Use of Multi-Parallel Real-Time Quantitative PCR to Determine Blastocystis Prevalence and Association with Other Gastrointestinal Parasite Infection in a Rural Honduran Location

In this study, a previously developed multi-parallel real-time quantitative PCR (qPCR) assay was used in combination with the Kato–Katz (KK) technique to determine the association of Blastocystis with the presence of Ascaris lumbricoides, Ancylostoma duodenale, Necator americanus, Strongyloides stercoralis, Trichuris trichiura, Cryptosporidium spp., Entamoeba histolytica, and Giardia lamblia.¹

The study was part of a larger investigation on soil-transmitted helminths (STHs), and a subsample of fecal samples from 95 children (mean age = 6.1 years; range = 8 months–13 years; 47.4% females) were analyzed for the present study. Children were residents of impoverished rural villages in and around La Hicaca, Department of Yoro, in northern Honduras.² Children in these communities are treated annually and sometimes biannually with 400 mg/day × 3 days with albendazole. Stool samples’ aliquots were stored in 70% ethanol and transported to Houston laboratories where they were stored at −20°C for molecular diagnosis of intestinal parasites.

At collection, the KK method was used to determine the presence of STHs in stool samples; STH eggs were identified and the number of eggs per gram calculated. Kato–Katz smears were examined between 30 and 60  minutes of preparation. Quality control procedures were applied, with 10% of positive and 100% of negative smears reexamined by a different researcher immediately after the first reading.

DNA was extracted from 50 mg of stool from each sample using MP FastDNA^™ for Soil Kit (MP Biochemicals, Solon, OH) according to the manufacturer’s instructions for all parasites, except T. trichiura, which required an additional heating step.¹

DNA extraction from the stool and qPCR methods were implemented as described by Mejia et al.¹ Species-specific primers and probes were previously designed and tested for eight gastrointestinal (GI) parasites.¹ Primers for Blastocystis were designed for a segment of the small subunit (SSU) rRNA gene with the ability to amplify DNA from subtypes 1–10, as published by Poirier et al.³ The sequence information for Blastocystis primers and probes (target region SSU RNA, GenBank Accession No. J02459) used in multi-parallel qPCR were as follows: forward primer sequence (5′→3′) AGTAGTCATACGCTCGTCTCAAA, reverse primer sequence (5′→3′) TCTTCGTTACCCGTTACTGC, probe sequence (6-FAM, 5′→3′) CGTGTAAATCTTACCATTTAGAGGA. Standards were prepared for Blastocystis according to the protocol already described for other species.¹

Samples were run on a ViiA^™ 7 Fast Real-Time PCR System (Applied Biosystems, Waltham, MA). For quantification, plasmids containing target sequences were run in duplicate according to dilution. An exogenous internal control was used to investigate the efficiency of DNA extraction, by spiking stool samples and measuring cycle threshold.⁴

Because KK is not suitable for detecting protozoa, qPCR and KK diagnostic methods were only compared for STH infections. The combined results from KK and qPCR were considered as the standard of diagnosis (i.e., any positive test result, regardless of the technique used, was considered a true-positive result) for A. lumbricoides, T. trichiura, and N. americanus.

Overall, 12 research participants were negative for parasites (12.6%). Taking into account both diagnostic methods, Blastocystis was the most common parasite detected in 68 positive samples (71.6%), followed by 60 positives for T. trichiura (63.2%), 38 for G. lamblia (40.0%), 15 for A. lumbricoides (15.8%), and four for N. americanus (4.2%). No positive samples were detected for A. duodenale, Cryptosporidium spp., S. stercoralis, or E. histolytica (Table 1).

Polyparasitism was frequent among research participants: 22 (23.2%) were positive for one parasite species, 28 (29.5%) for two, 26 (27.4%) for three, six (6.3%) for four parasites, and one (1.1%) for five species. Counts are displayed for combined and individual methods in Table 1. The median and range of the concentration of DNA (fg/μL) from qPCR-positive samples are also displayed.

Distribution of the intensity (burden) of infection by KK and qPCR was determined for STHs according to the thresholds set by WHO for A. lumbricoides (i.e., 1–5,000 light infection; > 5,000–50,000 moderate infection; and > 50,000, heavy infection), T. trichiura (i.e., 1–10³ light infection; 10³–10⁴: moderate infection; and ≥ 10⁴, heavy infection), and N. americanus (i.e., 1–2,000 light infection; > 2,000–4,000 moderate infection; and > 4,000 heavy infection).⁵ In terms of infection intensity, a moderate agreement was found between KK and qPCR for A. lumbricoides (κ = 0.516; 95% CI = 0.364, 0.702; P < 0.001), whereas for T. trichiura, the agreement was fair (κ = 0.389; 95% CI = 0.242, 0.508; P < 0.001).

Spearman’s rank correlation coefficient (r_s) indicated a positive correlation between age and the amount of Blastocystis DNA in stool (fg/μL) by qPCR (r_s = 0.524, P < 0.001; Figure 1). A weak positive correlation was noted between age and the amount of T. trichiura DNA in stool (fg/μL) by qPCR (r_s = 0.272, P = 0.008). No similar correlation was seen for G. lamblia (r_s = 0.142, P = 0.169), A. lumbricoides (r_s = −0.040, P = 0.701), or N. americanus (not available). There was an association between Blastocystis infection and T. trichiura (OR = 4.72; 95% CI = 1.83, 12.20; P < 0.001), but not with the other GI parasites (Table 2).

Spearman’s rank correlation between Blastocystis burden and age. There was a correlation between age and the amount of Blastocystis DNA in stool (fg/μL) by quantitative PCR (r_s = 0.524, P < 0.001).

Citation: The American Journal of Tropical Medicine and Hygiene 102, 6; 10.4269/ajtmh.19-0876

• Download Figure
• Download figure as PowerPoint slide

View Full Size

Spearman’s rank correlation between Blastocystis burden and age. There was a correlation between age and the amount of Blastocystis DNA in stool (fg/μL) by quantitative PCR (r_s = 0.524, P < 0.001).

Citation: The American Journal of Tropical Medicine and Hygiene 102, 6; 10.4269/ajtmh.19-0876

• Download Figure
• Download figure as PowerPoint slide

Spearman’s rank correlation between Blastocystis burden and age. There was a correlation between age and the amount of Blastocystis DNA in stool (fg/μL) by quantitative PCR (r_s = 0.524, P < 0.001).

Citation: The American Journal of Tropical Medicine and Hygiene 102, 6; 10.4269/ajtmh.19-0876

• Download Figure
• Download figure as PowerPoint slide

Blastocystis spp. is gaining attention globally as one of the most widespread organisms dwelling in the human GI tract, although its pathogenicity is still in dispute. The amount of parasite DNA in stool samples was quantified using a previously developed multi-parallel qPCR method for A. lumbricoides, A. duodenale, N. americanus, S. stercoralis, T. trichiura, Cryptosporidium spp., E. histolytica, G. lamblia, and Blastocystis spp. These data were compared with KK data for three of the nine species (A. lumbricoides, T. trichiura, and N. americanus). A high prevalence of Blastocystis (71.6%) was noted in this population in comparison with other Latin American studies undertaken in Brazil (21% and 28%), Argentina (25%), and Colombia (12.6%).^6–9

There was a correlation between age and Blastocystis infection (Figure 1). The correlation between age and prevalence of Blastocystis has been both present and absent in other similar studies.^10–12 Some authors have suggested that Blastocystis is acquired via person-to-person transmission.¹³ In this case, increasing age would allow more opportunities for exposure. In addition, this organism is known to colonize individuals for several years,¹² further increasing the likelihood that an older child would be infected if they were previously exposed. The association between T. trichiura infection and Blastocystis infection was noteworthy (Table 2). These two parasites have transmission sources in common, of which, contaminated soil and untreated water sources have been emphasized.^14,15 Further studies characterizing water sources would be useful. Moreover, the fecal–oral route of infection likely has a major impact on our findings. In the study community, children likely are continuously reinfected. This is evident by the high STH prevalence despite regular deworming treatment. In addition to transmission routes, it is worth mentioning the role of the immune system in polyparasitism, particularly the interplay of STH and protozoa.¹⁶

Overall, this study’s main contribution was to assess the prevalence and burden of Blastocystis, and its association with other GI parasites in this rural pediatric population in Honduras, where specific studies on Blastocystis are lacking. Molecular methods of detection for this organism are in extensive use, and this study adds to the global body of data for an understudied region in Honduras. Because of the clinical and evolutionary relevance of the distribution of subtypes, the next step would be to map these subtypes in Honduras and other parts of Central America as previous authors have undertaken in Latin America.^9,17 This would delineate which subtypes are associated with helminth infections, if any, in this region. Understanding the interactions between common species of the GI tract such as Blastocystis and endemic GI parasites is an essential step for improving human health.

In summary, we adapted a previously developed multi-parallel qPCR assay to determine the prevalence and burden of various GI parasites with fundamental demographic factors including gender, age, and infection of other known parasites of the GI tract. Blastocystis was the most commonly detected organism (71.6%). Also, the amount of Blastocystis DNA positively correlated with age in a single rural location in Honduras among a pediatric population.