AJTMH ASTMH Job Mart
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 78(6), 2008, pp. 946-948
Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, Y.
Right arrow Articles by Jing, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, Y.
Right arrow Articles by Jing, Z.
Related Collections
Right arrow Cysticercosis

SHORT REPORT


Genetic Variability of the 45W Gene Family between Chinese and Mexican Taenia solium

Yadong Zheng, Xuepeng Cai*, Xuenong Luo, Dongfeng Zhang, AND Zhizhong Jing
Key Laboratory of Zoonoses of CAAS, Key Laboratory of Veterinary Parasitology of Gansu Province, State Key Laboratory of Veterinary Etiological Biology, and Lanzhou Veterinary Research Institute, CAAS, Lanzhou, Gansu, China

 

ABSTRACT

Taenia solium 45W proteins are good candidates for development of anti-cysticercosis vaccines. However, the genetic characteristics of the 45 gene family are still unclear between different isolates. We investigated the polymorphism of the 45 gene family between Chinese and Mexican T. solium. Alignment showed that TSO45-4B and TSO45-1C antigens were conserved absolutely, whereas other TSO45 proteins varied between these two isolates. It is informative to guide using of recombinant 45W vaccines to control porcine cysticercosis caused by Asiatic or African/ Latin American T. solium.


Cysticercosis is an important parasitic zoonosis caused by infection of the larval-stage Taenia solium. This disease is a serious public health problem in pigs and human beings in many developing areas or countries worldwide and has recently re-emerged in some developed countries.1 The larvae in uncooked or poorly cooked meat products may encyst in the brain or other nervous tissues of humans, leading to the neurocysticercosis or even death. More importantly, recent studies have suggested that neurocysticercosis was also associated with human cancer.2 Pigs infected by metacestodes not only impede the international trades but also greatly threaten human safety. Immunization of pigs with efficient and cheap vaccines is a useful and practical approach for control of cysticercosis.3 Both recombinant oncosphere antigens TSOL18 and 45W elicit high levels of protection against challenge infection by T. solium oncospheres.4,5 The T. solium 45W gene family, specifically TSO45, has been shown to comprise at least 5 members. They can be transcribed into different types of mRNAs (A, B, and C) by means of alternative splicing, forming many protein isoforms.6 On a global scale, T. solium is divided into 2 geographical genotypes—Asian and African/ Latin American—based on mitochondrial markers.7,8 The Chinese isolate belongs to the Asiatic genotype, and the Mexican isolate is grouped into the African/Latin American genotype. The TSOL18 antigen has been shown to be completely conserved in both genotypes,9 but conservation of the 45W gene family from different locations is not yet clear. In this study, we shed light on the genetic polymorphism of the 45W gene family between two isolates from China and Mexico. This may be informative for guiding development of 45W vaccines to control this disease caused by these 2 different isolates and for assessing whether genetic diversity of T. solium affects the efficacy of 45W vaccines in field-derived infection. Moreover, studies on the 45W gene family result in profound understanding of the differences among isolates of cestodes and the biology of oncosphere during host infection.10

The adult worm from a taeniasis patient in Jilin Province, China, was completely scissored to completely release T. solium eggs. After they were washed 3 times in saline, the eggs were hatched and activated in vitro according to the method previously described by Stevenson.11 The activated oncospheres were then purified by centrifugation. Total RNA was extracted using the SV Total RNA Isolation Kit (Promega, Madison, WI) according to the manufacturer’s recommendations.

Reverse transcription was performed using the universal reverse primer (5'GGTTTGGAAATGGGCATTGACC3'). PCR was conducted using the universal reverse primer and the forward primer (5'ATGGCGTCTCAGTTCCACTTG3') or 45W-4B special forward primer (5'ATGGCGTCCCAAT TGTGCC3') in a Techgene (Irving, TX) PCR cycler with the following conditions: pre-denaturation at 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 52°C for 30 sec, and 72°C for 45 sec, with a final extension at 72°C for 10 min.

The PCR products of 45W purified with DNA purification kit (BioDev, Beijing, China) were cloned into the pGEM-T easy vector (Promega) and transformed into Escherichia coli JM109, and the recombinant colonies were identified by PCR and digestion with restriction endonuclease EcoRI. Positive clones were sequenced using ABI PRISM 377XL DNA sequencer (TaKaRa Bio, Shiga, Japan). Eight nucleotide sequences of 45W gene family from the Mexico isolate were retrieved from GenBank and were analyzed with those reported herein using the Jotun Hein method with DNAStar software (Table 1Go).


View this table:
[in this window]
[in a new window]

 
TABLE 1
List of 45W nucleotide sequences from Chinese and Mexican isolates used for alignment
 
In this study, 16 transcripts of the 45W gene family were obtained from the Chinese isolate (Table 1Go). Among them were 7 A-type, 8 B-type, and 1 C-type transcripts. Only 3 A-type transcripts from TSO45-A1 to TSO45-A3 had corresponding B-type transcripts from TSO45-B1 to TSO45-B3, respectively. Nucleotide homology of 2 transcripts TSO45-4B and TSO45-1C was 100% between Chinese and Mexican isolates, respectively, indicating that the TSO45-4B antigen is absolutely conserved. The A-type TSO45s from the Chinese isolate shared 86.6–97.2% of identity with those from the Mexican isolate at the amino acid level, and, except for TSO45-4B, another B-type TSO45s shared 86.9–96.1% with the Mexican isolate. As presumed, none of TSO45-4A mRNA was identified in our research, as previously reported by Gauci and Lightowlers.6 These results suggest that the 45W gene family of T. solium has more members than 5, as was previously reported.6

T. solium TSO45 genes consist of 4 exons—from I to IV—and 3 introns and form different type mRNAs A with all 4 exons, B with exons I, III, and IV, and C with only exons I and IV by means of exon inclusion/exon skipping. Alignment showed that variant nucleotides were mainly located in exons II and III (Table 2Go), which both contain fibronectin type III (FnIII) domain(s), previously found to be present in such proteins as To45W, TSOL16 and TSOL18, Eg95, and Em95, all of which were shown to induce high levels of protection against Taenia ovis, T. solium, Echinococcus granulosus, and Echinococcus multilocularis in animal vaccine trials, respectively.12 Moreover, most of variant nucleotides in exons II and III were distributed in the region of the first 200 bp (Table 2Go). It is notable that some variant nucleotides were detected in one TSO45 transcript from the Chinese or Mexican isolate. Two variant nucleotides were found in the exon I, but none was found in the exon IV, which is probably related to functions in signal transduction and regulation of cellular proliferation/differentiation,6 indicating that both exons I and IV are rather conserved between two T. solium isolates.


View this table:
[in this window]
[in a new window]

 
TABLE 2
Distribution of variant nucleotide in exons I–IV and its deduced amino acid among TSO45 transcripts (with exclusion of TSO45-4B) from isolates from China and Mexico*,{dagger}
 
The 45W gene was first identified from T. ovis. Immunization showed that the recombinant 45W product induced a high level of protection, up to 94%, suggesting that the protein encoded by the 45W gene was a promising candidate for vaccines against T. ovis.13 An animal vaccination experiment in Mexico showed that recombinant TSO45-1A antigen of T. solium Mexico induced 97.1% of protection in pigs against challenge infection of oncospheres.4 However, due to the diversity of A-type TSO45 proteins between the Chinese and Mexican isolates, it is doubtful that the TSO45-1A vaccine mentioned above still elicits high levels of protection to prevent pigs from infection by Asiatic T. solium. Although the TSO45-1C gene has been found completely conserved from our study, because this gene lacks FnIII domains, which exist in all protective oncosphere antigens,12 it cannot be recommended for use in developing or engineering genetic vaccines against infection of T. solium. Recently, we have demonstrated that recombinant TSO45-4B antigen has potential for development in anticysticercosis vaccines, inducing 94% and 95% protection in pigs in 2 animal vaccination trials, respectively.14,15 Because the TSO45-4B gene is rather conserved, the TSO45-4B protein is a priority for development of recombinant vaccines to control cysticercosis caused by Chinese and Mexican T. solium. To effectively use a recombinant TSO45-4B vaccine in global endemic regions, further experiments must clarify the genetic morphology of TSO45-4B in other main isolates such as those from India, Indonesia, Ecuador, and Cameroon.


Received November 27, 2007. Accepted for publication February 9, 2008.

Acknowledgments: The authors are grateful to Prof. D. H. Liu for providing the adult worm and to an anonymous reviewer for critical reading and constructive suggestions.

Financial support: This work was supported by the ‘863’ Program (2006AA10A207) and a Gansu Key Scientific and Technological Grant (2GS063-A43-013), People’s Republic of China.

* Address correspondence to Xuepeng Cai, Lanzhou Veterinary Research Institute, CAAS, Lanzhou, Gansu, 730046 China. E-mail: zhyd9{at}hotmail.com Back

Authors’ addresses: Yadong Zheng, Xuepeng Cai, Xuenong Luo, Dongfeng Zhang, and Zhizhong Jing, Key Laboratory of Zoonoses of CAAS, Key Laboratory of Veterinary Parasitology of Gansu Province, State Key Laboratory of Veterinary Etiological Biology, and Lanzhou Veterinary Research Institute, CAAS, Xujiaping 1, Yanchangbu, Lanzhou, Gansu 730046, People’s Republic of China, Tel: 86-931-8342535, Fax: 86-931-8340977, E-mails: zhyd9{at}yahoo.com.cn, caixp{at}public.lz.gs.cn, and zhyd9{at}hotmail.com.

Y. Zheng and X. Cai contributed equally to this paper.

Reprint requests: Xuepeng Cai, Xujiaping 1, Yanchangbu, Lanzhou, Gansu 730046, People’s Republic of China, Tel: 86-931-8342535, Fax: 86-931-8340977, E-mails: zhyd9{at}yahoo.com.cn and zhyd9{at}hotmail.com.

 

REFERENCES

  1. Sciutto E, Fragoso G, Fleury A, Laclette JP, Sotelo J, Aluja A, Vargas L, 2000. Taenia solium disease in humans and pigs: an ancient parasitosis disease rooted in developing countries and emerging as a major health problem of global dimensions. Microbes Infect 2: 1875–1890.[Web of Science][Medline]
  2. Del Brutto OH, Dolezal M, Castillo PR, Garcia HH, 2000. Neurocysticercosis and oncogenesis. Arch Med Res 31: 151–155.[Web of Science][Medline]
  3. Lightowlers MW, 1999. Eradication of Taenia solium cysticercosis: a role for vaccination of pigs. Int J Parasitol 29: 811–817.[Web of Science][Medline]
  4. Flisser A, Gauci CG, Zoli A, Martinez-Ocana J, Garza-Rodriguez A, Dominguez-Alpizar JL, Maravilla P, Rodriguez-Canul R, Avila G, Aguilar-Vega L, Kyngdon C, Geerts S, Lightowlers MW, 2004. Induction of protection against porcine cysticercosis by vaccination with recombinant oncosphere antigens. Infect Immun 72: 5292–5297.[Abstract/Free Full Text]
  5. Gonzalez AE, Gauci CG, Barber D, Gilman RH, Tsang VC, Garcia HH, Verastegui M, Lightowlers MW, 2005. Vaccination of pigs to control human neurocysticercosis. Am J Trop Med Hyg 72: 837–839.[Abstract/Free Full Text]
  6. Gauci CG, Lightowlers MW, 2001. Alternative splicing and sequence diversity of transcripts from the oncosphere stage of Taenia solium with homology to the 45W antigen of Taenia ovis. Mol Biochem Parasitol 112: 2173–2181.
  7. Nakao M, Okamoto M, Sako Y, Yamasaki H, Nakaya K, Ito A, 2002. A phylogenetic hypothesis for the distribution of two genotypes of the pig tapeworm Taenia solium worldwide. Parasitology 124: 657–662.[Web of Science][Medline]
  8. Ito A, Yamasaki H, Nakao M, Sako Y, Okamoto M, Sato MO, Nakaya K, Margono SS, Ikejima T, Kassuku AA, Afonso SM, Ortiz WB, Plancarte A, Zoli A, Geerts S, Craig PS, 2003. Multiple genotypes of Taenia solium—ramifications for diagnosis, treatment and control. Acta Trop 87: 95–101.[Web of Science][Medline]
  9. Gauci CG, Ito A, Lightowlers MW, 2006. Conservation of the vaccine antigen gene, TSOL18, among genetically variant isolates of Taenia solium. Mol Biochem Parasitol 146: 101–104.[Web of Science][Medline]
  10. Gauci CG, Lightowlers MW, 1995. Developmental regulation of Taenia ovis 45W gene expression. Mol Biochem Parasitol 73: 263–266.[Web of Science][Medline]
  11. Stevenson P, 1983. Observations on the hatching and activation of fresh Taenia saginata eggs. Ann Trop Med Parasitol 77: 399–404.[Web of Science][Medline]
  12. Lightowlers MW, Gauci CG, Chow C, Drew DR, Gauci SM, Heath DD, Jackson DC, Dadley-Moore DL, Read AJ, 2003. Molecular and genetic characterisation of the host-protective oncosphere antigens of taeniid cestode parasites. Int J Parasitol 33: 1207–1217.[Web of Science][Medline]
  13. Johnson KS, Harrison GBL, Lightowlers MW, O’Hoy KL, Dempster RP, Lawrence SB, Vinton JG, Heath DD, Rickard MD, 1989. Vaccination against ovine cysticercosis using a defined recombinant antigen. Nature 338: 585–587.[Medline]
  14. Luo X, Zheng Y, Dou Y, Guo A, Hou J, Jing Z, Cai X, 2007. Combining expression and protective efficacy of 45W-4BX and 18kD from different stages of Taenia solium. Sci Agr Sin 40: 385–390.
  15. Luo X, Zheng Y, Hu Z, Ding J, Dou Y, Guo A, Jing Z, Cai X, 2008. High efficacious expression and immune efficacy of 45W-4BX and TSOL18 from Taenia solium oncosphere. Acta Vet Zootech Sin 39: 212–217.



This article has been cited by other articles:


Home page
CVIHome page
X. Luo, Y. Zheng, J. Hou, S. Zhang, and X. Cai
Protection against Asiatic Taenia solium Induced by a Recombinant 45W-4B Protein
Clin. Vaccine Immunol., February 1, 2009; 16(2): 230 - 232.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zheng, Y.
Right arrow Articles by Jing, Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zheng, Y.
Right arrow Articles by Jing, Z.
Related Collections
Right arrow Cysticercosis


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS