 | 4 (5.4) |
| Ceftriaxone | 70 (94.6) | 0 | 4 (5.4) |
| Cefepime | 64 (86.5) | 0 | 10 (13.5) |
| Aztreonam | 68 (91.9) | 0 | 6 (8.1) |
| Ertapenem | 69 (93.2) | 0 | 5 (6.8) |
| Imipenem | 67 (90.5) | 2 (2.7) | 5 (6.8) |
| Meropenem | 65 (87.8) | 3 (4.1) | 6 (8.1) |
| Amikacin | 50 (67.6) | 0 | 24 (32.4) |
| Gentamicin | 58 (78.4) | 0 | 16 (21.6) |
| Ciprofloxacin | 60 (81.0) | 3 (4.1) | 11 (14.9) |
| Levofloxacin | 60 (81.0) | 3 (4.1) | 11 (14.9) |
| Tetracycline | 25 (33.8) | 10 (13.5) | 39 (52.7) |
| Nitrofurantoin | 60 (81.1) | 6 (8.1) | 8 (10.8) |
| Trimethoprim/ sulfamethoxazole | 43 (58.1) | 0 | 31 (41.9) |
CRKP = carbapenem-resistant Klebsiella pneumoniae.
Molecular characteristics.
Table 3 presents the results of PCR analysis for all 74 CRKP isolates. Of these isolates, 48 (64.9%) were positive for qacEΔ1 and 69 (93.2%) were positive for cepA. The prevalence of cepA was significantly higher than that of qacEΔ1 (χ2 = 17.0, P < 0.05). qacEΔ1 and cepA were co-detected in 46 isolates (62.2%), whereas only three isolates (4.1%) lacked both disinfectant resistance genes. The detection rate of qacEΔ1 in tertiary hospitals (69.8%) was higher than that in secondary hospitals (52.4%). In terms of hospital wards, the detection rate of qacEΔ1 was 67.3% in the ICU, 60.0% in the medical ward, and 85.7% in the pediatric ward, but it was not detected in the surgical ward (χ2 = 8.1, P < 0.05). The detection rate of qacEΔ1 in different specimen types was similar, with no significant differences (χ2 = 7.8, P > 0.05).
The detection rate of qacEΔ1 and cepA in CRKP isolates
| Types | No. of strains | Disinfectant resistance gene (%) | ||
|---|---|---|---|---|
| qacEΔ1 | cepA | qacEΔ1 + cepA | ||
| Hospital level | ||||
| Secondary hospital | 21 | 11 (52.4) | 18 (85.7) | 10 (47.6) |
| Tertiary hospital | 53 | 37 (69.8) | 51 (96.2) | 36 (67.9) |
| Ward | ||||
| ICU* | 49 | 33 (67.4) | 47 (95.5) | 32 (65.3) |
| Medical ward† | 15 | 9 (60.0) | 13 (86.7) | 9 (60.0) |
| Surgical ward‡ | 3 | 0 | 3 (100) | 0 |
| Pediatric ward§ | 7 | 6 (85.7) | 6 (85.7) | 5 (71.4) |
| Specimen | ||||
| Sputum | 34 | 24 (70.6) | 32 (94.1) | 22 (64.7) |
| Blood | 9 | 5 (55.6) | 9 (100) | 5 (55.6) |
| Urine | 11 | 6 (54.6) | 10 (90.9) | 6 (54.6) |
| Secretion | 7 | 5 (71.4) | 7 (100) | 5 (71.4) |
| Drainage | 5 | 1 (20.0) | 3 (60.0) | 1 (20.0) |
| Other location‖ | 8 | 7 (87.5) | 8 (100) | 7 (87.5) |
CRKP = carbapenem-resistant Klebsiella pneumoniae.
Included intensive care unit (ICU), neurology ICU, and pediatric ICU.
Included respiratory medicine, oncology, recovery unit, traditional Chinese medicine, nephrology, infectious diseases department, neurology, and cardiology.
Included gastrointestinal surgery and neurosurgery.
Included pediatric cardiology, neonatology, and endocrine genetics in children.
Included bronchoalveolar lavage fluid and bronchoscopy.
Table 4 presents the results of antimicrobial resistance rates between disinfectant resistance gene–positive and –negative strains. The genes of cepA and qacEΔ1 are closely associated with increasing antimicrobial resistance in part of the CRKP strains. The qacEΔ1-positive strains showed higher resistance rates to piperacillin, amoxicillin/clavulanic acid, aztreonam, amikacin, gentamicin, ciprofloxacin, levofloxacin, and nitrofurantoin (all P < 0.05). The cepA-positive strains showed higher resistance rates to piperacillin, ceftazidime, ceftriaxone, ertapenem, imipenem, ciprofloxacin, and levofloxacin (all P < 0.05).
Antimicrobial resistance rates between disinfectant resistance gene–positive and –negative strains
| Antibiotics | Resistant (%) | P* | P† | |||
|---|---|---|---|---|---|---|
| qacEΔ1-positive | qacEΔ1-negative | CepA-positive | CepA-negative | |||
| (N = 48) | (N = 26) | (N = 69) | (N = 5) | |||
| Ampicillin | 48 (100) | 26 (100) | 69 (100) | 5 (100) | 1.00‡ | 1.00‡ |
| Amoxicillin/clavulanic acid | 48 (100) | 23 (88.5) | 66 (95.7) | 5 (100) | < 0.05‡ | 1.00‡ |
| Piperacillin | 47 (97.9) | 21 (80.8) | 66 (95.7) | 2 (40.0) | < 0.05‡ | < 0.01‡ |
| Cefazolin | 48 (100) | 24 (92.3) | 67 (97.1) | 5 (100.0) | 0.12‡ | 1.00‡ |
| Ceftazidime | 47 (97.9) | 23 (88.5) | 67 (97.1) | 3 (60.0) | 0.24§ | < 0.05‡ |
| Ceftriaxone | 47 (97.9) | 23 (88.5) | 67 (97.1) | 3 (60.0) | 0.24§ | < 0.05‡ |
| Cefepime | 41 (85.4) | 23 (88.5) | 61 (88.4) | 3 (60.0) | 0.99§ | 0.13‡ |
| Aztreonam | 47 (97.9) | 21 (80.8) | 65 (94.2) | 3 (60.0) | < 0.05§ | 0.05‡ |
| Ertapenem | 47 (97.9) | 22 (84.6) | 66 (95.7) | 3 (60.0) | 0.09§ | < 0.05‡ |
| Imipenem | 46 (95.8) | 21 (80.8) | 65 (94.2) | 2 (40.0) | 0.06‡ | < 0.01‡ |
| Meropenem | 44 (91.7) | 21 (80.8) | 62 (89.9) | 3 (60.0) | 0.21‡ | 0.06‡ |
| Amikacin | 41 (85.4) | 9 (34.6) | 48 (69.6) | 2 (40.0) | < 0.01‖ | 0.39§ |
| Gentamicin | 45 (93.8) | 13 (50.0) | 56 (81.2) | 2 (40.0) | < 0.01‖ | 0.11§ |
| Ciprofloxacin | 45 (93.8) | 15 (57.7) | 59 (85.5) | 1 (20.0) | < 0.01‡ | < 0.01‡ |
| Levofloxacin | 42 (87.5) | 15 (57.7) | 57 (82.6) | 0 | < 0.01‡ | < 0.01‡ |
| Tetracycline | 15 (31.3) | 10 (38.5) | 23 (33.3) | 2 (40.0) | 0.79‡ | 0.69‡ |
| Nitrofurantoin | 43 (89.6) | 17 (65.4) | 57 (82.6) | 3 (60.0) | < 0.05‡ | 0.24‡ |
| Trimethoprim/sulfamethoxazole | 31 (64.6) | 12 (46.2) | 39 (56.5) | 4 (80.0) | 0.13‖ | 0.58§ |
Statistical analysis between qacEΔ1-positive and -negative.
Statistical analysis between CepA-positive and -negative.
Fisher’s exact test.
Continuity correction.
Likelihood ratio.
Pulsed-field gel electrophoresis typing.
The dendrogram generated from the PFGE image revealed that the 46 CRKP strains co-producing qacEΔ1 and cepA were divided into 15 different clonal clusters (designated as Types A to O) using 80% similarity as the cutoff (Figure 1). The most common clonal clusters were Type C (41.3%), Type E (13.0%), Type J (8.7%), Type I (6.5%), and Type L (6.5%). Type C, the predominant cluster, consisted of 19 strains from patients in four different hospitals. Among these, YY52 and YY57, YY31 and YY69, YY32 and YY65, HK11, HP38, YY3, and YY66 showed identical patterns (100%), suggesting that they were the same strain, whereas other isolates displayed similar but not identical band patterns (80%), indicating that they may belong to the same clonal group. Type E, the second-most common cluster, included six isolates from patients in three different departments of the same hospital. Among the Type J isolates, four collected from the pediatric intensive care unit (PICU) of the same hospital, FY31, FY33, FY30 and FY32 were all identical patterns (100%); further analysis found that four patients were hospitalized from November 5–22, 2018. The Type L isolates, HP20, HP21, and HP36, collected from the ICU and traditional Chinese medicine departments of the same hospital, were found to be the same strain. However, nine CRKP isolates exhibited unrelated PFGE patterns, suggesting that the dissemination of qacEΔ1 and cepA genes occurred horizontally throughout the population rather than by the spread of a single strain.
A dendrogram of PFGE pattern for 46 CRKP strains. These isolates were divided into 15 different clonal clusters (Types A to O) using 80% similarity as the cutoff. CRKP = carbapenem-resistant Klebsiella pneumoniae; ICU = intensive care unit; NICU = neurology intensive care unit; PFGE = pulsed-field gel electrophoresis; PICU = pediatric intensive care unit.
Citation: The American Journal of Tropical Medicine and Hygiene 110, 1; 10.4269/ajtmh.23-0247
DISCUSSION
Owing to variations in natural environments and economic levels across different regions, the implementation of disinfection measures and the type of antibiotics used in hospitals differ, resulting in varied disinfectant resistance mechanisms among strains from different regions. Therefore, it is important to base hospital infection control measures on local epidemiological studies. For this study, we selected six different hospitals in Wuhan, including both secondary and tertiary hospitals and both general and specialized hospitals. To the best of our knowledge, this is the first multicenter study to report on disinfectant-resistance genes and genetic relationships of CRKP isolates from inpatients in Wuhan, China.
Disinfectants are widely acknowledged for removing microorganisms from the surface of objects and transmission media. However, the emergence of disinfectant resistance has become a severe threat to life and health and the rational allocation of resources because of reduced disinfectant effectiveness. Bacteria can develop disinfectant resistance through the expression of disinfectant-resistant genes.14 The presence of the qacEΔ1 and cepA genes is known to be associated with high-level MICs of biocides.8 Previous studies have reported that the qacEΔ1 and cepA genes have a close relationship with decreasing disinfectant susceptibility in K. pneumoniae strains.15 However, it is important to note that the qacEΔ1 gene is a defective gene, and various mechanisms are involved in biocide resistance.16 In our study, we investigated the presence of the two disinfectant resistance genes qacEΔ1 and cepA in CRKP isolates.
Our findings revealed that 62.2% of the CRKP strains co-harbored qacEΔ1 and cepA. Specifically, among the clinical isolates of CRKP, 64.9% and 93.2% were positive for qacEΔ1 and cepA, respectively. The cepA gene was much more prevalent than the qacEΔ1 gene. These results are consistent with previous studies. Abuzaid et al. reported that the cepA gene was carried by 56 (87.5%) K. pneumoniae isolates,7 and Chen et al. reported that 41.7% were positive for qacEΔ1 and 80.6% for cepA among 36 CRKP strains at a tertiary hospital in China.16
In contrast to our results, a previous study conducted in Iran reported lower prevalence rates of the qacEΔ1 and cepA genes among clinical isolates of K. pneumoniae, with the qacEΔ1 gene detected in 30.6% of the clinical isolates and the cepA gene found in 22.4%.17 Our results indicate that the qacEΔ1 and cepA genes are widely distributed among CRKP isolated from hospitals, with an increase in their prevalence among CRKP strains in China.
The antimicrobial susceptibility profile showed that all CRKP strains were multidrug-resistant, as they were nonsusceptible to at least one antibiotic from three or more antibiotic classes. All 74 strains exhibited high rates of resistance to the majority of antibiotics, which indicates that the drug resistance situation of CRKP strains in Wuhan is very severe, which is consistent with some previous studies.18–20 The results showed that the qacEΔ1 and cepA genes are closely associated with increasing antimicrobial resistance in part of the CRKP strains, such as piperacillin, ciprofloxacin, and levofloxacin. The qacEΔ1 gene appears to be part of a small resistance island, suggesting that this gene is linked to and migrated with antibiotic resistance genes.13 The widespread carriage of qacEΔ1 genes in CRKP and their linkage to antibiotic resistance suggests that widespread use of disinfectants could select antibiotic-resistant strains, though there is no direct evidence for this so far.7,13 The relationship between the existence and expression of disinfectant genes and their resistance to bacteria needs further study. Pulsed-field gel electrophoresis is considered the “gold standard” for bacterial typing.21 Recently, matrix-assisted laser desorption/ionization time of flight mass spectrometry and whole-genome sequencing have also been proposed for bacterial typing.22 Whole-genome sequencing, in particular, provides more information and has been proposed as an alternative method for bacterial typing. However, PFGE remains an affordable and relevant technique in small laboratories and hospitals, especially in developing countries. With its high discriminatory power, PFGE is useful in outbreak investigations, surveillance, and infection control.23 In this study, the PFGE data revealed that the 46 CRKP isolates were divided into 15 distinct clonal clusters. The major cluster Type C included 19 strains from patients in four different hospitals, indicating a possible epidemiological link between the hospitals, potentially due to patient or staff transfer. Similarly, the second major cluster, Type E, included six isolates from patients in three different departments within the same hospital, indicating that CRKP can spread within the same hospital between different departments. Type J isolates collected from the same hospital’s PICU revealed that CRKP can also spread among different patients in the same department. These findings highlight the considerable DNA polymorphism of CRKP and suggest that polyclonal dissemination is a significant factor in the spread of CRKP.
In conclusion, the appropriate use of biocides is essential for the effective prevention and control of CRKP infections. However, our study showed a high frequency of qacEΔ1 and cepA in CRKP isolates, indicating the potential for biocide resistance and a higher level of antibiotic resistance in CRKP. Therefore, monitoring the disinfectant resistance rate of CRKP strains in the hospital environment should be a priority. This will ensure that appropriate and effective disinfection measures are implemented to prevent the spread of these life-threatening resistant strains.
ACKNOWLEDGMENTS
We thank the following institutions that participated as major collaborators in this study: Hubei Maternal and Child Health Care Hospital (Zhengjiang Jin), Wuhan No. 1 Hospital (Yuhe Ke), Wuhan Fourth Hospital (Ji Zeng), Huangpi People’s Hospital (Ying Liu), Wuhan Hankou Hospital (Qiongfang Liu), and the First People’s Hospital of Jiangxia District (Yu Xia).
REFERENCES
- 1.↑
Tacconelli E et al., 2018. Discovery, research, and development of new antibiotics: the WHO priority list of antibiotic-resistant bacteria and tuberculosis. Lancet Infect Dis 18: 318–327.
- 2.↑
Hu F , Guo Y , Yang Y , Zheng Y , Wu S , Jiang X , Zhu D , Wang F , 2019. Resistance reported from China antimicrobial surveillance network (CHINET) in 2018. Eur J Clin Microbiol Infect Dis 38: 2275–2281.
- 3.↑
Xu L , Sun X , Ma X , 2017. Systematic review and meta-analysis of mortality of patients infected with carbapenem-resistant Klebsiella pneumoniae. Ann Clin Microbiol Antimicrob 16: 18.
- 4.↑
Kohler PP , Volling C , Green K , Uleryk EM , Shah PS , McGeer A , 2017. Carbapenem resistance, initial antibiotic therapy, and mortality in Klebsiella pneumoniae bacteremia: a systematic review and meta-analysis. Infect Control Hosp Epidemiol 38: 1319–1328.
- 5.↑
Hoxha A , Karki T , Giambi C , Montano C , Sisto A , Bella A , D’Ancona F , 2016. Attributable mortality of carbapenem-resistant Klebsiella pneumoniae infections in a prospective matched cohort study in Italy, 2012–2013. J Hosp Infect 92: 61–66.
- 6.↑
Palmore TN , Henderson DK , 2013. Managing transmission of carbapenem-resistant enterobacteriaceae in healthcare settings: a view from the trenches. Clin Infect Dis 57: 1593–1599.
- 7.↑
Abuzaid A , Hamouda A , Amyes SG , 2012. Klebsiella pneumoniae susceptibility to biocides and its association with cepA, qacΔE and qacE efflux pump genes and antibiotic resistance. J Hosp Infect 81: 87–91.
- 8.↑
Yerushalmi H , Lebendiker M , Schuldiner S , 1995. EmrE, an Escherichia coli 12-kDa multidrug transporter, exchanges toxic cations and H+ and is soluble in organic solvents. J Biol Chem 270: 6856–6863.
- 9.↑
Fang CT , Chen HC , Chuang YP , Chang SC , Wang JT , 2002. Cloning of a cation efflux pump gene associated with chlorhexidine resistance in Klebsiella pneumoniae. Antimicrob Agents Chemother 46: 2024–2028.
- 10.↑
Russell AD , 2003. Biocide use and antibiotic resistance: the relevance of laboratory findings to clinical and environmental situations. Lancet Infect Dis 3: 794–803.
- 11.↑
CLSI , 2018. Performance Standards for Antimicrobial Susceptibility Testing. Supplement M100. 28th ed. Wayne, PA: Clinical and Laboratory Standards Institute.
- 12.↑
Tseng IL , Liu YM , Wang SJ , Yeh HY , Hsieh CL , Lu HL , Tseng YC , Mu JJ , 2015. Emergence of carbapenemase producing Klebsiella Pneumonia and spread of KPC-2 and KPC-17 in Taiwan: a nationwide study from 2011 to 2013. PLoS One 10: e0138471.
- 13.↑
Abuzaid AA , Amyes SG , 2015. The genetic environment of the antiseptic resistance genes qacEΔ1 and cepA in Klebsiella pneumoniae. J Chemother 27: 139–144.
- 14.↑
Tong C , Hu H , Chen G , Li Z , Li A , Zhang J , 2021. Disinfectant resistance in bacteria: mechanisms, spread, and resolution strategies. Environ Res 195: 110897.
- 15.↑
Paulsen IT , Littlejohn TG , Rådström P , Sundström L , Sköld O , Swedberg G , Skurray RA , 1993. The 3′ conserved segment of integrons contains a gene associated with multidrug resistance to antiseptics and disinfectants. Antimicrob Agents Chemother 37: 761–768.
- 16.↑
Chen Y , Liao K , Huang Y , Guo P , Huang H , Wu Z , Liu M , 2020. Determining the susceptibility of carbapenem resistant Klebsiella pneumoniae and Escherichia coli strains against common disinfectants at a tertiary hospital in China. BMC Infect Dis 20: 88.
- 17.↑
Azadpour M , Nowroozi J , Goudarzi GR , Mahmoudvand H , 2015. Presence of qacEΔ1 and cepA genes and susceptibility to a hospital biocide in clinical isolates of Klebsiella pneumoniae in Iran. Trop Biomed 32: 109–115.
- 18.↑
Zhang F , Li Y , Gan L , 2020. Investigation on molecular epidemiology and genetic characteristics of carbapenem-resistant Klebsiella pneumoniae in Beijing from 2016 to 2017. Chin J Antibiot 45: 610–620.
- 19.↑
Huang JM , Ke BX , He DM , 2022. Drug resistance and molecular epidemiological characteristics of carbapenem-resistant Klebsiella pneumoniae in Guangdong. Zhongguo Yiyuan Ganranxue Zazhi 32: 813–818.
- 20.↑
Singh S , Pathak A , Rahman M , Singh A , Nag S , Sahu C , Prasad KN , 2021. Genetic characterisation of colistin resistant Klebsiella pneumoniae clinical isolates from North India. Front Cell Infect Microbiol 11: 666030.
- 21.↑
Neoh HM , Tan XE , Sapri HF , Tan TL , 2019. Pulsed-field gel electrophoresis (PFGE): a review of the “gold standard” for bacteria typing and current alternatives. Infect Genet Evol 74: 103935.
- 22.↑
Sui W et al., 2018. Whole genome sequence revealed the fine transmission map of carbapenem-resistant Klebsiella pneumonia isolates within a nosocomial outbreak. Antimicrob Resist Infect Control 7: 70.
- 23.↑
Yan Z , Zhou Y , Du M , Bai Y , Liu B , Gong M , Song H , Tong Y , Liu Y , 2019. Prospective investigation of carbapenem-resistant Klebsiella pneumonia transmission among the staff, environment and patients in five major intensive care units, Beijing. J Hosp Infect 101: 150–157.