AJTMH Transactions of the Royal Society of Tropical Medicine and Hygiene
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 79(4), 2008, pp. 511-517
Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, J.
Right arrow Articles by Scott, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, J.
Right arrow Articles by Scott, T. W.
Related Collections
Right arrow Genetic Epidemiology
Right arrow Mosquitoes

SSCP Analysis of scnDNA for Genetic Profiling of Aedes aegypti

Jacklyn Wong, Frédéric Tripet, Jason L. Rasgon, Gregory C. Lanzaro, AND Thomas W. Scott*
Department of Entomology, University of California, Davis, California; Centre for Applied Entomology and Parasitology, Keele University, Staffordshire, United Kingdom; The W. Harry Feinstone Department of Molecular Microbiology and Immunology, and The Johns Hopkins Malaria Research Institute, Johns Hopkins University, Baltimore, Maryland; Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California, Davis, California


ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We characterized genetic profiling markers for Aedes aegypti using single-strand conformation polymorphism (SSCP) analysis of single copy nuclear genes (scnDNA). Nucleotide variations at 18 loci were evaluated in 173 wild Ae. aegypti collected from a single population in northwestern Thailand. We identified seven scnDNAs with polymorphisms sufficient to determine a unique genetic profile for each mosquito examined. Six markers were derived from previously mapped cDNA loci. One marker was developed from a non-coding region of a gene. The number of alleles at each scnDNA locus ranged from 3 to 9. The described scnDNAs can be used to quickly fingerprint large numbers of Ae. aegypti to track the behavior of individual mosquitoes in the field.


INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Dengue viruses cause more human morbidity and mortality than any other arthropod-borne virus.1 Because no vaccine or antiviral therapy is currently available, dengue prevention relies on suppression of the principal mosquito vector, Aedes aegypti.2 Despite a history of detailed studies in the laboratory, much remains unknown about the behavior and ecology of Ae. aegypti in nature. The limited efficacy of conventional vector-control methods such as source reduction, larvicide application, and adulticide spraying has led to exploration of genetic control strategies against Ae. aegypti. Successful genetic control of mosquitoes, however, will require a more complete understanding of the behavior of target populations.3

Results of previous genetic control trials have highlighted the importance of understanding the mating behavior of natural mosquito populations.4 Laboratory colonization and/or genetic modification of mosquitoes may lead to a mating disadvantage, or assortative mating, such that released individuals mate infrequently or not at all with mosquitoes in the wild population. Field release experiments involving genetically altered and/or sterilized Culex tritaeniorhynchus,5 Anopheles culicifacies,6,7 and Culex tarsalis8,9 in the 1970s and 1980s were unsuccessful in part because released males failed to mate competitively with wild females. Similarly, unpredicted polyandry in the target population can present an obstacle to genetic control programs. Introduced transgenes are expected to spread within mosquito populations according to patterns of reproduction. Deviations from monandry may prevent or slow the spread of transgenes,3 particularly if wild females mate with genetically altered males and subsequently mate again with wild males. Polyandry may pose an even greater obstacle to the success of genetic control programs based on sterile insect technique (SIT) or release of insects carrying dominant lethal genes (RIDL), because a smaller than expected proportion of offspring will not be viable.

Despite its importance to the success of genetic control strategies, relatively little research has been conducted on the mating behavior of free-ranging mosquito populations.3,10 Such studies require a set of highly polymorphic genetic markers that are single copy, heritable, and co-dominant to identify individual mosquitoes and their offspring. In past studies of Ae. aegypti behavior in the field, investigators have used randomly amplified polymorphic DNAs (RAPDs)11 and restriction fragment length polymorphisms (RFLPs).12 The use of these markers for genetic profiling is somewhat limited. RAPDs segregate as dominant alleles, such that heterozygous individuals cannot be identified.13 RFLPs require extraction of large amounts of genomic DNA, which restricts the number of loci that can be examined for a single mosquito specimen.12

Microsatellite markers have been successfully used to study the frequency of polyandry in Anopheles gambiae in Mali.14 In studies of Ae. aegypti, researchers have used microsatellites to examine population genetics in Vietnam,15 Cambodia,16 Côte d’Ivoire,17 Mexico,18 and Cameroon.19 Microsatellite markers are less abundant, however, in Ae. aegypti than other mosquito species.20,21 Because of low frequency and a tendency to be embedded in repetitive regions of the genome,2022 the number of useful Ae. aegypti microsatellites may remain limited,21 leaving room for discovery of other genetic markers for this species.

The purpose of this study was to characterize polymorphic genetic markers for Ae. aegypti using single strand conformation polymorphism (SSCP) analysis of single copy nuclear genes (scnDNAs). SSCP is a sensitive electrophoretic technique for detecting nucleotide polymorphisms.23 SSCP analysis has been used to identify numerous polymorphic loci for the construction of linkage maps of the Ae. aegypti genome24,25 and holds promise as a tool for extensive and efficient genotyping of individual mosquitoes.12 We characterized variability in scnDNAs and showed their use in fingerprinting natural field populations. Compared with RAPDs and RFLPs, markers previously used to study Ae. aegypti behavior, automated high-throughput SSCP analysis of scnDNAs is faster and less labor intensive. The scnDNA markers we characterized can be used for a variety of purposes that involve tracking or reconstructing behavior of individual mosquitoes in the field.


MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Aedes aegypti were collected during August 2002 from the villages of Pai Lom (16°45' N, 98°33' E) and Lao Bao (16°45' N, 98°34' E) in northwestern Thailand. These villages are separated by only 300 m,26 and we expect that the collected mosquitoes represent a single population. Adult Ae. aegypti were collected from 64 houses with backpack aspirators and preserved in 70% ethanol at ambient temperature until processed for genetic analysis at the University of California, Davis (Davis, CA). Total genomic DNA was purified from 173 adult mosquitoes (42 females and 131 males) by potassium acetate/ethanol precipitation.27 DNA was re-suspended in 200 µL ddH2O and stored at –80°C until used for polymerase chain reaction (PCR).

We evaluated 18 sequences published in GenBank for nucleotide polymorphisms in our study population from Thailand (Table 1Go). Fifteen loci represented cDNAs mapped in the Ae. aegypti genome by Fulton and others25 using SSCP analysis. Primer sequences and PCR fragment lengths for these cDNA loci followed Fulton and others.25 For the remaining three loci, we tried to examine non-coding sequences within the vitellogenin receptor gene (forward: AACCGCTTCTGCTGTACACA, reverse: TGGAGCAGACGGCAATCATC, 302 bp), vacuolar ATPase B subunit gene (forward: CGAATTCTACCCACGAGA, reverse: CTATCGCTTGTGATTGGTAA, 329 bp), and chitinase gene (forward: CAAGCGTCCTCATGATCAGT, reverse: GGGGTCACGTACCTCATAAT, 312 bp). Primers for these three loci were designed using OLIGO (Molecular Biology Insights, Cascade, CO).


View this table:
[in this window]
[in a new window]

 
TABLE 1
Aedes aegypti scnDNAs examined by SSCP analysis for nucleotide variation
 
We used 6-FAM–labeled forward primers and HEX-labeled reverse primers (Applied Biosystems, Foster City, CA) during PCR amplification of scnDNA fragments. PCR reactions were performed using puReTaq Ready-To-Go PCR Beads (GE Healthcare, Piscataway, NJ). Each 25-µL reaction contained 1.5 µL of genomic DNA, 0.6 µmol/L of each primer, 10 mmol/L Tris-HCl, 50 mmol/L KCl, 1.5 mmol/L MgCl, 200 µmol/L of each dNTP, and 2.5 units pureTaq DNA polymerase. PCR cycling conditions were 95°C for 5 minutes, followed by 30 or 35 cycles of 1) 95°C for 45 seconds, 2) Ta for 45 seconds, and 3) 72°C for 1 minute, followed by a final extension at 72°C for 7 minutes.

SSCP analysis of scnDNA fragments was carried out on an ABI Prism 3100 Genetic Analyzer, an automated capillary electrophoresis sequencer (Applied Biosystems). To prepare samples for analysis, 1 µL of diluted PCR product (1:20 in L HiDi formamide (Applied ddH2O) was mixed with 10.5 µ Biosystems), 0.5 µL NaOH, and 0.5 µL GeneScan ROX size standard (400 or 500 HD) (Applied Biosystems). Samples were denatured at 95°C for 5 minutes, snap-cooled on wet ice for 2–5 minutes, and subjected to capillary electrophoresis. Samples were run for 50 minutes at 25°C using 5% GeneScan polymer (Applied Biosystems) with 10% glycerol in 1x Tris/Boric Acid/EDTA (TBE). Resulting SSCP profiles were analyzed using ABI Prism GeneScan and Genotyper software (Applied Biosystems). Genotyper calculated the position of all forward (6-FAM) and reverse (HEX) peaks relative to ROX size standard peaks included with each sample.

For each locus, we selected at least one individual representative of each distinct SSCP profile for subsequent cloning and sequencing of alleles. Genomic DNA from the selected individuals was PCR amplified using unlabeled primers (Invitrogen, Carlsbad, CA) and Pfu Turbo polymerase (Stratagene, La Jolla, CA). Each 50-µL reaction contained 1.0 µL genomic DNA, 0.3 µmol/L of each primer, 20 mmol/L Tris-HCl, 10 mmol/L KCl, 10 mmol/L (NH2)SO4, 2 mmol/L Mg SO4, 0.1% Triton X-100, 0.1 mg/mL bovine serum albumin (BSA), 100 µmol/L each dNTP, and 2.5 units Pfu polymerase. PCR cycling conditions were 95°C for 2 minutes, followed by 35 cycles of 1) 95° C for 30 seconds, 2) Ta for 30 seconds, and 3) 72°C for 1 minute, followed by a final extension at 72°C for 10 minutes. Unlabeled PCR products were purified using the QIAquick PCR purification kit (Qiagen, Valencia, CA) and Taq-polished to add the 3' A overhang necessary for cloning. Each 40-µL Taq-polishing reaction contained 10 mmol/L Tris-HCl, 50 mmol/L KCl, 0.1% Triton-X, 1.5 mmol/L MgCl2, 0.5 units Taq polymerase (Promega, Madison, WI), 100 µmol/L dATP (Enzypol, London, Ontario, Canada), and 27 µL purified PCR product. Polishing was performed at 72°C for 10 minutes. Polished fragments were purified a second time using the QIAquick PCR Purification Kit (Qiagen) to eliminate excess dATPs. PCR products were ligated into vectors and transformed into TOP10 cells using the TOPO TA Cloning Kit (Invitrogen). Transformed bacteria were plated onto imMedia Amp Blue LB agar (Invitrogen) containing ampicillin, X-gal, and isopropyl-β-D-thiogalactopyranoside (IPTG), and incubated at 37°C overnight. For each individual, 16 colonies were randomly selected for a second round of PCR amplification with fluorescent-labeled primers and SSCP analysis. Distinct alleles in the population were identified, and two to four clones representative of each allele were sequenced. For each allele, the sequenced clones were isolated from at least two different individuals to ensure that identical SSCP profiles corresponded to identical nucleotide sequences. Colonies selected for sequencing were grown overnight in 3 mL LB broth with ampicillin at 37°C. Plasmid DNA was extracted using the QIAprep Spin Miniprep Kit (Qiagen) and submitted for sequencing by the Division of Biological Sciences Sequencing Facility (University of California, Davis) with M13R and M13 (–21) primers. Sequences from each clone were aligned with Sequencher (Gene Codes Corp., Ann Arbor, MI) and analyzed using ClustalX.28

Arlequin29 was used to calculate the observed and expected heterozygosity (HO and HE) for each marker locus and to test for significant deviations from Hardy-Weinberg equilibrium (100,000 Markov chains).


RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Of the18 loci evaluated, 7 exhibited polymorphisms sufficient to be useful as genetic fingerprinting markers (Table 1Go). Six markers were derived from cDNA loci mapped by Fulton and others,25 and one marker was located within a non-coding region of the vacuolar ATPase B subunit gene.

During SSCP analysis, we were able to consistently detect nucleotide sequence polymorphisms. In homozygous individuals, all clone SSCP profiles were identical to the original genomic profile. In heterozygous individuals, two distinct patterns were evenly represented in the clone SSCP profiles, each corresponding to a single allele (Figure 1Go). Sequencing of clones isolated from different individual mosquitoes confirmed that identical SSCP profiles were the result of identical nucleotide sequences.


Figure 1
View larger version (22K):
[in this window]
[in a new window]

 
    FIGURE 1. SSCP analysis of the maltase locus in homozygous (A and B) and heterozygous (C and D) Ae. aegypti collected from Thailand. In each panel, red denotes size markers, blue forward sequences, and green reverse sequences. Peaks in panels in the top row are products from individual mosquito genomic DNA. Peaks in panels in the bottom three rows represent individual alleles and are products from clones of material in their respective panel in the top row. Letters above each panel represent different mosquitoes, numbers are allele designations.

 
The degree of polymorphism varied among marker loci, with the number of alleles at each locus ranging from three to nine. Allele frequencies for our study population are presented in Figure 2Go. There were no significant differences in allele frequencies between males and females for any locus (transferrin precursor, P = 0.10; trypsin-Barillas Mury, P = 0.18; maltase, P = 0.07; carboxypeptidase A, P = 0.69; salivary vasodilatory protein-sialokinin 1, P = 0.95; vitelline membrane protein 15a, P = 0.11; vacuolar ATPase B subunit, P = 0.11; {chi}2). GenBank accession numbers for all allele sequences are listed in Table 2Go. No individuals shared the same genotype across all seven marker loci. Analysis using Gene-Pop30 showed no significant linkage disequilibrium between any loci. Based on the observed allele frequencies at each locus, we calculated the probability of any two randomly-selected individuals sharing the most common genotype to be 1.4 x 10–7.


Figure 2
View larger version (24K):
[in this window]
[in a new window]

 
    FIGURE 2. Allele frequency distributions for seven polymorphic scnDNA loci in Ae. aegypti collected from Pai Lom and Lao Bao, Thailand, during August 2002.

 

View this table:
[in this window]
[in a new window]

 
TABLE 2
Alleles identified at seven scnDNA loci in Ae. aegypti collected from Thailand
 
The observed and expected heterozygosity for each locus is shown in Table 1Go. In our study population, significant deviations from Hardy-Weinberg proportions were detected by {chi}2 test for five of seven loci, even after Bonferroni correction for multiple tests. Only transferrin precursor and carboxypeptidase A conformed to Hardy-Weinberg equilibrium. Heterozygote deficiencies were observed for vitelline membrane protein 15a, maltase, and trypsin-Barillas Mury. For vacuolar ATPase B subunit and salivary vasodilatory proteinsialokinin 1, some genotypes were over-represented, whereas others were under-represented, but there was no overall excess or deficiency of heterozygotes.

Of the 11 loci that could not be used as markers, 4 were not polymorphic in our study population, 2 exhibited skewed allele frequencies (one allele present at > 90%), 2 were not distinguishable by SSCP, 1 was not amenable to cloning, and 2 were multiple copy genes (Table 1Go).


DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Approximately one third of the loci examined met our genotyping criteria of being single copy, heritable, polymorphic, and co-dominant. With the seven scnDNA markers characterized in this study, we were able to individually distinguish 173 field-collected Ae. aegypti. Because the allele frequencies described herein are characteristic of a population at a particular time and location, the use of these scnDNA fingerprinting markers may not be universal. Before beginning any fingerprinting study, a sample of the target population should be screened for polymorphism at the selected loci. This process is relatively simple because SSCP profiles of sampled mosquitoes can be quickly compared against those of the reported alleles. If the seven reported loci are not sufficiently polymorphic, new marker loci may be identified by repeating the process we described.

In our study population, only two loci, transferrin precursor and carboxypeptidase A, conformed to Hardy-Weinberg frequencies. Vitelline membrane protein 15a, maltase, and trypsin-Barillas Mury exhibited heterozygote deficiencies, possibly because of non-amplification of alleles containing mutations in primer-binding regions. We found no mutations in the primer-binding sites of the alleles we were able to identify and sequence. To determine whether such mutations are present in the population, new primers must be designed upstream and downstream of the original forward and reverse primer-binding sites, respectively. Vacuolar ATPase B subunit and salivary vasodilatory protein-sialokinin 1 were not in Hardy-Weinberg equilibrium, but no overall excess or deficiency of heterozygotes was found. Allele frequencies for these loci have been examined in only a single population thus far. Additional populations must be sampled before the usefulness of these markers for population genetics studies of Ae. aegypti can be assessed.

The markers we characterized will be valuable for fingerprinting Ae. aegypti mosquitoes to study the biology of free-ranging individuals. We plan to use these scnDNA markers to study mating behavior, particularly to quantify the frequency of polyandry in natural populations. By dissecting out the spermatheca from wild-caught females and genotyping the contents, we can determine the rate at which female Ae. aegypti are inseminated by more than one male. We also plan to use these markers to examine Ae. aegypti oviposition patterns by tracking the progeny of released females in the field. Other potential uses for these markers include tracking released adults to study dispersal and adult survival or tracking released progeny to determine immature survival and development rates in different larval habitats.

In past studies of oviposition behavior, the number and size of Ae. aegypti sibling families in oviposition sites were estimated using RAPDs11 and RFLPs.12 These genetic markers have distinct disadvantages compared with scnDNAs. From a technical standpoint, RAPDs are difficult to standardize and reproduce. More importantly, most RAPDs segregate as dominant alleles. The result is that genotypes for heterozygous and homozygous dominant individuals cannot be discerned, and strict assumptions regarding identity in state of null alleles, Mendelian segregation, and Hardy-Weinberg equilibrium must be made.13 Although RFLPs segregate as co-dominant alleles and are comparable to scnDNAs in terms of the number of alleles found per locus, fingerprinting by RFLPs is limited by the time-consuming steps of identifying polymorphic loci and the need to extract large amounts of genomic DNA.12 scnDNAs are co-dominant, PCR-based markers that can be amplified from relatively small amounts of DNA and used to efficiently track individual behavior and genetic relationships.

Alternative PCR-based genetic markers for Ae. aegypti include microsatellites and single nucleotide polymorphisms (SNPs). Microsatellites, although considered not abundant in Ae. aegypti,20,21 have been successfully applied to study patterns of gene flow among different populations.1519 Some additional microsatellite loci have recently been discovered for Ae. aegypti21,31 and merit exploration for the type of fingerprinting studies we propose. SNPs have recently been used to study genetic relationships among Ae. aegypti populations,32 as well as to map regions of the genome associated with insecticide resistance in this species.33 We are currently comparing the utility of microsatellites and SNPs versus scnDNA markers for genetic profiling of Ae. aegypti.

In addition to serving as markers, SSCP analysis of scnDNA fragments can be used to rapidly identify SNPs in the Ae. aegypti genome.25 A previous study based on 25 nuclear genes found an average of 12 SNPs per kilobase in Ae. aegypti,34 a frequency similar to that in Drosophila35 and An. gambiae.36 In this study, sequencing of polymorphic alleles showed 111 SNPs in the seven scnDNA markers, with an average frequency of 47 SNPs per kilobase. This elevated SNP frequency is likely a consequence of targeting relatively few small and highly polymorphic gene regions. The distribution of SNPs varies substantially among genes; the highest frequencies are observed in rapidly evolving genes, such as those involved in host–parasite interactions.34 Quickly-evolving genes could become targets for automated high-throughput SSCP analysis to identify and characterize a large array of SNPs for fine-scale mapping and genotyping studies. The recent publication of the Ae. aegypti genome sequence37 will greatly facilitate the search for additional genetic markers.


Received October 18, 2007. Accepted for publication June 20, 2008.

Acknowledgments: The authors thank C. Meneses for technical guidance with SSCP analysis, Y. Lee for help with Arlequin, and K. Glunt for review of the manuscript.

Financial support: This research was supported by NIH Grants RO1 AI022119 to TWS and AI40308 to GCL.

* Address correspondence to Thomas W. Scott, Department of Entomology, University of California, Davis, 1 Shields Avenue, Davis, CA 95616. E-mail: twscott{at}ucdavis.edu Back

Authors’ addresses: Jacklyn Wong, Department of Entomology, University of California, Davis, 1 Shields Avenue, Davis, CA 95616, E-mail: jacwong{at}ucdavis.edu. Frédéric Tripet, Centre for Applied Entomology and Parasitology, Keele University, Staffordshire ST5 5BG, UK, E-mail: f.tripet{at}biol.keele.ac.uk. Jason L. Rasgon, The W. Harry Feinstone Department of Molecular Microbiology and Immunology, and The Johns Hopkins Malaria Research Institute, Johns Hopkins University, Suite E5132, North Wolfe Street, Baltimore, MD 21205, E-mail: jrasgon{at}jhsph.edu. Gregory C. Lanzaro, Department of Pathology, Microbiology, and Immunology, School of Veterinary Medicine, University of California, Davis, 1 Shields Avenue, Davis, CA 95616, E-mail: gclanzaro{at}ucdavis.edu. Thomas W. Scott, Department of Entomology, University of California, Davis, 1 Shields Avenue, Davis, CA 95616, E-mail: twscott{at}ucdavis.edu.

Reprint requests: Thomas W. Scott, Department of Entomology, University of California, Davis, 1 Shields Avenue, Davis, CA 95616, E-mail: twscott{at}ucdavis.edu.


REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Gubler DJ, 1997. Dengue and dengue hemorrhagic fever: its history and resurgence as a global public health problem. Gubler DJ, Kuno G, eds. Dengue and Dengue Hemorrhagic Fever. Wallingford: CAB International, 1–22.
  2. Gubler DJ, 2002. The global emergence/resurgence of arboviral diseases as public health problems. Arch Med Res 33: 330–342.[Web of Science][Medline]
  3. Scott TW, Takken W, Knols BGJ, Boëte C, 2002. The ecology of genetically modified mosquitoes. Science 298: 117–119.[Abstract/Free Full Text]
  4. Reisen WK, 2003. Lessons form the past: an overview of studies by the University of Maryland and the University of California, Berkeley. Takken W, Scott TW, eds. Ecological Aspects for Application of Genetically Modified Mosquitoes. Dordrecht: Kluwer Academic Publishers, 25–32.
  5. Baker RH, Reisen WK, Sakai RH, Hayes CG, Aslamkhan M, Saifuddin UT, Mahmood F, Perveen A, Javed S, 1979. Field assessment of mating competitiveness of male Culex tritaeniorhynchus carrying a complex chromosomal aberration. Ann Entomol Soc Am 72: 751–758.[Web of Science]
  6. Baker RH, Reisen WK, Sakai RH, Rathor HR, Raana K, Azra K, Niaz S, 1980. Anopheles culicifacies: mating behavior and competitiveness in nature of males carrying a complex chromosomal aberration. Ann Entomol Soc Am 73: 581–588.[Web of Science]
  7. Reisen WK, Baker RH, Sakai RH, Mahmood F, Rathor HR, Koukab R, Toqir C, 1981. Anopheles culicifacies Giles: mating behavior and competitiveness in nature of chemosterilized males carrying a genetic sexing system. Ann Entomol Soc Am 74: 395–401.[Web of Science]
  8. McDonald PT, Asman SM, Milby MM, 1978. Outdoor cage tests of genetic strains of Culex tarsalis for future field releases. Proc Calif Mosq Control Assoc 46: 105–109.
  9. Reisen WK, Asman SM, Milby MM, 1981. Attempted suppression of a semi-isolated population of Culex tarsalis by release of irradiated males. Mosq News 4: 736–744.
  10. Ferguson HM, John B, Ng’habi K, Knols BGJ, 2005. Redressing the sex imbalance in knowledge of vector biology. Trends Ecol Evol 20: 202–209.[Medline]
  11. Apostol BL, Black WC, Reiter P, Miller BR, 1994. Use of randomly amplified polymorphic DNA amplified by polymerase chain reaction markers to estimate the number of Aedes aegypti families at oviposition sites in San Juan, Puerto Rico. Am J Trop Med Hyg 51: 89–97.[Abstract/Free Full Text]
  12. Colton YM, Chadee DD, Severson DW, 2003. Natural skip oviposition of the mosquito Aedes aegypti indicated by codominant genetic markers. Med Vet Entomol 17: 195–204.[Web of Science][Medline]
  13. Black WC, 1993. PCR with arbitrary primers: approach with care. Insect Mol Biol 2: 1–6.[Medline]
  14. Tripet F, Touré YT, Dolo G, Lanzaro GC, 2003. Frequency of multiple inseminations in field-collected Anopheles gambiae females revealed by DNA analysis of transferred sperm. Am J Trop Med Hyg 68: 1–5.[Abstract/Free Full Text]
  15. Huber K, Loan LL, Hoang TH, Ravel S, Rodhain F, Failloux AB, 2002. Genetic differentialtion of the dengue vector, Aedes aegypti (Ho Chi Minh City, Vietnam) using microsatellite markers. Mol Ecol 11: 1629–1635.[Medline]
  16. Paupy C, Chantha N, Huber K, Lecoz N, Reynes JM, Rodhain F, Failloux AB, 2004. Influence of breeding site features on genetic differentiation of Aedes aegypti populations analyzed on a local scale in Phnom Penh Municipality of Cambodia. Am J Trop Med Hyg 71: 73–81.[Abstract/Free Full Text]
  17. Ravel S, Herve JP, Diarrassouba S, Kone A, Cuny G, 2002. Microsatellite markers for population genetic studies in Aedes aegypti (Diptera: Culicidae) from Cote d’Ivoire: evidence for a microgeographic genetic differentiation of mosquitoes from Bouake. Acta Trop 82: 39–49.[Web of Science][Medline]
  18. Ravel S, Monteny N, Velasco-Olmos D, Escalante-Verdugo J, Cuny G, 2001. A preliminary study of population genetics of Aedes aegypti (Diptera: Culicidae) from Mexico using micro-satellite and AFLP markers. Acta Trop 78: 241–250.[Web of Science][Medline]
  19. Paupy C, Brengues C, Kamgang B, Hervé JP, Fontenille D, Simard F, 2008. Gene flow between domestic and sylvan populations of Aedes aegypti (Diptera: Culicidae) in North Cameroon. J Med Entomol 45: 391–400.[Web of Science][Medline]
  20. Fagerberg AJ, Fulton RE, Black WC, 2001. Microsatellite loci are not abundant in all arthropod genomes: analyses in the hard tick, Ixodes scapularis and the yellow fever mosquito, Aedes aegypti. Insect Mol Biol 10: 225–236.[Web of Science][Medline]
  21. Chambers EW, Meece JK, McGowan JA, Lovin DD, Hemme RR, Chadee DD, McAbee K, Brown SE, Knudson DL, Severson DW, 2007. Microsatellite isolation and linkage group identification in the yellow fever mosquito Aedes aegypti. J Hered 98: 202–210.[Abstract/Free Full Text]
  22. Severson DW, Knudson DL, Soares MB, Loftus BJ, 2004. Aedes aegypti genomics. Insect Biochem Mol Biol 34: 715–721.[Web of Science][Medline]
  23. Orita M, Iwahana H, Kanazawa H, Hayashi K, Sekiya T, 1989. Detection of polymorphisms of human DNA by gel electrophoresis as single-strand conformation polymorphisms. Proc Natl Acad Sci USA 86: 2766–2770.[Abstract/Free Full Text]
  24. Antolin MF, Bosio CF, Cotton J, Sweeney W, Strand MR, Black WC, 1996. Intensive linkage mapping in a wasp (Bracon hebetor) and a mosquito (Aedes aegypti) with single-strand conformation polymorphism analysis of random amplified polymorphic DNA markers. Genetics 143: 1727–1738.[Abstract]
  25. Fulton RE, Salasek ML, DuTeau NM, Black WC, 2001. SSCP analysis of cDNA markers provides a dense linkage map of the Aedes aegypti genome. Genetics 158: 715–726.[Abstract/Free Full Text]
  26. Harrington LC, Scott TW, Lerdthusnee K, Coleman RC, Costero A, Clark GG, Jones JJ, Kitthawee S, Kittayapong P, Sithiprasasna R, Edman JD, 2005. Dispersal of the dengue vector Aedes aegypti within and between rural communities. Am J Trop Med Hyg 72: 209–220.[Abstract/Free Full Text]
  27. Black WC, DuTeau NM, 1997. RAPD-PCR and SSCP analysis for insect population genetic studies. Crampton J, Beard CB, Louis C, eds. The Molecular Biology of Insect Disease Vectors: A Methods Manual. New York: Chapman and Hall, 361–373.
  28. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG, 1997. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res 24: 4876–4882.
  29. Excoffier L, Laval G, Schneider S, 2005. Arlequin (version 3.0): an integrated software package for population genetics data analysis. Evolut Bioinform Online 1: 47–50.
  30. Raymond M, Rousset F, 1995. GENEPOP (version 1.2): population genetics software for exact tests and ecumenicism. J Hered 86: 248–249.[Free Full Text]
  31. Slotman MA, Kelly NB, Harrington LC, Kitthawee S, Jones JW, Scott TW, Caccone A, Powell JR, 2007. Polymorphic micro-satellite markers for studies of Aedes aegypti (Diptera: Culicidae), the vector of dengue and yellow fever. Mol Ecol Notes 7: 168–171.[Web of Science]
  32. Urdaneta-Marquez L, Bosio C, Herrera F, Rubio-Palis Y, Salasek M, Black WC, 2008. Genetic relationships among Aedes aegypti collections in Venezuela as determined by mitochondrial DNA variation and nuclear single nucleotide polymorphisms. Am J Trop Med Hyg 78: 479–491.[Abstract/Free Full Text]
  33. Saavedra-Rodriguez KL, Flores-Suarez AE, Fernandez-Salas L, Black WC, 2007. QTL mapping of genes controlling permethrin resistance in Aedes aegypti. Am J Trop Med Hyg 77 (Suppl 5): 178–179.
  34. Morlais I, Severson DW, 2003. Intraspecific DNA variation in nuclear genes of the mosquito Aedes aegypti. Insect Mol Biol 12: 631–639.[Web of Science][Medline]
  35. Moriyama EN, Powell JR, 1996. Intraspecific nuclear DNA variation in Drosophila. Mol Biol Evol 13: 261–277.[Abstract]
  36. Holt RA, Subramanian GM, Halpern A, Sutton GG, Charlab R, Nusskern DR, Wincker P, Clark AG, Ribeiro JMC, Wides R, Salzberg SL, Loftus B, Yandell M, Majoros WH, Rusch DB, Lai ZW, Kraft CL, Abril JF, Anthouard V, Arensburger P, Atkinson PW, Baden H, de Berardinis V, Baldwin D, Benes V, Biedler J, Blass C, Bolanos R, Boscus D, Barnstead M, Cai S, Center A, Chatuverdi K, Christophides GK, Chrystal MA, Clamp M, Cravchik A, Curwen V, Dana A, Delcher A, Dew I, Evans CA, Flanigan M, Grundschober-Freimoser A, Friedli L, Gu ZP, Guan P, Guigo R, Hillenmeyer ME, Hladun SL, Hogan JR, Hong YS, Hoover J, Jaillon O, Ke ZX, Kodira C, Kokoza E, Koutsos A, Letunic I, Levitsky A, Liang Y, Lin JJ, Lobo NF, Lopez JR, Malek JA, McIntosh TC, Meister S, Miller J, Mobarry C, Mongin E, Murphy SD, O’Brochta DA, Pfannkoch C, Qi R, Regier MA, Remington K, Shao HG, Sharakhova MV, Sitter CD, Shetty J, Smith TJ, Strong R, Sun JT, Thomasova D, Ton LQ, Topalis P, Tu ZJ, Unger MF, Walenz B, Wang AH, Wang J, Wang M, Wang XL, Woodford KJ, Wortman JR, Wu M, Yao A, Zdobnov EM, Zhang HY, Zhao Q, Zhao SY, Zhu SPC, Zhimulev I, Coluzzi M, della Torre A, Roth CW, Louis C, Kalush F, Mural RJ, Myers EW, Adams MD, Smith HO, Broder S, Gardner MJ, Fraser CM, Birney E, Bork P, Brey PT, Venter JC, Weissenbach J, Kafatos FC, Collins FH, Hoffman SL, 2002. The genome sequence of the malaria mosquito Anopheles gambiae. Science 298: 129–149.[Abstract/Free Full Text]
  37. Nene V, Wortman JR, Lawson D, Haas B, Kodira C, Tu Z, Loftus B, Xi Z, Megy K, Grabherr M, Ren Q, Zdobnov EM, Lobo NF, Campbell KS, Brown SE, Bonaldo MF, Zhu J, Sinkins SP, Hogenkamp DG, Amedeo P, Arensburger P, Atkinson PW, Bidwell S, Biedler J, Birney E, Bruggner RV, Costas J, Coy MR, Crabtree J, Crawford M, deBruyn B, De-Caprio D, Eiglmeier K, Eisenstadt E, El-Dorry H, Gelbart WM, Gomes SL, Hammond M, Hannick LI, Hogan JR, Holmes MH, Jaffe D, Johnston JS, Kennedy RC, Koo H, Kravitz S, Kriventseva EV, Kulp D, LaButti K, Lee E, Li S, Lovin DD, Mao C, Mauceli E, Menck CFM, Miller JR, Montgomery P, Mori A, Nascimento AL, Naveira HF, Nusbaum C, O’Leary S, Orvis J, Pertea M, Quesneville H, Reidenbach KR, Rogers YH, Roth CW, Schneider JR, Schatz M, Shumway M, Stanke M, Stinson EO, Tubio JMC, VanZee JP, Verjovski-Almeida S, Werner D, White O, Wyder S, Zeng Q, Zhao Q, Zhao Y, Hill CA, Raikhel AS, Soares MB, Knudson DL, Lee NH, Galagan J, Salzberg SL, Paulsen IT, Dimopoulos G, Collins FH, Birren B, Fraser-Liggett CM, Severson DW, 2007. Genome sequence of Aedes aegypti, a major arbovirus vector. Science 316: 1718–1723.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Wong, J.
Right arrow Articles by Scott, T. W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Wong, J.
Right arrow Articles by Scott, T. W.
Related Collections
Right arrow Genetic Epidemiology
Right arrow Mosquitoes


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS