INTRODUCTION
Severe fever with thrombocytopenia syndrome virus (SFTSV) is a tick-borne virus of the genus Banyangvirus, family Phenuiviridae, and order Bunyavirales that can cause hemorrhagic fever.1 Severe fever with thrombocytopenia syndrome (SFTS) was first confirmed in China in 2009, and retrospective serological studies showed that SFTSV-specific IgM and IgG were detected in the sera of patients in China in 1996 and retrospectively reported in South Korea in 2010, in Japan in 2013, and in Vietnam in 2017.2–6 Most SFTSV infections occur through bites from the tick Haemaphysalis longicornis, although SFTSV transmission can also occur through close contact with an infected patient.2–11
Scrub typhus is a bacterial disease caused by Orientia tsutsugamushi that is transmitted primarily by the bite of the Leptotrombidium spp. (Acari: Trombiculidae) infected with Orientia species, which is endemic in the “tsutsugamushi triangle” within the Asia-Pacific region. Mixed infections with SFTSV and O. tsutsugamushi in a patient have been reported.8,9
In South Korea, SFTS and scrub typhus are endemic and are major public health concerns between May and November and between October and November, respectively.8,9
The clinical presentations of SFTS and scrub typhus are similar at the early stage of infection: signs and symptoms typically develop within 1 and 2 weeks of infection and include fever, headache, malaise, and gastrointestinal symptoms, but SFTS exhibits a higher mortality rate than scrub typhus.2–11
In this study, we provide retrospective evidence of SFTSV infections or mixed infection with O. tsutsugamushi in patients’ sera collected in South Korea from 2000 to 2003. These findings confirmed that SFTSV infections in South Korea occurred earlier than reported in South Korea and Japan and were more concurrent with those in China. Considering SFTSV infection in patients with scrub typhus is also important for clinical diagnosis.2–5,8,9
MATERIALS AND METHODS
To investigate evidence of SFTSV or mixed infection with scrub typhus in South Korea, we examined 2,329 sera samples of patients from 2000 to 2003 for the diagnosis of rickettisal diseases at Seoul National University, Seoul, South Korea. The patients suffered from acute febrile illness from November 1, 2000, to November 1, 2003. This study was approved by the Institutional Review Board of Seoul National University Hospital.
Molecular analysis.
Molecular diagnosis and phylogenetic analysis of SFTSV were conducted. RNA was extracted from stored patients’ sera using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany). Two rounds of reverse transcription–polymerase chain reaction (RT-PCR) were performed to amplify the partial small (S) segment of the viral RNA from the stored serum and to confirm SFTSV infection.10,11 The partial RT-PCR products (114 and 346 bp, respectively) were sequenced using the BigDye Terminator Cycle Sequencing Kit (Perkin Elmer Applied Biosystems, Warrington, United Kingdom); phylogenetic analysis of partial S segment sequences (346 bp) was performed with MEGA6, and phylogenetic trees were constructed using the maximum likelihood method, which confirmed SFTSV infection (Figure 1).10,11
Phylogenetic tree constructed based on partial S segment sequences (346 bp) of severe fever with thrombocytopenia syndrome virus. The tree was constructed using the maximum likelihood method with MEGA6. The partial S sequences from the stored sera collected from November 1, 2000, to November 1, 2003, that were analyzed in this study are shown in bold. The partial S sequence data for the viruses identified in China, South Korea, and Japan were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Phylogenetic tree constructed based on partial S segment sequences (346 bp) of severe fever with thrombocytopenia syndrome virus. The tree was constructed using the maximum likelihood method with MEGA6. The partial S sequences from the stored sera collected from November 1, 2000, to November 1, 2003, that were analyzed in this study are shown in bold. The partial S sequence data for the viruses identified in China, South Korea, and Japan were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Phylogenetic tree constructed based on partial S segment sequences (346 bp) of severe fever with thrombocytopenia syndrome virus. The tree was constructed using the maximum likelihood method with MEGA6. The partial S sequences from the stored sera collected from November 1, 2000, to November 1, 2003, that were analyzed in this study are shown in bold. The partial S sequence data for the viruses identified in China, South Korea, and Japan were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Molecular diagnosis and phylogenetic analysis of the genotype of O. tsutsugamushi were conducted. DNA was extracted from stored patients’ sera samples using the QIAamp DNA Mini Kit (QIAGEN). Nested PCR (forward primer: GATCAAGCTTCCTCAGCCTACTATAATGCC, reverse primer: CGACAGATGCACTATTAGGC) was performed to amplify the 56-kDa antigen of O. tsutsugamushi from the stored serum, confirming O. tsutsugamushi infection.12 Nested PCR products (483 bp) were sequenced using the BigDye Terminator Cycle Sequencing Kit (Perkin Elmer Applied Biosystems). Phylogenetic analysis of O. tsutsugamushi 56-kDa gene sequences (483 bp) was performed with MEGA6 to determine the genotype of O. tsutsugamushi by comparing with the sequences from proto-genotypes, and phylogenetic trees were constructed using the maximum likelihood method, which confirmed O. tsutsugamushi infection (Figure 2).9,12,13
Phylogenetic tree constructed based on the Orientia tsutsugamushi 56-kDa gene sequences. The tree was constructed using the maximum likelihood method with MEGA6. The O. tsutsugamushi 56-kDa gene sequences from stored patient serum are shown in bold. The O. tsutsugamushi 56-kDa gene sequence data identified from China, South Korea, Japan, and India were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Phylogenetic tree constructed based on the Orientia tsutsugamushi 56-kDa gene sequences. The tree was constructed using the maximum likelihood method with MEGA6. The O. tsutsugamushi 56-kDa gene sequences from stored patient serum are shown in bold. The O. tsutsugamushi 56-kDa gene sequence data identified from China, South Korea, Japan, and India were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Phylogenetic tree constructed based on the Orientia tsutsugamushi 56-kDa gene sequences. The tree was constructed using the maximum likelihood method with MEGA6. The O. tsutsugamushi 56-kDa gene sequences from stored patient serum are shown in bold. The O. tsutsugamushi 56-kDa gene sequence data identified from China, South Korea, Japan, and India were obtained from NCBI/BLAST.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0392
Serologic testing for SFTSV and scrub typhus exposure.
Antibody detection in sera was carried out. An immunofluorescence assay (IFA) for SFTSV and scrub typhus was performed as previously described.7 L929 cells infected with three genotypes of O. tsutsugamushi (Boryong, Karp, and Gilliam strain) were mixed in equal amounts and used for IFA for scrub typhus.14 ELISA for SFTSV and scrub typhus was also performed as previously described.7 The cutoff value was set as the average absorbance value of the control sera (sera from healthy donors) plus three times the SD (mean absorbance + 3 × SD). A sample was considered positive if it yielded an absorbance value greater than the cutoff value.
RESULTS
Phylogenetic analysis of the partial S segment of SFTSV and serology study.
The partial S segment sequences of SFTSV were detected in nine patients by two rounds of RT-PCR, and the resulting phylogenetic tree of the partial S segment showed that the isolates were similar to those from China, South Korea, and Japan (Figure 1).10
Two thousand three hundred twenty-nine sera samples were tested for IgM and IgG antibodies against SFTSV using IFA and ELISA, and the results of the ELISA and IFA, which were used to detect IgM and IgG antibodies, showed that SFTSV-specific IgM or IgG antibodies were detected in the serum of the 12 patients (0.52%, 12/2,392) (Table 1). Ten of these 12 patients (83.33%) were potentially mixed-infected with scrub typhus as determined by serological diagnosis or bacterial DNA detection by nested PCR (Table 1). Nine of 2,329 sera (0.39%, 9/2,329) were clearly positive for SFTSV RNA.
Patients of SFTSV infection or mixed infection with scrub typus in this study
| No | Patients | Year of sampling | Age (years)/Sex | SFTSV (RT-PCR) | IgM of SFTSV (ELISA) | IgG of SFTSV (ELISA) | IgG of SFTSV (IFA) | Scrub typhus (IFA) | Scrub typhus (nested PCR) |
|---|---|---|---|---|---|---|---|---|---|
| 1 | 00–27,690 | November 2000 | NA | SFTSV | N | P | 160 | 2,560 | N |
| 2 | 01–28,360 | October 2001 | 65/F | N | N | P | N | 2,560 | Karp |
| 3 | 02–290 | November 2002 | 56/M | N | P | P | N | 2,560 | Karp |
| 4 | 02–431 | December 2002 | 81/M | SFTSV | N | P | 160 | N | N |
| 5 | 02–167 | November 2002 | 63/M | N | P | P | N | 2,560 | Boryong |
| 6 | 03–1,183 | November 2003 | 60/F | SFTSV | P | P | N | 2,560 | N |
| 7 | 02–140 | November 2002 | 70/F | SFTSV | P | P | 2,560 | 2,560 | Gilliam |
| 8 | 03–119 | March 2003 | 76/F | SFTSV | N | P | 2,560 | N | N |
| 9 | 03–323 | June 2003 | 70/M | SFTSV | N | P | 2,560 | N | Karp |
| 10 | 03–965 | November 2003 | NA | SFTSV | N | P | 2,560 | 40 | Gilliam |
| 11 | 03–194 | May 2003 | 84/F | SFTSV | N | P | 640 | 160 | N |
| 12 | 03–975 | November 2003 | 69/F | SFTSV | P | P | N | 640 | N |
IFA = immunofluorescence assay; NA = not available; N = negative; P = positive; RT-PCR = reverse transcription–polymerase chain reaction; SFTSV = severe fever with thrombocytopenia syndrome virus.
Phylogenetic analysis of the partial S segment of O. tsutsugamushi and serology study.
Twelve sera samples positive for anti-SFTSV NP IgG by ELISA were tested for IgG antibodies against O. tsutsugamushi using IFA. The IFA results used to detect IgG antibodies showed that O. tsutsugamushi–specific IgG antibodies were detected in the sera of the nine patients (Table 1). The 56-kDa gene sequence (483 bp) of O. tsutsugamushi was detected in six patients by nested PCR, and the resulting phylogenetic tree showed that the isolates were O. tsutsugamushi (Figure 2).9,12 Based on the results of genetic detection of the two pathogens, three of the nine SFTSV RNA-positive (33.3%) patients were coinfected with both pathogens.
DISCUSSION
Severe fever with thrombocytopenia syndrome is a new emerging viral disease in Asia that infects humans primarily through tick bites, and transmission via person-to-person contact has also been reported.2–11 Severe fever with thrombocytopenia syndrome virus was previously reported in South Korea in 2010, and in this study, we retrospectively confirmed 12 SFTSV infections or mixed infection with O. tsutsugamushi by amplification of the partial S segment of the viral RNA and the bacterial DNA, as well as detection of IgM and/or IgG antibodies against SFTSV and O. tsutsugamushi from the stored sera of patients who had acute febrile illness from November 1, 2000 to November 1, 2003, in South Korea.4,8,9
Based on genetic detection of the pathogens in sera samples, at least nine patients among 12 patients were clearly positive for SFTSV infection and six were positive for scrub typhus. Among them, three were positive only for scrub typhus and three patients were positive for both pathogens. Positive rate for scrub typhus is 33.3% (3/9), among nine SFTSV RNA-positive patients. Therefore, we suggest that SFTSV infections in South Korea occurred before previously reported cases and were more concurrent with those in China. Further clinical, epidemiological, and laboratory research is also needed to better understand the ecological transmission dynamics and geographic distribution of SFTSV and O. tsutsugamushi.
REFERENCES
- 1.↑
International Committee on Taxonomy of Viruses (ICTV), 2018. Taxonomy. Available at: https://talk.ictvonline.org/taxonomy/. Accessed February 1, 2019.
- 2.↑
Yu XJ et al. 2011. Fever with thrombocytopenia associated with a novel bunyavirus in China. N Engl J Med 364: 1523–1532.
- 3.
Hu J et al. 2018. A cluster of cases of severe fever with thrombocytopenia syndrome bunyavirus infection in China, 1996: a retrospective serological study. PLoS Negl Trop Dis 12: e0006603.
- 4.↑
Kim YR, Yun Y, Bae SG, Park D, Kim S, Lee JM, Cho NH, Kim YS, Lee KH, 2018. Severe fever with thrombocytopenia syndrome virus infection, South Korea, 2010. Emerg Infect Dis 24: 2103–2105.
- 5.↑
Takahashi T et al. 2014. The first identification and retrospective study of severe fever with thrombocytopenia syndrome in Japan. J Infect Dis 209: 816–827.
- 6.↑
Tran XC, Yun Y, Van An L, Kim SH, Thao NTP, Man PKC, Yoo JR, Heo ST, Cho NH, Lee KH, 2019. Endemic severe fever with thrombocytopenia syndrome in Vietnam. Emerg Infect Dis 25: 1029–1031.
- 7.↑
Yoo JR, Heo ST, Park D, Kim H, Fukuma A, Fukushi S, Shimojima M, Lee KH, 2016. Family cluster analysis of severe fever with thrombocytopenia syndrome virus infection in Korea. Am J Trop Med Hyg 95: 1351–1357.
- 8.↑
Wi YM, Woo HI, Park D, Lee KH, Kang CI, Chung DR, Peck KR, Song JH, 2016. Severe fever with thrombocytopenia syndrome in patients suspected of having scrub typhus. Emerg Infect Dis 22: 1992–1995.
- 9.↑
Yoo JR, Heo ST, Kang JH, Park D, Kim JS, Bae JH, Woo JJ, Kim S, Lee KH, 2018. Mixed infection with severe fever with thrombocytopenia syndrome virus and two genotypes of scrub typhus in a patient, South Korea, 2017. Am J Trop Med Hyg 99: 287–290.
- 10.↑
Zhang YZ et al. 2012. Hemorrhagic fever caused by a novel bunyavirus in China: pathogenesis and correlates of fatal outcome. Clin Infect Dis 54: 527–533.
- 11.↑
Yun Y et al. 2015. Phylogenetic analysis of severe fever with thrombocytopenia syndrome virus in South Korea and migratory bird routes between China, South Korea, and Japan. Am J Trop Med Hyg 93: 468–474.
- 12.↑
Lee YM, Kim DM, Lee SH, Jang MS, Neupane GP, 2011. Phylogenetic analysis of the 56 kDa protein genes of Orientia tsutsugamushi in southwest area of Korea. Am J Trop Med Hyg 84: 250–254.
- 13.↑
Kim G et al. 2017. Diversification of Orientia tsutsugamushi genotypes by intragenic recombination and their potential expansion in endemic areas. PLoS Negl Trop Dis 11: e0005408.
- 14.↑
Ha NY, Kim Y, Min CK, Kim HI, Yen NTH, Choi MS, Kang JS, Kim YS, Cho NH, 2017. Longevity of antibody and T-cell responses against outer membrane antigens of Orientia tsutsugamushi in scrub typhus patients. Emerg Microbes Infect 6: e116.