| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
Cysticercosis is an important parasitic zoonosis caused by infection of the larval-stage Taenia solium. This disease is a serious public health problem in pigs and human beings in many developing areas or countries worldwide and has recently re-emerged in some developed countries.1 The larvae in uncooked or poorly cooked meat products may encyst in the brain or other nervous tissues of humans, leading to the neurocysticercosis or even death. More importantly, recent studies have suggested that neurocysticercosis was also associated with human cancer.2 Pigs infected by metacestodes not only impede the international trades but also greatly threaten human safety. Immunization of pigs with efficient and cheap vaccines is a useful and practical approach for control of cysticercosis.3 Both recombinant oncosphere antigens TSOL18 and 45W elicit high levels of protection against challenge infection by T. solium oncospheres.4,5 The T. solium 45W gene family, specifically TSO45, has been shown to comprise at least 5 members. They can be transcribed into different types of mRNAs (A, B, and C) by means of alternative splicing, forming many protein isoforms.6 On a global scale, T. solium is divided into 2 geographical genotypes—Asian and African/ Latin American—based on mitochondrial markers.7,8 The Chinese isolate belongs to the Asiatic genotype, and the Mexican isolate is grouped into the African/Latin American genotype. The TSOL18 antigen has been shown to be completely conserved in both genotypes,9 but conservation of the 45W gene family from different locations is not yet clear. In this study, we shed light on the genetic polymorphism of the 45W gene family between two isolates from China and Mexico. This may be informative for guiding development of 45W vaccines to control this disease caused by these 2 different isolates and for assessing whether genetic diversity of T. solium affects the efficacy of 45W vaccines in field-derived infection. Moreover, studies on the 45W gene family result in profound understanding of the differences among isolates of cestodes and the biology of oncosphere during host infection.10
The adult worm from a taeniasis patient in Jilin Province, China, was completely scissored to completely release T. solium eggs. After they were washed 3 times in saline, the eggs were hatched and activated in vitro according to the method previously described by Stevenson.11 The activated oncospheres were then purified by centrifugation. Total RNA was extracted using the SV Total RNA Isolation Kit (Promega, Madison, WI) according to the manufacturer’s recommendations.
Reverse transcription was performed using the universal reverse primer (5'GGTTTGGAAATGGGCATTGACC3'). PCR was conducted using the universal reverse primer and the forward primer (5'ATGGCGTCTCAGTTCCACTTG3') or 45W-4B special forward primer (5'ATGGCGTCCCAAT TGTGCC3') in a Techgene (Irving, TX) PCR cycler with the following conditions: pre-denaturation at 95°C for 5 min followed by 35 cycles of 94°C for 30 sec, 52°C for 30 sec, and 72°C for 45 sec, with a final extension at 72°C for 10 min.
The PCR products of 45W purified with DNA purification kit (BioDev, Beijing, China) were cloned into the pGEM-T easy vector (Promega) and transformed into Escherichia coli JM109, and the recombinant colonies were identified by PCR and digestion with restriction endonuclease EcoRI. Positive clones were sequenced using ABI PRISM 377XL DNA sequencer (TaKaRa Bio, Shiga, Japan). Eight nucleotide sequences of 45W gene family from the Mexico isolate were retrieved from GenBank and were analyzed with those reported herein using the Jotun Hein method with DNAStar software (Table 1
).
|
). Among them were 7 A-type, 8 B-type, and 1 C-type transcripts. Only 3 A-type transcripts from TSO45-A1 to TSO45-A3 had corresponding B-type transcripts from TSO45-B1 to TSO45-B3, respectively. Nucleotide homology of 2 transcripts TSO45-4B and TSO45-1C was 100% between Chinese and Mexican isolates, respectively, indicating that the TSO45-4B antigen is absolutely conserved. The A-type TSO45s from the Chinese isolate shared 86.6–97.2% of identity with those from the Mexican isolate at the amino acid level, and, except for TSO45-4B, another B-type TSO45s shared 86.9–96.1% with the Mexican isolate. As presumed, none of TSO45-4A mRNA was identified in our research, as previously reported by Gauci and Lightowlers.6 These results suggest that the 45W gene family of T. solium has more members than 5, as was previously reported.6
T. solium TSO45 genes consist of 4 exons—from I to IV—and 3 introns and form different type mRNAs A with all 4 exons, B with exons I, III, and IV, and C with only exons I and IV by means of exon inclusion/exon skipping. Alignment showed that variant nucleotides were mainly located in exons II and III (Table 2), which both contain fibronectin type III (FnIII) domain(s), previously found to be present in such proteins as To45W, TSOL16 and TSOL18, Eg95, and Em95, all of which were shown to induce high levels of protection against Taenia ovis, T. solium, Echinococcus granulosus, and Echinococcus multilocularis in animal vaccine trials, respectively.12 Moreover, most of variant nucleotides in exons II and III were distributed in the region of the first 200 bp (Table 2). It is notable that some variant nucleotides were detected in one TSO45 transcript from the Chinese or Mexican isolate. Two variant nucleotides were found in the exon I, but none was found in the exon IV, which is probably related to functions in signal transduction and regulation of cellular proliferation/differentiation,6 indicating that both exons I and IV are rather conserved between two T. solium isolates.
|
Received November 27, 2007. Accepted for publication February 9, 2008.
Acknowledgments: The authors are grateful to Prof. D. H. Liu for providing the adult worm and to an anonymous reviewer for critical reading and constructive suggestions.
Financial support: This work was supported by the ‘863’ Program (2006AA10A207) and a Gansu Key Scientific and Technological Grant (2GS063-A43-013), People’s Republic of China.
* Address correspondence to Xuepeng Cai, Lanzhou Veterinary Research Institute, CAAS, Lanzhou, Gansu, 730046 China. E-mail: zhyd9{at}hotmail.com 
Authors’ addresses: Yadong Zheng, Xuepeng Cai, Xuenong Luo, Dongfeng Zhang, and Zhizhong Jing, Key Laboratory of Zoonoses of CAAS, Key Laboratory of Veterinary Parasitology of Gansu Province, State Key Laboratory of Veterinary Etiological Biology, and Lanzhou Veterinary Research Institute, CAAS, Xujiaping 1, Yanchangbu, Lanzhou, Gansu 730046, People’s Republic of China, Tel: 86-931-8342535, Fax: 86-931-8340977, E-mails: zhyd9{at}yahoo.com.cn, caixp{at}public.lz.gs.cn, and zhyd9{at}hotmail.com.
Y. Zheng and X. Cai contributed equally to this paper.
Reprint requests: Xuepeng Cai, Xujiaping 1, Yanchangbu, Lanzhou, Gansu 730046, People’s Republic of China, Tel: 86-931-8342535, Fax: 86-931-8340977, E-mails: zhyd9{at}yahoo.com.cn and zhyd9{at}hotmail.com.
This article has been cited by other articles:
|
|
 |
|
  X. Luo, Y. Zheng, J. Hou, S. Zhang, and X. Cai Protection against Asiatic Taenia solium Induced by a Recombinant 45W-4B Protein Clin. Vaccine Immunol., February 1, 2009; 16(2): 230 - 232. [Abstract] [Full Text] [PDF]
|
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
