AJTMH HINARI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 79(5), 2008, pp. 779-786
Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Srikram, A.
Right arrow Articles by Sermswan, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Srikram, A.
Right arrow Articles by Sermswan, R. W.
Related Collections
Right arrow Vaccine
Right arrow Leptospirosis

Analyses of Vaccination Protocols for Leptospira interrogans Serovar Autumnalis in Hamsters

Amporn Srikram, Surasakdi Wongratanacheewin, Anucha Puapairoj, Vanaporn Wuthiekanun, AND Rasana W. Sermswan*
Department of Biotechnology, Faculty of Technology, Khon Kaen University, Khon Kaen, Thailand; Department of Microbiology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand; Department of Pathology, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand; Mahidol-Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok, Thailand; Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand


ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leptospirosis, caused by Leptospira spp., is a zoonotic disease found worldwide. Killed whole cell leptospiral vaccines have been used as effective vaccines to elicit specific antibodies for protection. However, the involvement of cytokine responses after vaccination is not well characterized. Hamsters were immunized with killed L. interrogans serovar Autumnalis before challenge to study cytokine mRNA expression levels (interferon [IFN]-{gamma}, tumor necrosis factor [TNF]-{alpha}, interleukin [IL]-10, and IL-4). Vaccinated groups showed 92–100% survival rates, whereas control hamsters died within 6–10 days. However, live organisms were detected in vaccinated groups, and mild to moderate pathology was observed early in infection. IFN-{gamma} and TNF-{alpha} mRNA expression levels correlated with the severity of infection and lung pathology, whereas IL-4 and IL-10 expression levels were significantly higher in vaccinated groups. In summary, commonly used vaccines changed the cytokine profiles and protected hamsters from death but failed to stimulate sterile immunity and were unable to prevent the occurrence of pathology.


INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leptospirosis is a zoonotic disease of global importance. Host infection by pathogenic Leptospira produces a diverse array of clinical manifestations ranging from subclinical to undifferentiated febrile illness to jaundice, renal failure, and potentially pulmonary hemorrhage. Pathogenesis mechanisms of Leptospira and the nature of protective immunity against leptospiral infection are poorly understood. The pathogenic mechanisms may be divided into direct effects by Leptospira and the host immune response to infection. Naturally acquired immunity that protects against re-infection by Leptospira does occur and has been assumed to be humorally mediated.1 Protective immunity may be mediated by antibodies directed against serovar-specific leptospiral lipopolysaccharide, which stimulates the innate immune system through a Toll-like receptor-2–dependent mechanism, another potential mechanism of either protective immunity or immunopathology.2 Previous studies have suggested that antibodies against Leptospira membrane–associated proteins may play a role in host defense.3 Severe pulmonary hemorrhage is the most critical clinical presentation in patients infected with the organism.46 The most remarkable is profuse lung hemorrhage, which is predominantly caused by capillary involvement and thrombocytopenia.7,8 There is evidence that Leptospira may activate or damage capillary endothelial cells, leading to profuse leaking of plasma into the interstitium with consequent hypovolemia and generalized hemorrhage.8 Toxic substances produced by the pathogen, such as endotoxins,9 or by cytokine-producing activated host cells, for example, tumor necrosis factor {alpha} (TNF-{alpha}),10 seem to be important in pathogenesis. Although protective serovar-specific vaccines against leptospirosis have been developed and used, the roles of cytokine responses in protective immunity have not been thoroughly studied. Therefore, we evaluated the mRNA expression levels of the pro-inflammatory cytokines, TNF-{alpha} and interferon {gamma} (IFN-{gamma}), anti-inflammatory cytokine, interleukin 10 (IL-10), and a cytokine related to antibody production, interleukin 4 (IL-4). We also evaluated antibody responses to leptospiral infection in hamsters immunized with either heat-killed or formalin killed Leptospira, which are generally used as animal vaccines. The study also observed the presence of Leptospira in some organs and the histopathologic findings in hamsters.


MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Leptospira strain and cultivation. Pathogenic Leptospira interrogans serovar Autumnalis no. RY21 was isolated from a patient with leptospirosis in Rayong province, Thailand. The isolate was subsequently cultured in Ellinghausen–McCullough–Johnson–Harris (EMJH) medium (BD Difco; Becton, Dickinson and Co., Sparks, MD) with 0.1% agar and enriched with 3% inactivated rabbit serum at 28–30°C. The LD50 of this isolate for hamsters is 158 cells. To maintain bacterial pathogenicity, aliquots of culture in EMJH medium containing 2.5% dimethyl sulfoxide were stored in liquid nitrogen until needed.

Preparation of vaccine for immunization. The 10% formalin-killed and heat-killed Leptospira vaccines used for immunization were prepared as described.11,12 In brief, formalin-killed leptospires were prepared from 7- to 10-day-old cultures harvested by centrifugation at 12,000 x g for 10 minutes. The bacteria were washed four times in phosphate-buffered saline (PBS), pH 7.4, and resuspended in 10% neutral-buffered formalin for 60 minutes, thoroughly washed, and resuspended to a final concentration of 108 organisms/0.1 mL (vaccination dose) in PBS. The heat-killed vaccine was prepared by re-suspending the leptospires in PBS and boiling at 100°C for 10 minutes (final concentration, 108 organisms/0.1 mL). The sterility of vaccines was confirmed by absence of bacterial growth on blood agar plates and EMJH medium at 37°C and 30°C, respectively.

Experimental animals. Male 4- to 6-week-old Syrian golden hamsters (Mesocricetus auratus) were bred and housed at the Animal Laboratory Breeding Unit, Faculty of Medicine, Khon Kaen University. Hamsters were maintained and care under strictly hygienic conventional conditions under regulation of the National Laboratory Animal Center, Mahidol University, Thailand.

Immunization and challenge. Hamsters were divided into three groups (14/group). Group I was immunized with heat-killed L. interrogans (108 cells/0.1 mL/hamster), group II with formalin-killed L. interrogans (108 cells/0.1 mL/hamster), and group III with 0.1 mL PBS (control group). The immunizations were performed twice by subcutaneous injection at 45 and 30 days (D–45 and D–30) before intraperitoneal challenge (D0) with 100 µL of PBS containing 1.58 x 105 L. interrogans serovar Autumnalis (1,000 LD50). Animals were observed daily for 30 days.

Blood collection for bacterial culture, reverse transcriptase-polymerase chain reaction, and microscopic agglutination test. The immunization protocol was repeated with 12 hamsters per group. Blood, kidneys, urine, liver, and lungs were taken for bacterial culture, and all tissues collected were subjected to histopathologic examination. Blood samples were also used for detection of antibodies and cytokine mRNA expression.

Blood samples were taken through the orbital plexus (300 µL) from all hamsters of each group 1 day before first immunization (D–46) and on Days 2, 4, 7, 10, 21, and 30 after challenge using a sterile capillary tube containing 0.5 U of heparin. For the microscopic agglutination test (MAT), blood samples were taken through the orbital plexus 1 day before each immunization and challenge (D–46, D–32, and D–1) and on Days 7, 14, 21, and 30 after challenge. Heparinized blood samples on Day 2 were also used for bacterial culture (50 µL of blood was inoculated into 5 mL EMJH), and all blood samples were centrifuged to obtain plasma for MAT and the pellet was used for RNA extraction within 1 hour after collection for reverse transcriptase-polymerase chain reaction (RT-PCR). The plasma was stored at –20°C until needed.

Histopathologic examination and bacterial culture. Three animals at a time from the immunized groups (a total of 12 hamsters from each group) were killed on Days 7, 14, 21, and 30 after challenge to collect blood and kidney, lung, liver, and urine samples for further experiments. All hamsters in the control group were killed on Day 7.

For histopathologic examination, lung, kidney, and liver tissues were prepared by fixing in 10% neutral-buffered formalin for 12 hours, dehydration by immersion in increasing concentrations of ethanol (70%, 95%, and then 100%) and then xylene before embedding in paraffin wax. The paraffin sections were stained with hematoxylin and eosin (H&E) for examination.

For bacterial culture, one lobe of lung and one kidney were homogenized in 1 mL EMJH medium and briefly centrifuged, and the supernatant was harvested. Ten-fold serial dilutions (10–1, 10–2, and 10–3) of the supernatant were made in EMJH medium containing 3% rabbit serum; 100 µL of each dilution was inoculated into 5 mL of 0.1% semi-solid EMJH medium containing 200 µg/mL 5-fluorouracil. Ten-fold serial dilutions of urine from each hamster were also prepared and inoculated in the same way. The cultures were incubated at 30°C and observed weekly for 30 days.

MAT. Specific antibodies against Leptospira in serum samples from immunized hamsters were examined by MAT13 using 108 cells/mL live L. interrogans serovar Autumnalis isolate no. RY21 cultured in EMJH medium as an antigen. Twofold serial dilutions of serum samples starting from 1:50 were prepared in PBS in microtiter plates before the bacteria were added. The plate was incubated for 2 hours at room temperature in the dark and examined for agglutination by dark-field microscopy. The serum titer is the final dilution that shows 50% agglutination.

Preparation of hamster RNA from blood. Two hundred microliters of heparinized blood from each hamster was treated with ice-cold erythrocyte lysis solution (140 mmol/L NH4Cl and 17 mmol/L Tris, pH 7.2). White blood cells were collected by centrifugation at 2,000 x g for 10 minutes, washed with PBS, pH 7.2, and homogenized in 1 mL Trizol reagent (Invitrogen, Life Technologies, Carlsbad, CA). Each sample was incubated at room temperature for 5 minutes and centrifuged at 11,000 x g for 10 minutes at 4°C. The supernatant was transferred to a new tube, and RNA was extracted with an equal volume of chloroform and then with 500 µL of isopropyl alcohol. The RNA pellet was precipitated with 1 mL absolute ethanol, air-dried, and dissolved in 50 µL of RNase-free water. Contaminating DNA was digested with RNase-free DNase (Promega, Madison, WI), and the quality and quantity of RNA were studied by electrophoresis and spectrophotometry. The DNase-treated RNA was stored at –70°C until needed.

Determination of cytokine gene expression. cRNA synthesis for standard real-time PCR. Spleen cells from normal hamsters at a concentration of 1 x 106 cells/mL were stimulated with 10 µg/mL of concanavalin A (Con A; Sigma, St. Louis, MO) in Roswell Park Memorial Institute (RPMI) containing penicillin (100 U/mL) and streptomycin (100 µg/mL). After 24 hours of stimulation, the cell suspension was harvested, washed in PBS, and subjected to total RNA extraction using Trizol reagent (Invitrogen). The standard cRNA of each cytokine (TNF-{alpha}, IFN-{gamma}, IL-10, and IL-4) and a housekeeping gene, hypoxanthine phosphoribosyl transferase (HPRT), used as a control were prepared from this total RNA as described previously.14,15

The cRNA construction was carried out by converting the total RNA to single-stranded cDNA, and the T7 promoter sequence (TAATACGACTCACTATAGGGA) was added to the 5' end of the forward primers and Oligo-d (T)15 to the 5' end of the reverse primers (Table 1Go) by PCR amplification. The PCR reaction contained 50–100 ng of cDNA, 10x PCR buffer, 1 unit of Taq DNA polymerase, 0.2 mmol/L dNTP, 1.5 mmol/L MgCl2, and RNase-DNase-free water to a final volume of 25 µL. The amplification conditions included pre-amplification for one cycle at 94°C for 2 minutes and amplification for 35 cycles as listed in Table 1Go with a final extension at 72°C for 4 minutes for one cycle. To obtain cRNA, the purified PCR products containing the T7 promoter were used as templates for in vitro transcription with MEGAscript (Ambion, Austin, TX). Two microliters of reaction buffer, 2 µL of each dNTP (75 mmol/L ATP, CTP, GTP, and UTP), 2 µL enzyme, and 1 µg of PCR product in a reaction volume of 20 µL were incubated at 37°C overnight. The cDNA was removed by RNase-free DNase I (Ambion). The cRNA was precipitated by adding 30 µL nuclease-free water and 25 µL 7.5 mol/L lithium chloride and incubated at –20°C for at least 30 minutes before centrifugation at 12,000 x g for 15 minutes. The cRNA pellet was washed with 70% ethanol, resuspended in 20 µL diethyl pyrocarbonate-dH2O (DEPC-H2O), and stored at –80°C.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Sequences of the forward and reverse primers and PCR conditions used for real-time PCR or cRNA in vitro transcription
 
cDNA synthesis for real-time PCR. The standard cRNA of each cytokine was serially diluted 10-fold to obtain 101–108 copies, and cDNA from each dilution was synthesized using Moloney Murine Leukemia Virus (M-MLV) reverse transcriptase (Invitrogen) according to the manufacturer’s instructions. cDNA of each cytokine from each sample was also synthesized from total RNA in parallel with the standards. All cDNA samples were kept at –20°C until needed for real-time PCR.

Real-time PCR. Real-time PCR was performed using the LightCycler machine (Roche Applied Science, Indianapolis, IN). Primers to amplify each hamster’s cytokine and HPRT genes were designed from sequences available in GenBank (Table 1Go). Ten microliters of 2x Platinum SYBR Green qPCR superMix-UDG (Invitrogen) was mixed with 1 µL of bovine serum albumin (Sigma; 1 mg/mL), 10 µmol/L of each forward and reverse primer, 2 µL of either cDNA from the sample or cDNA generated from standard cRNA, and nuclease-free water to a final volume of 20 µL. Amplification was carried out for 45 cycles as indicated in Table 1Go. Melting curve analysis was performed for 1 cycle at 95°C/0 seconds, 55°C/15 seconds, and 95°C/0 seconds (slope = 0.1°C/second) for denaturation, annealing, and melting, respectively. The copy number of each cytokine or HPRT gene was quantified from the standard curve. The result was expressed as the ratio of copy number of the cytokine genes over the copy number of HPRT.

Statistical analysis. For the cytokine assay, changes within groups over time were analyzed with the paired t test. The differences between vaccinated and control animals were analyzed using a one-way ANOVA test. The software used for the statistical analysis was SPSS 11.0 for Windows (SPSS, Inc., Chicago, IL).


RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Survival and organ sterility. All infected control hamsters died within 6–10 days of challenge. The hamsters vaccinated with heat-killed and formalin-killed Leptospira showed 100% (14/14) and 92% (13/14) survival, respectively (Figure 1Go). When the immunization experiment was repeated with 12 hamsters per group, 2 hamsters in the control group died on Day 6, and the rest were moribund by Day 7 after challenge and therefore were killed and their organs were collected for H&E staining and bacterial culture. Urine samples were also collected for bacterial culture. The control group was positive for Leptospira in all kidney samples (100%), 7 of 10 (70%) urine samples, and 1 of 10 (10%) lung samples (Table 2Go). In contrast, leptospires were not seen by Day 21 in any of the cultures from vaccinated groups. However, one third of kidney samples from the formalin-killed vaccine group and one third of kidney and one third of urine samples of the heat-killed vaccine group were culture positive by Day 30.


Figure 1
View larger version (11K):
[in this window]
[in a new window]

 
    FIGURE 1. Survival of hamsters immunized with heat-killed ({diamondsuit}) or formalin-killed ({blacksquare}) L. interrogans serovar Autumnalis and control hamsters ({blacktriangleup}) after challenge with L. interrogans serovar Autumnalis and observed for 30 days.

 

View this table:
[in this window]
[in a new window]

 
TABLE 2
Bacterial culture results of blood, kidney, lung, and urine from vaccinated and control hamsters after challenge with L. interrogans serovar Autumnalis
 
Histologic examinations. Gross pathology of lungs in all control hamsters (non-vaccinated) at 7 days after infection showed multiple foci of hemorrhage visible on the surface (Figure 2C1Go, arrow). Lungs of vaccinated hamsters showed a few focal areas of hemorrhage on the surface on Days 7 and 14 after infection (Figure 2, A1, A3, B1, and B3Go), but all samples taken on Days 21 and 30 (Figure 2, A5, A7, B5, and B7Go) appeared normal. Livers and kidneys from either vaccinated or control groups appeared normal (data not shown).


Figure 2
View larger version (117K):
[in this window]
[in a new window]

 
    FIGURE 2. Gross pathology (H&E stain; magnification, x200) of lungs from hamsters vaccinated with heat-killed (A) or formalin-killed (B) leptospires, control hamsters (non-vaccinated) (C), and normal hamsters (D). The vaccinated hamsters were killed for blood and organ collection on Days 7, 14, 21, and 30 after challenge with live leptospires, whereas the control group was killed on Day 7. The gross pathology of lungs on Day 7 of vaccinated hamsters showed a few focal areas of hemorrhage visible on the surface (A1 and B1) compared with many foci on most of the lung surface in control hamsters (C1). The H&E staining from lungs of normal hamsters showed thin alveolar septae (D2), whereas all control hamsters showed large foci of hemorrhage (C2 and C3) and thickening of alveolar septae caused by infiltrates of mononuclear inflammatory cells (C3, top left) and foci of pulmonary edema (C4). Lung samples from one third of vaccinated hamsters on Days 7 (B2) and 14 (A4) showed small foci of hemorrhage and thickening of alveolar septae (A2, B2, and B4) caused by infiltrates of mononuclear inflammatory cells. Lung samples from one third of vaccinated hamsters on Day 21 (B6) show thickening of alveolar septae. The pulmonary hemorrhage is indicated by the arrows. This figure appears in color at www.ajtmh.org.

 
Light microscopy observations of the lungs were consistent with the gross examinations. In the control group, hemorrhage in lungs involved an estimated 30–60% of total lung parenchyma. The alveolar hemorrhages appeared as large foci with interstitial congestion (Figure 2, C2 and C3Go), and mild to moderate inflammatory infiltrates and foci of pulmonary edema (Figure 2, C4Go) were observed in all control hamsters. In lungs from hamsters vaccinated with heat-killed Leptospira, minimal pulmonary hemorrhage was found in 1–10% of total lung parenchyma (Figure 2, A4Go). Only one third of the hamsters showed interstitial congestion on Days 7 and 14 after infection (Figure 2, A2 and A4Go), but samples taken from Day 21 onward appeared normal (Figure 2, A6 and A8Go). Two of three hamsters vaccinated with formalin-killed Leptospira showed minimal pulmonary hemorrhage in an estimated 5–10% of total lung parenchyma on Day 7 (Figure 2, B2Go), and one third of the hamsters showed interstitial congestion on Days 7, 14, and 21 (Figure 2, B2, B4, and B6Go). Normal histology was seen by Day 30 (Figure 2, B8Go). The remaining hamsters showed normal histology (data not shown).

Light microscopic findings of the kidneys and livers from vaccinated and control hamsters did not show any differences. Most of the kidneys showed only mild congestion, and glomeruli and tubular interstitial areas appeared normal. No interstitial nephritis was observed (data not shown). Liver lobules showed varying pathology from normal to mild congestion and mild steatosis in both vaccinated and control groups. Portal tracts appeared normal. No abnormality of bile ducts and blood vessels was noted (data not shown).

Serologic examinations. All vaccinated hamsters developed antibodies against L. interrogans serovar Autumnalis before challenge (Table 3Go). In hamsters vaccinated with heat-killed Leptospira, detectable levels of antibodies were observed 2 weeks after the first immunization, and the MAT titers increased and remained at high levels after challenge until the end of the experiment (geometrical mean MAT titer = 459 on Day 30 after challenge). Hamsters vaccinated with formalin-killed Leptospira sero-converted later, and the highest geometrical mean MAT titer was 213 at 14 days after challenge before decreasing substantially.


View this table:
[in this window]
[in a new window]

 
TABLE 3
Geometric mean plasma MAT titers from hamsters immunized with heat-killed or formalin-killed L. interrogans serovar Autumnalis
 
TNF-{alpha}, IFN-{gamma}, IL-4, and IL-10 responses in vaccinated and control hamsters. The mRNA expression level of all cytokines in all groups, except IL-4 in the control, was significantly increased after challenge (P < 0.05; Figure 3Go). The levels of IL-4 and IL-10 expression in vaccinated hamsters were significantly higher on Days 2, 4, and 7 than the infected control group (P < 0.05) and remained constant until Day 30 after challenge.


Figure 3
View larger version (37K):
[in this window]
[in a new window]

 
    FIGURE 3. Expression levels represented as the ratio of cytokine copy number to HPRT copy number as determined by reverse transcription real-time PCR analysis of blood samples from control and vaccinated hamsters. IL-10 (A), IL-4 (B), IFN-{gamma} (C), and TNF-{alpha} (D) expression in hamsters immunized with heat-killed ({square}) or formalin-killed (Figure 3) L. interrogans serovar Autumnalis and control hamsters (Figure 3) before and after challenge with L. interrogans serovar Autumnalis. The result is expressed as cytokine/HPRT ratio. All animals were challenged on Day 0 (arrow). The asterisks (*) indicate statistical difference (P < 0.05) between control and immunized groups on the same day. Each bar represents the mean ± SD.

 
In comparison, IFN-{gamma} expression levels in vaccinated hamsters were increased but were significantly lower than the infected controls on Days 2, 4, and 7 after challenge. Moreover, IFN-{gamma} levels in vaccinated groups decreased after Day 4 and returned to almost basal levels on Day 10 after challenge, whereas the IFN-{gamma} level in infected controls remained high at Day 7. The TNF-{alpha} mRNA expression levels in all groups were not significantly different on Day 2, but vaccinated groups showed more decline in TNF-{alpha} expression by Day 7. However, only the heat-killed vaccine group differed significantly from the infected control group on Days 4 and 7. The infected control group was either dead or moribund by 7 days after challenge, whereas heat-killed or formalin-killed vaccine groups survived (100% and 92% respectively; Table 2Go).

These results indicate that expression levels of the inflammatory cytokines (TNF-{alpha} and IFN-{gamma}) in vaccinated groups were inversely correlated with survival, whereas expressions of the Th2 cytokine (IL-4) and anti-inflammatory cytokine (IL-10) were increased and positively correlated with the hamster survival after challenge (Figure 3Go; Table 2Go).


DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The pathogenic mechanisms of leptospirosis are a combination of direct effects by Leptospira and the host immune response to the infection. For example, inflammation in many organs caused by deposition of immune complexes contributes to the severity of the symptoms.16 In the last decade, it has been shown that a pivotal point in the immune response is whether a Th1-type response (intracellular microbe killing) is induced, characterized by T-cell production of IFN-{gamma} and a bias of the antibody response toward IgG2, or induction of a Th2 response (extracellular microbe killing), characterized by production of IL-4 by T cells and antibodies of the IgE, IgG1, and IgA isotypes.17 The Th1 and Th2 profile elicited by leptospires is of interest for the success of vaccine development.

It is well established that the effectiveness of the killed vaccine is serovar-specific because of antibody-mediated protection. For example, the Japanese leptospiral vaccine, which consists of formalin-killed leptospires of serovars Australis, Autumnalis, Hebdomadis, and Copenhageni, can provide 60–100% protection only for the serovars included in the vaccine.18,19 This is also seen with leptospiral vaccines used in the United States.20

In our study, hamsters immunized with heat-killed or formalin-killed Leptospira showed 100% and 92% survival rates, respectively, after challenge with the homologous serovar. However, hamsters in vaccinated groups showed sublethal but severe pathology at the early stage (7 days) and took at least 3 weeks to recover to normal. Moreover, the vaccination was shown here to be insufficient for preventing colonization of the kidney by leptospires.

Histopathologic examination of the lungs showed a good correlation with antibody titer in that mostly mild pathology was seen in immunized groups, whereas severe lung hemorrhages were observed in the control group. The role of antibody may not only clear the bacteria but also remove or neutralize components released from the organism, such as lipopolysaccharide and glycolipoprotein, which have been reported to be a cause of tissue pathology.21,22 As seen in humans, in addition to specific tissue lesions (e.g., interstitial nephritis and hepatic central-lobular necrosis), a generalized vasculitis is accompanied by hemorrhagic phenomena in all tissues.8,23 However, severe pathology was not observed in any liver and kidney samples, even from control hamsters. Their glomeruli and tubular interstitial areas appeared normal even though leptospiral cultures were positive for all kidney samples. Because only a few spirochetes were observed in the damaged tissue, some factors released from spirochetes may be responsible for the acute systemic inflammation that is clinically found in the most severe cases such as in sepsis or the systemic inflammatory response syndrome of infectious origin.9,10

The cell-mediated immune response has also been shown in vitro to play a role during leptospiral infection.24,25 Glycolipoprotein extracted from the pathogenic L. interrogans serovar Copenhageni can induce peripheral blood mononuclear cell activation as measured by the secretion of TNF-{alpha} and IL-10 and the increase in the expression of CD69 and HLA-DR, which are markers of cellular activation.26 The induction of in vitro production of Th1 cytokines by Peripheral Blood Mononuclear Cells (PBMCs) and cell proliferation in {alpha}βT cells and {gamma}{delta}T cells was also shown by Klimpel and others.27 In immunized hamsters, besides antibody formation, vaccination induced significant changes in patterns of inflammatory cytokine profiles. The expression levels of pro-inflammatory cytokines in the vaccinated hamster were correlated with pathogenesis because they were significantly lower than the control group. This corresponded with the report of Estavoyer and others28 that a significant increase of TNF-{alpha} in patients infected with leptospires is associated with severity of the disease. The level and persistence period of pro-inflammatory cytokines may also correlate with the virulence of leptospires compared with the study of Vernel-Pauillac and Merien29 that used a less virulent leptospiral isolate for infection and obtained only a transient period of cytokine response.

Taken together, our findings suggest that vaccination does change cytokine profiles. The IFN-{gamma} and TNF-{alpha} mRNA expression levels were correlated with the severity of infection and lung pathology. Moreover, this study showed that the current commercially available killed vaccines may not efficiently prevent pathology in vaccinated populations and may not completely prevent the pathogen from colonizing the kidney and subsequent shedding in urine. Therefore, the pathogen may still persist and cause re-infection from time to time even in a vaccinated herd. Ideally, future leptospiral vaccines would induce both humoral and cell-mediated responses, whereby manipulation of the cell-mediated response could foreseeable provide a broad species-wide protection.


Received May 12, 2008. Accepted for publication August 13, 2008.

Acknowledgments: The authors thank Dr. Miranda Lo, Australian Research Council Centre of Excellence in Structural and Functional Microbial Genomics, Monash University, Australia, and Emeritus Professor James A. Will, Department of Pathobiology, SVM, and Surgery, School of Medicine and Public Health, University of Wisconsin-Madison, for kind help in editing the English in this manuscript.

Financial support: This project was supported by the Thailand Research Fund through the Royal Golden Jubilee PhD Program (Grant PHD/02/2/2543) to Amporn Srikram and R. Wongratanacheewin (Sermswan) and Melioidosis Research Center, Khon Kaen University, Khon Kaen, Thailand.

* Address correspondence to Rasana W. Sermswan, Department of Biochemistry, Faculty of Medicine, Khon Kaen University, Khon Kaen, Thailand 40002. E-mail: rasana{at}kku.ac.th Back

Authors’ addresses: Amporn Srikram, Department of Biotechnology, Faculty of Technology, Khon Kaen University, 123 Mitraparb Rd., Khon Kaen 40002, Thailand, E-mail: a_srikram{at}yahoo.com. Surasakdi Wongratanacheewin, Department of Microbiology, Faculty of Medicine, Khon Kaen University, 123 Mitraparb Rd., Khon Kaen 40002, Thailand, Tel: 66-43-363188, Fax: 66-43-348385, E-mail: sura_wng{at}kku.ac.th. Anucha Puapairoj, Department of Pathology, Faculty of Medicine, Khon Kaen University, 123 Mitraparb Rd., Khon Kaen 40002, Thailand, Tel: 66-0894196077, E-mail: anupua{at}kku.ac.th. Vanaporn Wuthiekanun, Mahidol-Oxford Tropical Medicine Research Unit, Faculty of Tropical Medicine, Mahidol University, Bangkok 10400, Thailand, Tel: 662-2460832, Fax: 662-2467795, E-mail: lek{at}tropmedres.ac. Rasana W. Sermswan, Department of Biochemistry, Faculty of Medicine, Khon Kaen University, 123 Mitraparb Rd., Khon Kaen 40002, Thailand, Tel: 66-43-363265, Fax: 66-43-348386, E-mail: rasana{at}kku.ac.th.


REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Adler B, Faine S, 1977. Host immunological mechanisms in the resistance of mice to leptospiral infections. Infect Immun 17: 67–72.[Abstract/Free Full Text]
  2. Werts C, Tapping RI, Mathison JC, Chuang TH, Kravchenko V, Saint Girons I, Haake DA, Godowski PJ, Hayashi F, Ozinsky A, Underhill DM, Kirschning CJ, Wagner H, Aderem A, Tobias PS, Ulevitch RJ, 2001. Leptospiral lipopolysaccharide activates cells through a TLR2-dependent mechanism. Nat Immunol 2: 346–352.[Web of Science][Medline]
  3. Gamberini M, Gomez RM, Atzingen MV, Martins EA, Vasconcellos SA, Romero EC, Leite LC, Ho PL, Nascimento AL, 2005. Whole-genome analysis of Leptospira interrogans to identify potential vaccine candidates against leptospirosis. FEMS Microbiol Lett 244: 305–313.[Web of Science][Medline]
  4. Im JG, Yeon KM, Han MC, Kim CW, Webb WR, Lee JS, Han YC, Chang WH, Chi JG, 1989. Leptospirosis of the lung: radiographic findings in 58 patients. AJR Am J Roentgenol 152: 955–959.[Abstract/Free Full Text]
  5. Yersin C, Bovet P, Merien F, Clement J, Laille M, Van Ranst M, Perolat P, 2000. Pulmonary hemorrhage as a predominant cause of death in leptospirosis in Seychelles. Trans R Soc Trop Med Hyg 94: 71–76.[Web of Science][Medline]
  6. Zaki SR, Shieh WJ, 1996. Leptospirosis associated with outbreak of acute febrile illness and pulmonary hemorrhage, Nicaragua, 1995. The Epidemic Working Group at Ministry of Health in Nicaragua. Lancet 347: 535–536.[Web of Science][Medline]
  7. Allen P, Raftery S, Phelan D, 1989. Massive pulmonary hemorrhage due to leptospirosis. Intensive Care Med 15: 322–324.[Web of Science][Medline]
  8. da Silva JJ, Netto BA, Lilembaum W, Alvim ME, de Oliveira AV, 1995. The hemorrhagic syndrome of leptospirosis: an experimental study in guinea pigs. Rev Soc Bras Med Trop 28: 169–177.[Medline]
  9. Barnett JK, Barnett D, Bolin CA, Summers TA, Wagar EA, Cheville NF, Hartskeerl RA, Haake DA, 1999. Expression and distribution of leptospiral outer membrane components during renal infection of hamsters. Infect Immun 67: 853–861.[Abstract/Free Full Text]
  10. Yang CW, Wu MS, Pan MJ, Hong JJ, Yu CC, Vandewalle A, Huang CC, 2000. Leptospira outer membrane protein activates NF-{kappa}B and downstream genes expressed in medullary thick ascending limb cells. J Am Soc Nephrol 11: 2017–2026.[Abstract/Free Full Text]
  11. Adler B, Faine S, 1980. Immunogenicity of boiled compared with formalized leptospiral vaccines in rabbits, hamsters and humans. J Hyg (Lond) 84: 1–10.[Medline]
  12. Christopher WL, Adler B, Faine S, 1982. Immunogenicity of leptospiral vaccines grown in protein-free medium. J Med Microbiol 15: 493–501.[Abstract/Free Full Text]
  13. Faine S, 1982. Guidelines for the Control of Leptospirosis. Geneva: World Health Organization.
  14. Fronhoffs S, Totzke G, Stier S, Wernert N, Rothe M, Bruning T, Koch B, Sachinidis A, Vetter H, Ko Y, 2002. A method for the rapid construction of cRNA standard curves in quantitative real-time reverse transcription polymerase chain reaction. Mol Cell Probes 16: 99–110.[Web of Science][Medline]
  15. Jittimanee J, Sermswan RW, Puapairoj A, Maleewong W, Wongratanacheewin S, 2007. Cytokine expression in hamsters experimentally infected with Opisthorchis viverrini. Parasite Immunol 29: 159–167.[Web of Science][Medline]
  16. Galli M, Esposito R, Crocchiolo P, Chemotti M, Gasparro M, Dall’Aglio PP, 1985. Immune complexes in leptospirosis. Infection 13: 156.[Web of Science][Medline]
  17. Del Prete G, 1998. The concept of type-1 and type-2 helper T cells and their cytokines in humans. Int Rev Immunol 16: 427–455.[Medline]
  18. Chen T, 1985. Development and present status of a leptospiral vaccine and the technology of vaccine production in China. Nippon Saikingaku Zasshi 40: 755–762.[Medline]
  19. Fukumura K, 1984. Epidemiological studies on leptospirosis in Okinawa Part1. Prevalence of leptospirosis in Izena Island and the prevention by vaccination. Yamaguchi Igaku 33: 257–268.
  20. Bolin CA, Zuerner RL, Trueba G, 1989. Effect of vaccination with a pentavalent leptospiral vaccine containing Leptospira interrogans serovar Hardjo type hardjobovis on type hardjobovis infection of cattle. Am J Vet Res 50: 2004–2008.[Web of Science][Medline]
  21. Vinh T, Adler B, Faine S, 1986. Glycolipoprotein cytotoxin from Leptospira interrogans serovar Copenhageni. J Gen Microbiol 132: 111–123.[Abstract/Free Full Text]
  22. Higgins R, Cousineau G, 1977. The pathogenesis of leptospirosis I. Hemorrhages in experimental leptospirosis in guinea pigs. Can J Comp Med 41: 174–181.[Web of Science][Medline]
  23. Miller NG, Allen JE, Wilson RB, 1974. The pathogenesis of hemorrhage in the lung of the hamster during acute leptospirosis. Med Microbiol Immunol (Berl) 160: 269–278.[Medline]
  24. Naiman BM, Alt D, Bolin CA, Zuerner R, Baldwin CL, 2001. Protective killed Leptospira borgpetersenii vaccine induces potent Th1 immunity comprising responses by CD4 and {gamma}{delta} T lymphocytes. Infect Immun 69: 7550–7558.[Abstract/Free Full Text]
  25. Naiman BM, Blumerman S, Alt D, Bolin CA, Brown R, Zuerner R, Baldwin CL, 2002. Evaluation of type 1 immune response in naive and vaccinated animals following challenge with Leptospira borgpetersenii serovar Hardjo: involvement of WC1(+) {gamma}{delta} and CD4 T cells. Infect Immun 70: 6147–6157.[Abstract/Free Full Text]
  26. Diament D, Brunialti MK, Romero EC, Kallas EG, Salomao R, 2002. Peripheral blood mononuclear cell activation induced by Leptospira interrogans glycolipoprotein. Infect Immun 70: 1677–1683.[Abstract/Free Full Text]
  27. Klimpel GR, Matthias MA, Vinetz JM, 2003. Leptospira interrogans activation of human peripheral blood mononuclear cells: preferential expansion of TCR {gamma}{delta} + T cells vs TCR {alpha}β + T cells. J Immunol 171: 1447–1455.[Abstract/Free Full Text]
  28. Estavoyer JM, Racadot E, Couetdic G, Leroy J, Grosperrin L, 1991. Tumor necrosis factor in patients with leptospirosis. Rev Infect Dis 13: 1245–1246.[Web of Science][Medline]
  29. Vernel-Pauillac F, Merien F, 2006. Proinflammatory and immunomodulatory cytokine mRNA time course profiles in hamsters infected with a virulent variant of Leptospira interrogans. Infect Immun 74: 4172–4179.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Srikram, A.
Right arrow Articles by Sermswan, R. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Srikram, A.
Right arrow Articles by Sermswan, R. W.
Related Collections
Right arrow Vaccine
Right arrow Leptospirosis


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS