INTRODUCTION
Enteroaggregative Escherichia coli (EAEC) is an emerging diarrheal pathogen worldwide.1,2 Since its discovery in pediatric diarrhea by Nataro et al.,3 EAEC has increasingly been identified from diarrhea patients, especially from children. In developed and developing countries, it is recognized as an important pathogen in outbreaks of acute diarrhea.4,5 Enteroaggregative Escherichia coli appears to cause subclinical infection or only intestinal colonization as opposed to the clear association with diarrhea in some individuals.6–8 Some reports have shown that EAEC infection could result in intestinal inflammation, leading to childhood malnutrition and growth impairment.9
Virulence of EAEC strains for humans has been proposed to be genetically and phenotypically diverse.6,10 With the advent of sequencing, the complete genome sequence of a prototypical strain of EAEC 042 has been published, and this has led to insights about the pathogen.11 A plethora of virulence-related genes have been reported, nevertheless, not present in all EAEC strains. The virulence factors of EAEC are encoded in the bacterial chromosome and its virulence plasmid termed pAA.12 Virulence determinants include aggregative adherence regulator (aggR), which is shown to regulate most of the EAEC virulence genes, including aggregative adherence fimbriae (AAFs) with four known variants (including aggA[AAF/I], aafA [AAF/II], agg3A[AAF/III], and agg4A [AAF/IV]).8,13,14 Antiaggregation protein gene (aap) and activated island (aaiC) are also under the control of aggR.8
Serine protease autotransporters of Enterobacteriaceae (SPATEs) are a group of EAEC genes not regulated by aggR. The SPATEs group includes the following genes: plasmid encoded toxin gene (pet) putative, secreted autotransporter toxin gene (sat), Shigella IgA–like protease homologue gene (sigA), a mucinase that promotes intestinal colonization (pic), and Shigella extracellular protease (sepA).15 Whereas pet is plasmid encoded, pic, set, and sat are encoded on the chromosome. Other virulence genes of importance regulated by aggR include eilA (EAEC HilA homologue), capU (cap locus that encodes a protein 50% identical to an rfbU-related lipopolysaccharide biosynthetic gene of E. coli O157: H7), hypotheticals orf3 (cryptic protein), and orf61 (plasmid-encoded hemolysin).6,8,16
The gold standard test for identification of EAEC is based on a characteristic aggregative pattern of adherence (AA) to HEp-2 cells.3,6 Two diagnostic genes (aaiC and aatA) have been proposed for the identification of EAEC. Studies related to prevalence and gene characterization of EAEC have been reported around the world from clinical samples and the significance of some specific genes noted.1,17,18 In Mali, Boisen et al.8 found the autotransporter protease SepA as the most strongly associated with diarrhea due to EAEC strains, whereas in Brazil, a combination of aaiC and agg3/4C, but lacking agg4A and orf61, was associated with diarrhea cases.15 These findings underscore the heterogeneity of EAEC strains.
Enteroaggregative Escherichia coli infection has been associated with diarrhea.3 A high prevalence of EAEC-associated diarrhea was found among the children in South African site of the MAL-ED study (The Etiology, Risk Factors and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Development Project).19 Apart from studies by Samie et al.2 in the Venda region of South Africa on three virulence genes of EAEC (aggR, aap, and AA probe) on HIV-infected adults and school children, limited data exist on the prevalence of virulence genes of EAEC and their association with diarrhea. In the present study, we used multiplex polymerase chain reactions (PCRs) to determine the distribution of EAEC virulence genes in stool samples obtained from children enrolled and followed up from 1 to 12 months of age, who were part of the MAL-ED study cohort in the Dzimauli community in the Limpopo Province of South Africa.
MATERIALS AND METHODS
Study population and ethical considerations.
Stools samples used to study the prevalence of EAEC virulent genes were obtained from 97 children enrolled in the MAL-ED birth cohort study. The MAL-ED study aimed to evaluate the impact of intestinal infections on gut function, vaccine response, growth, and cognitive development in developing countries. The enrollment of study participants and study population in Dzimauli, South Africa, has been described.19 The South African site is a rural community in northern South Africa characterized by poor sanitation and lack of access to potable water supply. The purpose of the study was explained to the mothers and/or the child’s legal guardian, and written informed consent was obtained. We enrolled only participants who gave informed consent. The study protocol was approved by the Safety, Health and Research Ethics Committee of the University of Venda, South Africa, and the Institutional Review Board of the University of Virginia, USA.
Sample collection.
Stool samples were collected monthly from the study participants, as well as diarrhea samples whenever available (166 nondiarrheal and 11 diarrheal). The samples were aliquoted in 1.5-mL Eppendorf tubes. A gram of stool was collected using the wooden spatula or 1 mL of liquid stool using the transfer pipette. The stools samples were transported on Cary-Blair transport media and analyzed within 4 hours
Bacteriology and genomic DNA purification.
Stool specimens were directly streaked onto MacConkey agar (Difco, Detroit, MI) for isolation of E. coli. Isolates were confirmed by biochemical tests using standard procedures. Suspected E. coli colonies from a sample were collected and stored at −80°C or further analysis. DNA from suspected E. coli colonies was extracted using modified method as previously reported.20 Briefly, selected colonies were resuspended in 500 μL of molecular biology–grade water, subjected to boiling at 100°C in a water bath for 10 minutes, cooled on ice, and centrifuged at 15,000 × g for 15 minutes before it was stored at −20°C. Aliquots of 5 μL of template DNA were used for PCR. Preliminary identification of EAEC was carried out by amplification of its diagnostic genes aaiC and aatA in a multiplex reaction of nine genes with other E. coli pathotypes.21
Multiplex polymerase chain reaction.
Confirmation of enteroaggregative E. coli identity of the isolates was further performed by amplifying aaiC (chromosomal gene) and aatA (plasmid gene). The aatA gene was previously referred to as CVD432 (or AA probe), when its specific probe was first published.22 Both diagnostic genes and 17 virulence genes selected for this study were amplified by conventional multiplex PCR (five multiplex reaction sets) using DreamTaq DNA polymerase master mix (Thermo Scientific, Waltham, MA), which contains 2× DreamTaq Green buffer; dATP, dCTP, dGTP, and dTTP, 0.4 mM each; and 4 mM MgCl2. A single PCR reaction had a final volume of 25 µL and composed of 12.5 µL of the master mix, 2.5 μL (1 µM) of each forward and reverse primer solution (in a final concentration of 10 µM), and 5 µL of E. coli DNA. Nuclease-free water was used to complete the final volume. Conditions for amplification for each set of multiplex PCR reaction are listed in (Table 1) using thermal cycler (Bio-Rad Laboratories). PCR products were visualized and photographed using ChemiDoc XRS (Bio_Rad Laboratories, Berkeley, CA) after the products were resolved in 1.5% agarose gel electrophoresis. Primers used in this study are indicated in Table 1.
Primers used for the five multiplex polymerase chain reactions (PCRs) and quantitative real-time PCR
| Target gene (GenBank accession no.) | Multiplex PCR | Primer sequence (5′-3′) | Amplicon size (bp) | PCR conditions (35 cycles) | Reference |
|---|---|---|---|---|---|
| aaiC—aggR-activated island (FN554766.1) | 5 | TGGTGACTACTTTGATGGACATTGT GACACTCTCTTCTGGGGTAAACGA | 215 | 20 seconds at 95°C, 20 seconds at 57°C, and 1 minute at 72°C | 8 |
| aatA—anti-aggregation protein transporter (AY351860) | 5 | CAGACTCTGGCRAAAGACTGTATCAT CAGCTAATAATGTATAGAAATCCGCTGT | 630 | 20 seconds at 95°C, 20 seconds at 57°C, and 1 minute at 72°C | 8 |
| astA—aggregative heat-stable toxin A, EAST1 (L11241) | 1 | ATGCCATCAACACAGTATAT GCGAGTGACGGCTTTGTAGT | 110 | 60 seconds at 94°C, 1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| pet—plasmid-encoded toxin (AF056581) | 1 | GGCACAGAATAAAGGGGTGTTT CCTCTTGTTTCCACGACATAC | 302 | 60 seconds at 94°C, 1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| pic—protein involved in colonization (AF097644) | 1 | ACTGGATCTTAAGGCTCAGGAT TAATGTCACTGTTCAGCG | 572 | 60 seconds at 94°C,1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| sigA—Shigella IgA–like protease homologue (NC_004337 | 2 | CCGACTTCTCACTTTCTCCCG CCATCCAGCTGCATAGTGTTTG | 430 | 60 seconds at 94°C, 1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| sat—secreted autotransporter toxin (AE014075) | 2 | TCAGAAGCTCAGCGAATCATTG CCATTATCACCAGTAAAACGCACC | 932 | 60 seconds at 94°C, 1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| sigA—Shigella IgA–like protease homologue (NC_004337) | 2 | CCGACTTCTCACTTTCTCCCG CCATCCAGCTGCATAGTGTTTG | 430 | 60 seconds at 94°C, 1.5 minutes at 58°C, and 1.5 minutes at 72°C | 8 |
| orf3—cryptic protein (FN554767.1) | 3 | CAGCAACCATCGCATTTCTACGCATCTTTCAATACCTCCA | 121 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| eilA—Salmonella HilA homologue (FN554766.1 | 3 | AGGTCTGGAGCGCGAGTGTT GTAAAACGGTATCCACGACC | 248 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| capU—hexosyltransferase homologue (AF134403) | 3 | CAGGCTGTTGCTCAAATGAAGTTCGACATCCTTCCTGCTC | 395 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| agg4A—AAF/IV fimbrial subunit (EU637023) | 4 | TGAGTTGTGGGGCTAYCTGGACACCATAAGCCGCCAAATAAGC | 169 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| aafA—AAF/II fimbrial subunit (AF012835) | 4 | CTACTTTATTATCAAGTGGAGCCGCTAGGAGAGGCCAGAGTGAATCCTG | 289 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| agg3A—AAF/III fimbrial subunit (AF411067) | 4 | CCAGTTATTACAGGGTAACAAGGGAATTGGTCTGGAATAACAACTTGAACG | 370 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
| aafC—usher, AAF/II assembly unit (AF114828) | 4 | ACAGCCTGCGGTCAAAAGCGCTTACGGGTACGAGTTTTACGG | 491 | 50 seconds at 94°C, 1.5 minutes at 57°C, and 1.5 minutes at 72°C | 8 |
N.B. Conventional multiplex PCR reaction was performed in five sets. No. (1–5) represent genes involved in each set of reaction.
Statistical analysis.
Results were analyzed using SPSS software version 22 (SPSS Inc., Chicago, IL). Data derived from children with or without diarrhea were compared using chi-square test. Associations were performed between the genes, age, and seasons of sample collection. Differences were considered significant when the P-value was < 0.05.
RESULTS
Characteristics of subjects and features of stool samples.
The 177 suspected EAEC-positive samples were obtained from 97 children of whom 46 were females. Diarrhea was not common among these children. Diarrheal positive samples were 11/177 (6.2%) of all samples tested. Twelve samples (6.7%) presented with mucus (five diarrheal and seven nondiarrheal). None of the stool samples had blood.
Prevalence of EAEC diagnostic genes.
Identification of EAEC was based on the presence of either aaiC or aatA gene. The chromosomal gene aaiC was the most common and was detected in 85/177 (48.0%), whereas the plasmid-encoded gene aatA was present in 46/177 (26.0%). Both genes (aaiC and aatA) were present in 46/177 (26.0%) of the EAEC isolates. All the 177 suspected EAEC isolates harbored either aaiC, aatA, or both.
Detection of frequencies of virulence-related genes using conventional multiplex PCR.
To investigate the prevalence of EAEC virulence genes in the 177 isolates, we performed five groups of multiplex PCR assays targeting 17 genes. Some of these genes are plasmid encoded (pAA-encoded genes) and others are chromosomally encoded. Our results from this amplification showed that all isolates analyzed carried at least one of the 17 virulence genes. Frequencies of each of these genes are shown in Table 2. Different genotype combinations were found in this population. Plasmid-borne gene encoding cryptic protein Orf61 was the most frequently detected (84.7%), followed by Orf3 (73.4%), astA (72.3%), aggR (55.4%), capU (48.6%), and EAEC HilA homologue eilA (44.1%) (Table 2).
Prevalence of genes by conventional multiplex PCR and distribution among gender and diarrheal and nondiarrheal cases
| Enteroaggregative Escherichia coli virulence genes | Gender | Diarrheal | |||||
|---|---|---|---|---|---|---|---|
| Male | Female | Total | Nondiarrheal | Diarrheal | Total | χ2, P | |
| aatA | 54 (55.7%) | 38 (47.5%) | 92 (52) | 87 (53.4) | 3 (27.3) | 90 | χ2 = 2.812; P = 0.094 |
| aaiC | 68 (70.1%) | 62 (77.5%) | 130 (73.4) | 118 (72.8) | 10 (90.9) | 128 | χ2 = 1.817; P = 0.178 |
| astA | 63 (64.9%) | 65 (81.3%) | 128 (72.3) | 120 (73.6) | 7 (63.6) | 127 | χ2 = 0.521 ; P = 0.470 |
| pet | 17 (17.5%) | 20 (25.0%) | 37 (20.9) | 34 (20.9) | 2 (18.2) | 36 | χ2 = 0.045 ; P = 0.832 |
| pic | 34 (35.1%) | 33 (41.3%) | 67 ( 37.9) | 62 (38.0) | 4 (36.4) | 66 | χ2 = 0.012 ; P = 0.912 |
| sigA | 18 (18.6%) | 15 (17.5%) | 33 (18.6) | 29 (88.1) | 4 (36.4) | 33 | χ2 = 2.313; P = 0.128 |
| sep | 2 (2.1%) | 2 (2.5%) | 4 (2.3) | 3 (1.8) | 0 (0) | 3 | χ2 = 0.206; P = 0.650 |
| orf3 | 65 (67.0%) | 65 (81.3%) | 130 (73.4) | 118 (72.4) | 9 (81.8) | 127 | χ2 = 0.464; P = 0.496 |
| aap | 12 (12.5%) | 14 (17.5%) | 26 (14.8) | 24 (14.8) | 1 (9.1) | 25 | χ2 = 0.273; P = 0.601 |
| aggR | 49 (50.5%) | 49 (61.3%) | 98 (55.4) | 90 (55.2) | 5 (45.5) | 95 | χ2 = 0.396; P = 0.529 |
| Orf61 | 82 (84.5%) | 68 (85.0%) | 150 (84.7) | 139 (85.3) | 9 (81.8) | 148 | χ2 = 0.097; P = 0.756 |
| eilA | 38 (39.2%) | 40 (50.0%) | 78 (44.1) | 73 (44.8) | 4 (36.4) | 77 | χ2 = 0.296; P = 0.589 |
| CapU | 45 (46.4%) | 41 (51.3%) | 86 (48.6) | 77 (47.2) | 7 (63.7) | 84 | χ2 = 1.110; P = 0.292 |
| aafA | 8 (8.2%) | 6 (7.5%) | 14 (7.9) | 13 (7.4) | 1 (9.1) | 13 | χ2 = 0.045; P = 0.834 |
| aafC | 6 (6.2%) | 8 (10.0%) | 14 (7.9) | 13 (8.0) | 1 (9.1) | 14 | χ2 = 0.017; P = 0.895 |
| agg4a | 32 (33.0%) | 26 (32.5%) | 58 (32.8) | 55 (33.1) | 3 (27.3) | 58 | χ2 = 0.160; P = 0.689 |
| agg3A | 17 (17.5%) | 16 (20.0%) | 33 (18.6) | 30 (18.4) | 2 (18.2) | 32 | χ2 = 0.000 ; P = 0.985 |
| aggA | 27 (27.8%) | 31 (38.8%) | 58 (32.8) | 56 (34.4) | 2 (18.2) | 58 | χ2 = 1.213; P = 0.273 |
Aggregative adherence fimbriae, which are the main mucosal adhesins of EAEC were also detected. The AAFs comprises aggA (AAF/I), aafA (AAF/II), agg3A (AAF/III), and agg4A (AAF/IV). aggA (AAF/I) (32.8%) and agg4A (AAF/IV) (32.8%) were the most prevalent genes detected, followed by agg3A (AAF/III) (18.6%) and aafA (AAF/II) (7.9%). AAFs were absent in 71/177 (40.1%) of our isolates; 106/177 (59.8%) and 42/177 (23.7%) were positive for more than one and two genes, respectively. Among the genes encoding SPATEs, the frequencies of detection were as follows: pic, 67 (37.9%); pet, 37 (20.9%); sigA, 33 (18.6); sepA, 4 (2.3%); and sat, 0 (0 %).
The prevalence of virulent genes was evenly distributed between women and men (Table 2). There was no statistically significant difference between the distribution of genes between diarrheal and nondiarrheal samples (P > 0.05) (Table 2).
Detection of multiple genes.
In this study, a number of isolates were found to possess multiple genes. Combinations of six genes were the most prevalent (37 isolates), whereas a combination of 16 or 18 genes were the least prevalent, occurring in one isolate each. No isolate had all 19 genes. Gene number and frequencies of distribution are presented in Figure 1.
Occurrence of multivirulence factors and frequency of distribution in enteroaggregative Escherichia coli isolates.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0192
Occurrence of multivirulence factors and frequency of distribution in enteroaggregative Escherichia coli isolates.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0192
Occurrence of multivirulence factors and frequency of distribution in enteroaggregative Escherichia coli isolates.
Citation: The American Journal of Tropical Medicine and Hygiene 101, 5; 10.4269/ajtmh.19-0192
Gene distribution according to age group and season.
The identified virulent genes were more prevalent in stools obtained from the 7–12 months of life compared with those obtained from 1 to 6 months of life. The frequency of occurrence of the pic gene (51/177) was slightly significantly higher in EAEC isolates obtained from the 7–12 months of life (P = 0.04) when compared with those obtained between 1 and 6 months of life (15/177) (Table 3).
Distribution of enteroaggregative Escherichia coli virulence genes among the different age groups
| Virulence genes | Age group (1–6 months) | Age group (7–12 months) | χ2, P |
|---|---|---|---|
| aatA | 11 (40.7) | 79 (53.7) | χ2 = 1.544; P = 0.214 |
| aaiC | 21 (77.8) | 107 (72.8) | χ2 = 2.92; P = 0.589 |
| astA | 19 (70.4) | 108 (73.5) | χ2 = 0.111; P = 0.739 |
| pic | 15 (55.6) | 51 (34.7) | χ2 = 4.217; P = 0.04 |
| sigA | 7 (25.9) | 26 (17.7) | χ2 = 1.007; P = 0.316 |
| sep | 1 (3.7) | 2 (1.4) | χ2 = 0.739; P = 0.390 |
| Orf3 | 20 (74.1) | 107 (72.8) | χ2 = 0.019; P = 0.890 |
| aap | 5 (19.2) | 20 (13.6) | χ2 = 0. 565; P = 0.452 |
| aggR | 16 (59.3) | 79 (53.7) | χ2 = 0. 280; P = 0.597 |
| Orf61 | 25 (92.6) | 123 (83.7) | χ2 = 1.428; P = 0.232 |
| eilA | 15 (55.6) | 62 (42.2) | χ2 = 1.655; P = 0.198 |
| capU | 9 (33.3) | 75 (51.0) | χ2 = 2.858; P = 0.091 |
| aafA | 2 (7.4) | 11 (7.5) | χ2 = 0.000; P = 0.989 |
| aafC | 1 (3.7) | 13 (8.8) | χ2 = 0.814; P = 0.367 |
| Agg4A | 7 (12.3) | 50 (87.7) | χ2 = 0.677; P = 0.410 |
| Agg3A | 5 (18.5) | 27 (18.4) | χ2 = 0.000; P = 0.985 |
| aggA | 8 (29.6) | 50 (34.0) | χ2 = 0.197; P = 0.657 |
| pet | 6 (22.2) | 30 (20.4) | χ2 = 0.046; P = 0.831 |
| Total | 172 | 1,020 | – |
Bold values indicate the genes for which there was a significant difference in the prevalence in the different age groups (P < 0.05).
Winter was the season with the highest detection rates. Generally, the distribution of EAEC virulence genes during the various seasons revealed no associations for most of the genes (Table 4). However, there was an association of aatA (P = 0.032) gene with highest detection rates of 38 (63.3%) observed during spring, whereas aaiC (P = 0.040) and capU (P = 0.033) were mostly detected in summer with detection rates of 45 (64.3%) and 33 (63.5%), respectively (Table 4).
Seasonal distribution of enteroaggregative Escherichia coli (EAEC) virulence genes
| EAEC virulence genes | Winter | Spring | Summer | χ2, P |
|---|---|---|---|---|
| aatA | 32 (51.6) | 38 (63.3) | 30 (38.5) | χ2 = 6.902; P = 0.032 |
| aaiC | 42 (67.7) | 41 (68.3) | 45 (64.26) | χ2 = 6.426; P = 0.040 |
| astA | 41 (66.1) | 44 (73.3) | 42 (80.8) | χ2 = 3.080; P = 0.214 |
| pic | 21 (33.9) | 21 (35.0) | 24 (46.2) | χ2 = 2.146; P = 0.342 |
| sigA | 12 (19.4) | 10 (16.7) | 11 (21.2) | χ2 = 0.374; P = 0.829 |
| sep | 3 (4.8) | 0 (0.0) | 0 (0.0) | χ2 = 5.514; P = 0.063 |
| Orf3 | 47 (75.8) | 45 (75.0) | 35 (67.3) | χ2 = 1.224; P = 0.542 |
| aap | 12 (19.7) | 5 (8.3) | 15 (13.5) | χ2 = 3.265; P = 0.195 |
| aggR | 38 (61.3) | 28 (46.7) | 30 (57.7) | χ2 = 2.827; P = 0.243 |
| Orf61 | 53 (85.5) | 54 (90.0) | 40 (76.9) | χ2 = 3.707; P = 0.157 |
| eilA | 29 (46.8) | 26 (43.3) | 22 (42.3) | χ2 = 0.260; P = 0.878 |
| capU | 26 (41.9) | 25 (41.7) | 33 (63.5) | χ2 = 6.850; P = 0.033 |
| aafA | 5 (8.1) | 2 (3.3) | 6 (11.5) | χ2 = 2.762; P = 0.251 |
| aafC | 6 (9.7) | 1 (1.7) | 7 (13.5) | χ2 = 5.585; P = 0.061 |
| Agg4A | 23 (37.1) | 16 (26.7) | 18 (34.6) | χ2 = 1.622; P = 0.444 |
| Agg3A | 10 (16.1) | 8 (13.3) | 13 (25.0) | χ2 = 2.777; P = 0.249 |
| aggA | 20 (32.3) | 19 (31.7) | 19 (36.5) | χ2 = 0.348 ; P = 0.840 |
| pet | 14 (22.6) | 8 (13.3) | 15 (28.8) | χ2 = 4.104; P = 0.128 |
| Total | 434 | 391 | 405 | – |
Bold values indicate the genes for which there was a significant difference in the prevalence during the different seasons (P < 0.05).
DISCUSSION
The emergence of EAEC as an important cause of diarrhea has increasingly been recognized worldwide.23–25 Understanding of the epidemiology and pathogenesis of this was heightened following sequencing of prototypical strain of EAEC (strain 042), which revealed several virulence-related genes. However, studies conducted in different geographical regions of the world have revealed differences in prevalence of specific virulent markers, especially in association with diarrhea.1,8,15 Such noted differences could explain why the association between EAEC and diarrhea is not a rule, as some epidemiologic studies have reported no association between EAEC and diarrhea.1,6 In the present study, we sought the prevalence of EAEC virulence factors in a rural population in northern South Africa and its association with diarrhea and demographic factors. This was a community-based cohort study with participants with or without diarrhea who were part of the MAL-ED cohort contrary to most studies on EAEC virulence gene prevalence, which are case–control. This study area was characterized by poor sanitation and lack of potable water.
The aggR-activated island C (aaiC) and EAEC ABC transporter A (aatA) probe has been used extensively in EAEC diagnosis and epidemiology. Worthy of note is the fact that these have not been identified among non-EAEC genomes deposited in the GenBank.26 In our study, 85 (48.0%) of EAEC isolates were positive for aaiC and 46 (26.0%) were positive for aatA. This pattern is similar to that observed in other studies where a higher prevalence was observed for aaiC when compared with aatA.13 However, our findings are contrary to that of Boisen et al.8 who reported a higher prevalence of 83 (68.6%) for aatA when compared with 58 (47.9%) for aaiC. Thus, either gene can be common among EAEC isolates in different African regions.
Our isolates harbored a diverse range and combination of virulence genes. We found no significant association between any one gene or group of genes with diarrhea (P > 0.05), given diarrhea was not a common feature in this study. However, additional studies are underway to assess potential associations of specific EAEC virulence traits with other clinically important manifestations, such as enteropathy or growth impairment. Cryptic protein Orf61 (84.7%) and Orf3 (73.4%) were the most frequently detected genes. These findings are like those of Boisen et al.8 who in their study in Mali reported a high prevalence of the newly detected Orf3 (86.0%) and Orf61 (59.5%) among the strains studied. The key regulator gene (aggR) was detected in 55.4% of our isolates and this accords the finding of Lima et al.15 and Mendez-Arancibia et al.16 who described similar prevalence in their studies in Brazil and Tanzania, respectively. AggR is the regulatory gene that controls a number of plasmid genes encoding virulence factors, in addition to pathogenicity islands in the EAEC chromosome associated with its pathogenesis. Most EAEC-positive isolates lacked the aggR gene, further confirming that this gene may not be a good marker for diagnosis of EAEC as suggested by several reports.27,28 Also, some isolates were negative for the aggR gene but positive for a number of genes controlled by the key regulator gene and vice versa.
The importance of AAFs cannot be overemphasized with varying percentage isolation of the different variants reported in each study. Our findings are similar with those of several studies that have reported fairly similar prevalence of either one or more of the AAFs.1,4,6 The aggA (AAF/I) (32.8%) and agg4A (AAF/IV) (32.8%) were the most prevalent gene variants detected in our study. This is in line with the finding of Lima et al.15 who reported these AAFs to be the most prevalent in their study. However, contrary to the finding of Okeke et al.,1 of a strong association between AAF/II fimbriae with diarrhea in their study population with suggestion that this variant could serve as a marker for disease. Depending on the detection rates of SPATEs, genes vary as follows: pic, 67 (37.9%); pet, 37 (20.9%); sigA, 33 (18.6); sepA, 4 (2.3%); and sat, 0 (0 %). Our study is seemingly the first study with no detection of the sat gene. However, other studies have reported a low prevalence of this gene in their study area.1,16 Although we found a relatively high prevalence of some of these genes in our study population compared with other studies,1,2,8,15 we are amidst exploring potential correlations with enteropathy and growth, in addition to our relatively low rates of diarrheal illnesses. However, considering the lack of proper sanitation or access to potable water, the high prevalence of these genes is not surprising and will be important to understand better.
The distribution of most EAEC genes in our study was similar between women and men. EAEC virulence genes were not significantly associated with diarrhea (P > 0.05). This finding is consistent with previous reports from developing regions that the percentage of EAEC among diarrheal cases ranged from 4.5% to 39%.1,7,29,30 However, the low prevalence of diarrhea cases in our study area may preclude our finding potential associations. Studies carried out in England, Germany, the United States, and Romania implicated EAEC as a common bacterial cause of diarrhea,23–25 which is not consistent with the observation in this study. Noteworthy is the fact that this is a cohort study with most samples being taken on a monthly basis in the absence of overt diarrheal illnesses.
Multivirulence gene occurrence was a common phenomenon among the isolates investigated. Our results are consistent with the work of other investigators who have reported a high prevalence of multigenes in their study.16 Despite the large number of putative EAEC virulence factors identified in our isolates, no single factor appears to be consistently present in all isolates. This further confirms the previous reports of other investigators.1,10,16
There were fewer isolates from the age group 1–6 months as compared with 7–12 months. The gene pic was significantly different between the two age groups (P = 0.04). EAEC are infrequent in early childhood life but appear to be acquired in early childhood. Children are normally fed breast milk during the first 6 months of life after which different food types are introduced, which is likely to expose the children to infections. Also, differences in feeding practices between these two age groups may account for the difference observed. Most of our isolates were collected during the season of winter dropping slightly through spring and summer. The following genes were significantly different between the various seasons (aaiC [P = 0.040], aatA [P = 0.032], and capU [P = 0.033]). A similar pattern was observed by Pillay-van Wyk and Swingler31 in Cape Town where they found that EAEC increased in August to December among children presenting with dehydrating diarrhea. October and August are early summer and late winter months, respectively, in South Africa. Infection might occur from consumption of contaminated long-term stored food or water during winter because of hibernation from the cold weather, which prevents frequent fetch of food and water.
The present study has demonstrated a high prevalence of EAEC virulence genes in our study population even in the absence of overt diarrheal symptoms. Enteroaggregative Escherichia coli isolates were highly heterogeneous. Orf61 was the most prevalent gene observed and could serve as a marker for identification of EAEC in this region. Specific genes may provide additional markers for study of disease associations with age and season of sample collection.
Acknowledgments:
The Etiology, Risk Factors and Interactions of Enteric Infections and Malnutrition and the Consequences for Child Health and Development Project (MAL-ED) is carried out as a collaborative project supported by the Bill & Melinda Gates Foundation, the Foundation for the National Institute of Health, and the Fogarty International Center, National Institutes of Health. Additional support for N. T. was obtained from the grant Award Number D43 TW009359 from the Fogarty International Center (FIC) of the National Institutes of Health (USA). We appreciate the families who participated in this study and the project field staff for their hard work and dedication.
REFERENCES
- 1.↑
Okeke IN, Lamikanra A, Czeczulin J, Dubovsky F, Kaper JB, Nataro JP, 2000. Heterogeneous virulence of enteroaggregative Escherichia coli strains isolated from children in southwest Nigeria. J Infect Dis 181: 252–260.
- 2.↑
Samie A, Obi CL, Dillingham R, Pinkerton RC, Guerrant RL, 2007. Enteroaggregative Escherichia coli in Venda, South Africa: distribution of virulence-related genes by multiplex polymerase chain reaction in stool samples of human immunodeficiency virus (HIV)-positive and HIV-negative individuals and primary school children. Am J Trop Med Hyg 77: 142–150.
- 3.↑
Nataro JP, Kaper JB, Robins-Browne R, Prado V, Vial P, Levine MM, 1987. Patterns of adherence of diarrheagenic Escherichia coli to HEp-2 cells. Pediatr Infect Dis J 6: 829–831.
- 4.↑
Huang DB, Mohamed JA, Nataro JP, DuPont HL, Jiang ZD, Okhuysen PC, 2007. Virulence characteristics and the molecular epidemiology of enteroaggregative Escherichia coli isolates from travellers to developing countries. J Med Microbiol 56: 1386–1392.
- 5.↑
Scavia G, Staffolani M, Fisichella S, Striano G, Colletta S, Ferri G, Escher M, Minelli F, Caprioli A, 2008. Enteroaggregative Escherichia coli associated with a foodborne outbreak of gastroenteritis. J Med Microbiol 57: 1141–1146.
- 6.↑
Regua-Mangia AH, Gomes TA, Vieira MA, Irino K, Teixeira LM, 2009. Molecular typing and virulence of enteroaggregative Escherichia coli strains isolated from children with and without diarrhoea in Rio de Janeiro city, Brazil. J Med Microbiol 58: 414–422.
- 7.↑
Meng CY, Smith BL, Bodhidatta L, Richard SA, Vansith K, Thy B, Srijan A, Serichantalergs O, Mason CJ, 2011. Etiology of diarrhea in young children and patterns of antibiotic resistance in Cambodia. Pediatr Infect Dis J 30: 331–335.
- 8.↑
Boisen N et al. 2012. Genomic characterization of enteroaggregative Escherichia coli from children in Mali. J Infect Dis 205: 431–444.
- 9.↑
Steiner TS, Samie A, Guerrant RL, 2006. Infectious diarrhea: new pathogens and new challenges in developed and developing areas. Clin Infect Dis 43: 408–410.
- 10.↑
Czeczulin JR, Whittam TS, Henderson IR, Navarro-Garcia F, Nataro JP, 1999. Phylogenetic analysis of enteroaggregative and diffusely adherent Escherichia coli. Infect Immun 67: 2692–2699.
- 11.↑
Chaudhuri RR, Sebaihia M, Hobman JL, Webber MA, Leyton DL, Goldberg MD, Cunningham AF, Scott-Tucker A, Ferguson PR, 2010. Complete genome sequence and comparative metabolic profiling of the prototypical enteroaggregative Escherichia coli strain 042. PLoS One 5: e8801.
- 12.↑
Morin N, Tirling C, Ivison SM, Kaur AP, Nataro JP, Steiner TS, 2010. Autoactivation of the AggR regulator of enteroaggregative Escherichia coli in vitro and in vivo. FEMS Immunol Med Microbiol 58: 344–355.
- 13.↑
Bernier C, Gounon P, Le Bouguénec C, 2002. Identification of an aggregative adhesion fimbria (AAF) type III-encoding operon in enteroaggregative Escherichia coli as a sensitive probe for detecting the AAF-encoding operon family. Infect Immun 70: 4302–4311.
- 14.↑
Nataro JP, Deng Y, Maneval DR, German AL, Martin WC, Levine MM, 1992. Aggregative adherence fimbriae I of enteroaggregative Escherichia coli mediate adherence to HEp-2 cells and hemagglutination of human erythrocytes. Infect Immun 60: 2297– 2304.
- 15.↑
Lima IF et al. 2013. Prevalence of enteroaggregative Escherichia coli and its virulence-related genes in a case-control study among children from north-eastern Brazil. J Med Microbiol 62:683–693.
- 16.↑
Mendez-Arancibia E, Vargas M, Soto S, Ruiz J, Kahigwa E, Schellenberg D, Urassa H, Gascón J, Vila J, 2008. Prevalence of different virulence factors and biofilm production in enteroaggregative Escherichia coli isolates causing diarrhea in children in Ifakara (Tanzania). Am J Trop Med Hyg 78: 985–989.
- 17.↑
Kahali S, Sarkar B, Rajendran K, Khanam J, Yamasaki S, Nandy RK, Bhattacharya SK, Ramamurthy T, 2004. Virulence characteristics and molecular epidemiology of enteroaggregative Escherichia coli isolates from hospitalized diarrheal patients in Kolkata, India. J Clin Microbiol 42: 4111–4120.
- 18.↑
Falcao JP, Falcao DP, Gomes TA, 2004. Ice as a vehicle for diarrheagenic Escherichia coli. Int J Food Microbiol 91: 99–103.
- 19.↑
Bessong PO, Nyathi E, Mahopo TC, Netshandama V, 2014. Development of the Dzimauli community in Vhembe district, Limpopo province of South Africa, for the MAL-ED cohort study. Clin Infect Dis 59(Suppl 4): S317–S324.
- 20.↑
Queipo-Ortuño MI, De Dios Colmenero J, Macias M, Bravo MJ, Morata P, 2008. Preparation of bacterial DNA template by boiling and effect of immunoglobulin G as an inhibitor in real-time PCR for serum samples from patients with brucellosis. Clin Vaccine Immunol 15: 293–296.
- 21.↑
Nguyen TV, Le Van P, Le Huy C, Gia KN, Weintraub A, 2005. Detection and characterization of diarrheagenic E. coli from young children in Hanoi, Vietnam. J Clin Microbiol 43: 755–760.
- 22.↑
Baudry B, Savarino SJ, Vial P, Kaper JB, Levine MM, 1990. A sensitive and specific DNA probe to identify enteroaggregative Escherichia coli, a recently discovered diarrheal pathogen. J Infect Dis 161: 1249–1251.
- 23.↑
Cohen MB, Nataro JP, Bernstein DI, Hawkins J, Roberts N, Staat MA, 2005. Prevalence of diarrheagenic Escherichia coli in acute childhood enteritis: a prospective controlled study. J Pediatr 146: 54–61.
- 24.
Nataro JP, Mai V, Johnson J, Blackwelder WC, Heimer R, Tirrell S, Edberg SC, Braden CR, Glenn Morris J Jr., Hirshon JM, 2006. Diarrheagenic Escherichia coli infection in Baltimore, Maryland, and New Haven, Connecticut. Clin Infect Dis 43: 402–407.
- 25.↑
Usein CR, Tatu-Chitoiu D, Ciontea S, Condei M, Damian M, 2009. Escherichia coli pathotypes associated with diarrhea in Romanian children younger than 5 years of age. Jpn J Infect Dis 62: 289–293.
- 26.↑
Dudley EG, Thomson NR, Parkhill J, Morin NP, Nataro JP, 2006. Proteomic and microarray characterization of the AggR regulon identifies a pheU pathogenicity island in enteroaggregative Escherichia coli. Mol Microbiol 61: 1267–1282.
- 27.↑
Cerna JF, Nataro JP, Estrada-Garcia T, 2003. Multiplex PCR for detection of three plasmid-borne genes of enteroaggregative Escherichia coli strains. J Clin Microbiol 41: 2138–2140.
- 28.↑
Sarantuya J et al. 2004. Typical enteroaggregative Escherichia coli is the most prevalent pathotype among E. coli strains causing diarrhea in Mongolian children. J Clin Microbiol 42: 133–139.
- 29.↑
Ochoa TJ, Mercado EH, Durand D, Rivera FP, Mosquito S, Contreras C, Riveros M, Lluque A, Barletta F, 2011. Frequency and pathotypes of diarrheagenic Escherichia coli in Peruvian children with and without diarrhea [article in Spanish]. Rev Peru Med Exp Salud Publica 28: 13–20.
- 30.↑
Rúgeles LC1, Bai J, Martínez AJ, Vanegas MC, Gómez-Duarte OG, 2010. Molecular characterization of diarrheagenic Escherichia coli strains from stools samples and food products in Colombia. Int J Food Microbiol 15: 282.
- 31.↑
Pillay-van Wyk V, Swingler G, 2013. Enteropathogens associated with the seasonal fluctuations in plasma sodium and potassium levels in childhood diarrhoea. South Afr J Epidemiol Infect 28: 79–89.