AJTMH ASTMH MEMBERSHIP INFORMATION: astmh@astmh.org
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 78(4), 2008, pp. 633-640
Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zakeri, S.
Right arrow Articles by Djadid, N. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zakeri, S.
Right arrow Articles by Djadid, N. D.
Related Collections
Right arrow Drug-Resistance
Right arrow Malaria

Association of pfcrt But Not pfmdr1 Alleles with Chloroquine Resistance in Iranian Isolates of Plasmodium falciparum

Sedigheh Zakeri*, Mandana Afsharpad, Tahmineh Kazemzadeh, Kambiz Mehdizadeh, Ashraf Shabani, AND Navid Dinparast Djadid
Malaria and Vector Research Group (MVRG), Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran; Biochemistry Department, Al-Zahra University, Tehran, Iran; Chabahar Public Health Department, Zahedan University of Medical Sciences, Chabahar, Iran


ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
This study was designed to analyze the Plasmodium falciparum chloroquine resistance transporter (pfcrt) and P. falciparum multidrug resistance 1 (pfmdr1) mutations as markers of chloroquine (CQ) resistance in 200 blood samples collected from malaria patients in south-eastern Iran during 2002–2005. Among these, 25 (post-treatment) fulfilled the 28-day follow-up study. A high number of Iranian P. falciparum (97%) strains harbored quadruple mutations at codons 76T, 220S, 326D, and 356L. All post-treatment isolates harbored the mutant allele 76T, but low rates of the mutant allele 86Y (44%) of the pfmdr1 gene were detected. No wild haplotype of pfcrt (72-CVMNKAQNIR-371) was found in post-treatment samples; however, 56% of clinical "failure" samples carried the wild type of pfmdr1 (NYSND). The present results suggest a strong association between pfcrt 76T, but not pfmdr1 86Y mutation and in vivo CQ resistance. Furthermore, we found the CQ resistance-associated SVMNT haplotype, which previously had been seen in South American isolates. Although Iran is located more proximally to Southeast Asia than to South America, no CQ resistance-associated CVIET haplotye has been observed in this region. Therefore, these results were not consistent with the earlier presumed spread of CQR parasites from Southeast Asia to Africa via the Indian subcontinent. In conclusion, P. falciparum mutations associated with resistance to CQ are abundant in south-eastern Iran and this finding strongly supports that CQ as the first line drug is inadequate for treatment of uncomplicated falciparum malaria in Iran.


INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Malaria is an infectious disease that continues to be associated with considerable morbidity and mortality and has significant social and economic impact on developing societies. Today, shortages of resources and drug resistance have been significant obstacles to malaria control in many developing countries. For the past 60 years, chloroquine (CQ) has been the gold standard in prevention and treatment of uncomplicated malaria. Since the early 1960s, sensitivity of the parasites to CQ, the best, cheapest, and most widely used drug for treating malaria, has been on the decline.1 Newer antimalarials have been discovered to overcome this problem, but all of these drugs are either expensive or have undesirable side effects. In addition, the parasites, especially the falciparum species, have started showing resistance to these drugs. The first report of CQ resistance (CQR) was documented from Thailand (Southeast Asia) and Columbia (South America) in early 1960s. Since then, resistance has been spreading worldwide and reached the Indian state of Assam in 1973.2,3 In Iran, the first cases of resistance were reported from Sistan and Baluchistan province in 1983 and later in Hormozgan province in 1986.4 Further, in vivo and in vitro studies on response of P. falciparum to CQ during 1990–1996 showed rather high resistance of P. falciparum at RI and RII and lower numbers of RIII levels.5 Although resistance has been reported since 1983, CQ is still used as antimalaria treatment in Iran. An in vivo study carried out by Raeisi and co-workers during 2002–2004 also showed that the frequency of treatment failure by day 28 was 78.5% in south-eastern provinces of Iran.6

Although resistance to CQ has been well documented, this anti-malarial drug is still used as the standard treatment of uncomplicated malaria in many geographic regions. Some progress has been made in understanding the mechanism of action of CQ, but it has not yet been fully understood. Although the molecular basis of CQ resistance is not fully elucidated, several genes encoding a candidate protein involved in the transport of CQ into or out of the digestive vacuole have been proposed. The genes considered for CQ resistance are pfcrt (P. falciparum chloroquine resistance transporter), cg2 (encoding a ~330-kDa protein), and pfmdr1 (P. falciparum multidrug resistance).711 Based on transfection studies, cg2 was not the CQ resistance determinant.12 Also, association of pfmdr1 gene with CQ resistance remains unclear,13 and genetic crosses showed no linkage to CQ resistance.14 In several studies, the pfmdr1 gene was known to undergo mutations leading to the substitution of amino acids at codons 86, 184, 1034, 1042, and 1246.7,11,1416 In other studies, no association of these mutations with CQR was found,1720 but most recent investigations showed that polymorphisms in pfmdr1 in some geographical areas were associated with increased in vitro mefloquine sensitivity.21,22 In contrast, the crt gene showed absolute association with CQ resistance in parasite lines23 and clinical isolates.24,25 In addition, CQ resistance is associated with a K76T mutation of the pfcrt gene,7 while a multidrug resistance analogue (pfmdr1) N86Y variation may modulate its degree.26 In eastern Sudan, Babiker and coworkers27 demonstrated a significant association between high levels of CQR and pfcrt 76T and pfmdr1 86Y alleles. Moreover, a commonly strong association between pfcrt 76T and pfmdr1 86Y alleles, especially in CQR parasites, suggests a joint role in development of resistance.28 However, the implication of pfmdr1 86Y in CQR was challenged in other studies.29

In several studies, point mutations were observed in more than 20 codons in the pfcrt gene from various regions, which were found to be associated with the CQR phenotype.3032 These include mutations at amino acid positions 72, 74, 75, 76, 97, 144, 148, 160, 194, 220, 271, 326, 356, and 371.7,30,3335 In particular, the CQR parasite isolates from Southeast Asia and Africa have pfcrt genes with 7–9 mutated codons, 72-CIETH(L)SEST(I)I-371.7,30 The CQR parasites from South America and Papua New Guinea also possess 4–5 mutated codons, 72-S(C)MNTHSQDLR-371, in pfcrt genes.7,30,36 The mutation K76T was found in all CQR parasites and A220S was found in all but 2 CQR isolates sequenced thus far,7,30,31 indicating their essential role in CQR. In another study, Chen and co-workers33 reported that mutation in codon A220S in pfcrt is associated with CQR in African countries but not in the Philippines.

There is little published molecular data available on characterization of resistant P. falciparum in Iran,3741 and to our knowledge, no such study on large samples examining the pfcrt and pfmdr1 haplotypes in parasites has been conducted in this region before. Thus the current study has been designed to investigate the prevalence of CQR-associated markers in Iran. This aim was achieved by genetic analysis of pfcrt and pfmdr1 genes, and detection of their haplotypes in 200 Iranian P. falciparum strains collected during 2002–2005. In addition, the association between in vivo CQR and pfcrt polymorphisms in clinical P. falciparum isolates from malaria hypoendemic regions of Iran was evaluated in where CQ has been used as the first-line treatment and CQR was first reported in 1983. In addition, to compare and determine the association of pfmdr1 alleles with CQR, this gene was also characterized on the same isolates.


MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study site and patients. P. falciparum field isolates (N = 175) were obtained from patients (ages 1–70 years old) with uncomplicated malaria before treatment during the years 2002–2005. All patients with the average age of 27 years attended malaria clinics at primary health care centers in Chabahar district in Sistan and Baluchistan, Iran (Figure 1Go). The majorities were male (80%) and were nationals of three countries: Iran (60%), Afghanistan (5%), and Pakistan (22%); those of the remainder were not recorded. In addition, a large fraction of the patients had traveled to Pakistan (36%) 2–3 weeks prior to blood sampling. Details of study areas in Chabahar district are described elsewhere.39


Figure 1
View larger version (23K):
[in this window]
[in a new window]

 
    FIGURE 1. Map of Iran indicating the location of the study area in Chabahar district situated in the south-eastern corner of Sistan and Baluchistan province where the P. falciparum isolates were collected (Ch, Chabahar).

 
In vivo assay. In this study, patients were selected according to inclusion criteria suggested by the standard WHO 28-day in vivo test.42 Thin and thick blood films were stained with Giemsa and examined microscopically for detection of P. falciparum asexual stages. Approximately 1 mL of venous blood was obtained pre-treatment in a tube containing EDTA from 175 patients who were confirmed to be positive for the presence of P. falciparum parasites. CQ (25 mg/kg body weight over 3 days) was then administrated orally under supervision, and patients were observed for eventual vomiting for at least 30 minutes. The 25/175 consenting patients fulfilled a 28-day follow-up. Therefore, in total, 200 P. falciparum clinical isolates were obtained from malaria patients pre- (175) and post-treatment (25) in this study. The clinical condition, body temperature, and parasite density were assessed at each visit. Parasite clearance was monitored by thick-film microscopy each day after treatment, and follow-up blood samples were collected not only before treatment (D0) but also at D1, D2, D3, D7, D14, D21, and D28 following treatment (post-treatment). The clinical response to treatment was classified as sensitive (S) or resistant (R) based on the asexual stage parasite clearance time and recurrence of blood-stage parasites as follows: parasite clearance within 7 days of treatment which was sustained for 28 days (S); parasite clearance by D7 but reappearance before D28 (RI); parasitemia was markedly reduced (> 75%) by D2 of treatment but not cleared by D7 (RII); and parasitemia not reduced by D2 (RIII). Patients’ or parents’ informed consent was obtained before inclusion in the study. The study was reviewed by, and received Ethical Clearance from, Pasteur Institute of Iran. All pre- and post-treatment blood samples were collected in tubes containing EDTA, stored at 4°C, and then transported to the main laboratory in Tehran.

Genotyping of P. falciparum parasites. To determine whether the patients had recrudescent parasites or new infections, P. falciparum genetic diversity was compared between the pre- and post-treatment samples by using msp-1 and msp-2 encoding highly polymorphic loci from merozoite surface protein genes.43 These genes were genotyped by using allelic type-specific primers in nested PCR for msp-1 (with K1, MAD20, and RO33 allelic families) and msp-2 genes (for 3D7 or FC27 allelic family).

Nested PCR and mutation-specific amplifications of pfcrt and pfmdr1 genes. The parasite genomic DNA was extracted from infected red blood cells using phenol/phenol–chloroform followed by ethanol precipitation as described previously.44 Nested PCR was performed for crt and mdr1 genes on pre- and post-treatment samples. All reactions were carried out in 25-µL reaction mixtures containing 1.5–3 mM MgCl2, 200 µM dNTP mixture (Invitrogen, Carlsbad, CA), 1 unit of Taq polymerase (Invitrogen), and a pair of primers (10 pM each). For both crt and mdr1, 1–2 µL of DNA was used as template in the first reaction and 1 µL of samples (if no band was seen) was used, whereas 1 µL of a 1/100 to 1/500 dilution of the samples with an intense band from the first-round PCR product was used as template for the secondary PCR. The PCR primers and conditions for both genes were those published previously45,46 with modification. PCR products were resolved by electrophoresis on 1–2% agarose gels and visualized by staining with ethidium bromide.

Detection of pfcrt and pfmdr1 mutations by restriction digestion of PCR products (PCR/RFLP). Following amplification of the fragments concerned, polymorphisms in the pfcrt and pfmdr1 genes were assessed by the mutation-specific restriction endonuclease digestion to detect single nucleotide polymorphisms (SNPs) in pfcrt at positions K76T, A220S, Q271E, N326S/D, I356T/L, and R371I/T and in pfmdr1 at positions N86Y/H, Y184F, S1034C, N1042D, and D1246Y.45,46 A number of restriction enzymes were used for RFLP of PCR products.45,46 For pfcrt, the PCR products were digested with ApoI, BglI, XmnI, MseI, CaiI, and AFlII to determine the polymorphisms at codons 76, 220, 271, 326, 356, and 371, respectively (detailed information is available on the internet at http://medschool.umaryland.edu/cvd/nejm2001djimde.asp). For pfmdr1, 3 enzymes, ApoI, NsiI, and AFlIII were used to identify codon 86, while TasI, DdeI, AseI, and EcoRV were used to determine the polymorphisms at codons 184, 1034, 1042, and 1246, respectively. Digestions were done in 20-µL reactions containing 10 µL of PCR products according to the manufacturer’s instructions (New England Biolabs, Beverly, MA, Fermentase, Vilnius, Lithuania, and/or Invitrogen). If there was doubt about a complete digestion, reactions were repeated overnight. Digested products were subjected to electrophoresis on 1.5–2% agarose or 2–3% Metaphor agarose gels and visualized by ultraviolet (UV) transillumination.

DNA sequence analysis of pfcrt gene. In the present study, the pfcrt haplotypes (amino acids at codons 72–76, 326, and 356) were preformed by PCR amplification, followed by both restriction enzyme digestion and DNA sequencing in 175 (pre-) and 25 post-treatment field samples whose in vivo patterns of CQ response were unknown and known, respectively. The following forward and reverse primers (7G8 type: AF233067) were designed and used for amplification:

crt1F: 5' TATTTTCATTGTCTTCCAC 3' (codons 72–76)

crt1R: 5' AGGAATAAACAATAAAGAAC 3'

crt4F: 5' CCTTTTTAGTTCATTTACC 3' (codon 326)

crt4R: 5' AGTAATAAGCAATTGCTA 3'

crt5F: 5' TATCGACAAATTTTCTACCATG 3' (codon 356)

crt5R: 5' TAATTGAATCGACGTTGG 3'

Amplified fragments were gel-purified using the Qiagen DNA purification kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using an ABI-3100 sequencer (Primm Company, Milan, Italy). Nucleotide and amino acid sequences were aligned and compared with the 7G8 sequence (accession no. AF233067) using CLUSTALX.


RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
In vivo CQ response study. In this study, a total of 200 P. falciparum-positive blood samples were collected; and among these, 25 were recruited for in vivo study and had a complete 28-day follow-up. Based on WHO standard protocols, the parasitological responses were classified as 2 (8%), 16 (64%), 4 (16%), and 3 (12%) that were sensitive (S), RI, RII, and RIII, respectively. The 2 sensitive parasites were isolated from patients who showed recurrent infection at D30 and D58 of treatment with CQ. The important issue to consider is that genotyping of all 25 P. falciparum isolates with both msp-1 and msp-2 markers showed the same allelic families and lengths of the PCR products (data not shown).

Analysis of pfcrt mutations by the PCR/RFLP method. In this study, 6 loci of pfcrt, the gene involved in CQ resistance were analyzed in 200 P. falciparum clinical samples, including 175 pre- and 25 post-treatment samples. No mutations were detected at codons 271 and 371 among all samples examined. However, analysis of pre- and post-treatment samples showed that 97.7% and 100% of the samples harbored the pure mutant allele of pfcrt 76T, respectively. For the other codons—220S, 326S/D, and I356L—the prevalence of the mutations was 97%, 97.7%, and 100% among pre-treatment and 96%, 100%, and 100% among post- treatment samples. Regarding these 6 SNPs in the pfcrt gene, no significant difference in prevalence was observed in the pre- and post-treatment samples after treatment with CQ, although the number of post-treatment samples was small. A high number of examined Iranian P. falciparum (97% of all 200) isolates harbored quadruple mutations at codons 76T, 220S, 326S/D, and I356L. The SNPs results of the pfcrt in pre- and post-treatment P. falciparum isolates are shown in Table 1Go.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Distribution of pfcrt polymorphisms in pre- and post-treatment samples from Iran based on PCR/RFLP*
 
Sequence analysis of pfcrt gene. Sequence analysis of DNA from 200 P. falciparum isolates showed that the codon 72-SVMNT-76 haplotype associated with CQR isolate was found in 98% of sequenced isolates and accounted for the vast majority of P. falciparum infections. However, the remaining 4 (2%) pre-treatment isolates carrying the K76 allele had CVMNK wild haplotype. No CVIET sequence was found in any of these samples. Sequence analyses of codons N326S/D and I356T/L in pfcrt gene showed that 98% of sequence samples harbored aspartic acid (D) at codon 326 and leucine (L) at codon 356.

Analysis of pfmdr1 mutations. Similarly, we investigated 5 loci of pfmdr1, the gene that might be involved in CQR. The frequency of the mutant pfmdr1 86Y allele was 36.6% and 44% among pre- and post-treatment isolates, respectively. No 86H mutation was detected in all Iranian P. falciparum isolates examined.47 All pre- and post-treatment isolates with 86Y mutation also carried the mutant pfcrt 76T allele. Only 3 samples harbored mixed pfmdr1 N86Y alleles. Furthermore, for other 2 codons, 184F and 1042D, the prevalence of the mutations was 6.3%, and 0.6%, respectively in pre-treatment samples; however, for post-treatment, this prevalence was 0% and 12%, respectively. In addition, no mutation has been detected at codon S1034C in pre-treatment but one (4%) in post-treatment samples; and also D1246Y in any of the isolates examined. The SNPs results of the pfmdr1 in pre-treatment and post-treatment P. falciparum isolates are shown in Table 2Go.


View this table:
[in this window]
[in a new window]

 
TABLE 2
Distribution of pfmdr1 polymorphisms of P. falciparum in pre- and post-treatment samples from Iran based on PCR/RFLP analysis
 
Distribution of pfcrt and pfmdr1 haplotypes from Iran. Three different profiles of the pfcrt 72-371 codons were identified by analysis of nucleotide sequences obtained from both pre- and post-treatment samples. The 72-SVMNTSQDLR-371 (97%) was the highest prevalent haplotype among both samples. The distribution of the pfcrt haplotypes is shown in Table 1Go and Figure 2Go.


Figure 2
View larger version (18K):
[in this window]
[in a new window]

 
    FIGURE 2. Frequency distribution of the different pfcrt haplotypes was obtained from 175 pre-treatment and 25 post-treatment samples collected from Iran. Based on sequencing analysis, a high prevalence of quadruple mutations at codons 76T, 220S, 326D, and 356L has been found among both samples. Complete absence of parasites with wild mutation K76 in post-treatment samples indicates in vivo selection for the mutant allele 76T.

 
The pfmdr1 haplotype with amino acid NYSND at positions 86, 1034, 1042, and 1246 in the 3D7 laboratory clone was also defined wild type. A total of six distinct haplotypes were identified in all examined isolates in this study (Figure 3Go). Haplotypes NYSND (58.8% to 56%) with no mutation and YYSND (34.3% to 32%) with a single mutation were the most common among both pre- and post-treatment samples, respectively (Figure 3Go). Haplotype YYCDD with mutations at 3 positions was detected in 1 (4%), but YYSDD with double mutations was identified in 2 (8%) of the post-treatment samples with RI parasitological response. Two haplotypes, NFSND (4.6%) and YFSND (1.7%), were identified only in pre-treatment samples (Figure 3Go).


Figure 3
View larger version (14K):
[in this window]
[in a new window]

 
    FIGURE 3. Frequency distribution of the different pfmdr1 haplotypes was obtained from 175 pre-treatment and 25 post-treatment samples collected from Iran. Wild haplotype NYSND was the most prevalent haplotype among both pre- and post-treatment samples.

 
Combination of pfcrt and pfmdr1 haplotypes among all 200 samples in this study demonstrated 9 distinct haplotypes (Figure 4Go). The 2 most prevalent haplotypes among both pre- and post-treatment samples were SVMNTSQDLR/NYSND (55% to 52%) and SVMNTSQDLR/YYSND (33% to 28%). Haplotype SVMNTSQDLR/YYCDD with 6 mutations at different positions on both pfcrt and pfmdr1 was isolated from a Pakistani patient (post-treatment) who came to Iran to seek treatment at a Chabahar clinic.


Figure 4
View larger version (20K):
[in this window]
[in a new window]

 
    FIGURE 4. Frequency distribution of the combination pfcrt/pfmdr1 haplotypes was obtained from 200 isolates collected from Iran. The haplotype SVMNTSQDLR/NYSND was the most prevalent among both pre- (N = 175) and post- (N = 25) treatment samples. There was no association between the pfmdr1 86Y mutation and in vivo CQ resistance observed in this study.

 

DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Identification of pfcrt as the central determinant of chloroquine-resistant P. falciparum malaria provides a molecular marker that can be used for surveillance of resistance and to evaluate drug treatment and prophylaxis policies. The present results further support this role of the pfcrt gene. In the current study, 200 P. falciparum clinical isolates were collected during 2002–2005 when CQ was used as the first-line anti-malaria treatment of uncomplicated falciparum patients in south-eastern Iran. Genotyping of all 25 recrudescent isolates with both msp-1 and msp-2 showed no re-infection. Two follow-up patients recruited at D30 and D58 after treatment with CQ and based on the parasitological response were classified as sensitive (S). However, msp-1 and msp-2 genotyping of those samples at D0, D30, and D58 showed the same allelic families and length of PCR products, and therefore, these 2 samples might have been classified as RI. Hence, this data suggested that the standard WHO 28-day in vivo test might need to be revised and extended to 60 days after treatment.

In this study, 6 codons of pfcrt were monitored by the RFLP method; however, for identification of the pfcrt haplotype, DNA sequencing was applied. Both pre- (97%) and post-treatment (96%) P. falciparum isolates harbored mutations at positions 76T, 220S, 326D, and 356L, but other codons (271 and 371) showed no mutation associated to CQR. Although only 25/175 consenting patients fulfilled the 28-day follow-up, most of the patients showed recurrent infection in different days after treatment with CQ without fulfilling the 28-day follow-up (such post-treatment samples were not available for molecular work). The high prevalence of CQ treatment failure by D28 (78.5%) in south-eastern province of Iran was also reported in another study.6 Therefore, the present data suggest that these 4 mutations in the pfcrt gene might have been selected by treatment and therefore can be used as molecular markers to monitor CQR in this region of the world.

We also observed predominance of wild haplotype N86, Y184, S1034, N1042, and D1245 (NYSND) of the pfmdr1 gene in our samples. The presence of this predominant haplotype among Iranian P. falciparum strains was in concordance with findings in Thai isolates48; however, it was distinct from African isolates.14 Although all parasite isolates examined in this study harbored 86Y also the 76T mutation in both pre- and post-treatment isolates, there was no association between the pfmdr1 86Y mutation and in vivo CQ resistance observed in this study. This result was also in concordance with other studies24,28,49 and confirms that the N86Y position in the pfmdr1 gene is not a reliable molecular marker to monitor CQR in an epidemiologic survey in Iran. A low number of P. falciparum isolates showed mutations at positions 184F and 1034C; these samples had been isolated from patients who had taken a trip to Pakistan or from Pakistani patients who came to Iran for seeking treatment with anti-malarial drugs. This issue must be considered for control of the disease because there is a risk of invasion of resistant parasites with different mutations, and its spread might occur either by local transmission and/or migration of reservoirs from the Indian subcontinent to Iran and from there may be distributed to other malaria settings.

Regarding the prevalence of pfmdr1 haplotypes, 2 haplotypes predominated among our samples (NYSND, N = 58.5% and YYSND, N = 34%). No wild haplotype of pfcrt (72-CVMNKAQNIR-371) was found in post-treatment samples; however, 56% of clinically failed samples carried the wild-type pfmdr1 (NYSND). Therefore, our study does not support the role of pfmdr1 in conferring CQR in P. falciparum strains, as has been shown in studies from Uganda, Laos, Cameroon, South Africa, Brazil, and Peruvian Amazon, verifying that this mutation is not predictive of treatment outcome in their regions.9,5052

One of the interesting results of this study was genetic investigation of the codons 72–76 haplotypes among Iranian isolates. CQ-sensitive P. falciparum strains have the haplotype CVMNK, regardless of geographic origin. However, so far, 8 distinct pfcrt allelic patterns for codons 72– 76, including SVMNT, CVMNT, CVMET, CVIET, SVIET, CVIKT, SVMIT, and RVMNT, have been associated with P. falciparum CQR phenotype.7,53,54 In general, CQR P. falciparum strains from South America have most often the haplotype SVMNT, CVMNT, and CVMET, whereas CQR parasites from Africa/Southeast Asia carry an allele encoding the CVIET haplotype, suggesting two main independent origins of CQR7,35 and an apparently separate site in Papua New Guinea (PNG),30,35 Philippines,55 and India.56 Sequence analysis of our samples revealed that 72-SVMNT-76 was the most prevalent haplotype among examined samples, which was in agreement with similar findings in India and PNG.35,53,56 In addition, parasite isolates from other malaria setting, such as Laos and Tanzania (possibly, after large-scale use of amodiquine), share this haplotype with the South American isolates.57,58 Remarkably, haplotype 72-CVIET-76, which was characteristic of CQR parasites from Southeast Asia,24,30 has not been found among our examined isolates, and surprisingly, we found that there is a closer relationship between the Iranian and South American 7G8 line than Asian/African CQR P. falciparum. Therefore, the high prevalence of 72-SVMNT-76 haplotype that accompanies other mutations at codons 220S, 326D, and 356L of pfcrt gene (72-SVMNTSQDLR-371 haplotype) and the absence of CQR CVIET haplotype (Asia/Africa) among examined isolates in this study were not consistent with the earlier presumed spread of CQR parasites from Southeast Asia to Africa via the Indian subcontinent. In addition, CQR isolates carrying the 72-SVMNT-76 haplotype from the present study were detected in Iran, India,55,59 Philippines,55 PNG,30,35 and Laos57 and share the same pfcrt haplotype as the Brazilian line 7G8, indicating their origin as apparently independent mutational events.

Nevertheless, genetic analysis of a large number of samples from different parts of malaria setting in Iran and similar studies on samples from Pakistan and Afghanistan, which serve as bridges between India and Iran, could help our understanding of how CQR evolved in this region of the world. In addition, the high prevalence of mutations at codons 220S, 326D, and 356L (97%) that accompanies 72-SVMNT-76 in Iranian P. falciparum isolates suggests that the population of P. falciparum that circulates in south-eastern Iran has been selected by the long use of CQ. The overall picture emerging from this study is that resistance to this drug is abundant in south-eastern Iran, and this finding strongly supports withdrawal of CQ as the first-line drug for treatment of falciparum malaria in Iran.


Received May 19, 2007. Accepted for publication November 19, 2007.

Acknowledgments: The authors are indebted to H. Malek Afzali (Deputy for Research, Ministry of Health, I.R. Iran) for his invaluable support; the Malaria Division, Centre for Diseases Management and Control, Iran; Zahedan University of Medical Sciences and staff in Public Health Department, Chabahar district, Sistan and Baluchistan province, for their assistance in collecting blood samples from the field. We also thank all participants of the in vivo drug study. We also thank to S. Sardari and Mrs. M. Saffari for English editing the manuscript.

Financial support: This study was partially supported by grants from Deputy for Research, Ministry of Health, and Pasteur Institute of Iran.

* Address correspondence to Sedigheh Zakeri, Malaria and Vector Research Group (MVRG), Biotechnology Research Center, Pasteur Institute of Iran, Pasteur Avenue, PO Box 1316943, Tehran, Iran. E-mail: zakeris{at}yahoo.com, azad{at}institute.pasteur.ac.ir Back

Authors’ addresses: Sedigheh Zakeri, Mandana Afsharpad, and Navid Dinparast Djadid, Malaria and Vector Research Group (MVRG), Biotechnology Research Center, Pasteur Institute of Iran, Tehran, Iran, Pasteur Avenue, PO Box 1316943, Tehran, Iran, Tel: +98 21 66480780, Fax: +98 21 66465132, E-mail: zakeris{at}yahoo.com, azad{at}institute.pasteur.ac.ir. Tahmineh Kazemzadeh and Ashraf Shabani, Al-Zahra University, Tehran, Iran. Kambiz Mehdizadeh, Chabahar Public Health Department, Zahedan University of Medical Sciences, Chabahar, Iran.

Reprint requests: Sedigheh Zakeri, Malaria and Vector Research Group (MVRG), Biotechnology Research Center, Pasteur Institute of Iran, Pasteur Avenue, PO Box 1316943, Tehran, Iran, Tel: +98 21 66480780, Fax: +98 21 66465132, E-mail: zakeris{at}yahoo.com; azad{at}institite.pasteur.ac.ir.


REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Wongsrichanalai C, Pickard AL, Wernsdorfer WH, Meshnick SR, 2002. Epidemiology of drug-resistant malaria. Lancet Infect Dis 2: 209–218.[Web of Science][Medline]
  2. Misra SP, 1996. In vivo resistance to chloroquine and sulfadoxine/pyrimethamine combination in Plasmodium falciparum in India. Proc Nat Acad Sci India 66: 123–128.
  3. Sharma YD, Biswas S, Pillai CR, Ansari MA, Adak T, Devi U, 1996. High prevalence of chloroquine resistant Plasmodium falciparum infection in Rajasthan epidemic. Acta Trop 62: 135–141.[Web of Science][Medline]
  4. Edrissian GH, Shahabi S, Pishva E, Hajseyed-Javadi J, Khaleghian B, Ghorbani M, Emadi AM, Afshar A, Saghari H, 1986. Imported cases of chloroquine-resistant falciparum malaria in Iran. Bull Soc Pathol Exot 79: 217–221.[Web of Science]
  5. Edrissian GH, Nateghpour M, Afshar A, Sayedzadeh A, Mohsseni GH, Satvat MT, Emadi AM, 1999. Monitoring the response of P. falciparum and P. vivax to anti malarial drugs in the malarious areas in south-east Iran. Arch Iran Med 2: 61–66.
  6. Raeisi A, Ringwald P, Safa O, Shahbazi A, Ranjbar M, Keshavarze H, Nateghpour M, Faraji L, 2006. Monitoring of the therapeutic efficacy of chloroquine for the treatment of uncomplicated, Plasmodium falciparum malaria in Iran. Ann Trop Med Parasitol 100: 11–16.[Web of Science][Medline]
  7. Fidock DA, Nomura T, Talley AK, Cooper RA, Dzekunov SM, Ferdig MT, Ursos LMB, Sidhu AB, Naude B, Deitsch KW, Su XZ, Wootton JC, Roepe PD, Wellems TE, 2000. Mutations in the P. falciparum digestive vacuole transmembrane protein PfCRT and evidence for their role in chloroquine resistance. Mol Cell 6: 861–871.[Web of Science][Medline]
  8. Su X, Kirkman LA, Fujioka H, Wellems TE, 1997. Complex polymorphisms in an approximately 330 kDa protein are linked to chloroquine-resistant Plasmodium falciparum in Southeast Asia and Africa. Cell 91: 593–603.[Web of Science][Medline]
  9. Martin SK, Oduola AMJ, Milhous WK, 1987. Reversal of chloroquine resistance in Plasmodium falciparum by verapamil. Science 235: 899–901.[Abstract/Free Full Text]
  10. Wilson CM, Serrano AE, Wasley A, Bogenschutz MP, Shankar AH, Wirth DF, 1989. Amplification of a gene related to mammalian mdr genes in drug resistant Plasmodium falciparum. Science 244: 1184–1186.[Abstract/Free Full Text]
  11. Foote SJ, Kyle DE, Martin RK, Oduola AM, Forsyth K, Kemp DJ, Cowman AF, 1990. Several alleles of the multidrug-resistance gene are closely linked to chloroquine resistance in Plasmodium falciparum. Nature 345: 255–258.[Medline]
  12. Fidock DA, Nomura T, Cooper RA, Su X, Talley AK, Wellems E, 2000. Allelic modifications of cg2 and cg1 genes do not alter the chloroquine response of drug-resistant Plasmodium falciparum. Mol Biochem Parasitol 110: 1–10.[Web of Science][Medline]
  13. Awad-el-Kariem FM, Miles MA, Warhurst DC, 1992. Chloroquine-resistant Plasmodium falciparum isolates from the Sudan lack two mutations in the pfmdrl gene thought to be associated with chloroquine resistance. Trans R Soc Trop Med Hyg 86: 587–589.[Web of Science][Medline]
  14. Wellems TE, Walker-Jonah A, Panton LJ, 1991. Genetic mapping of the chloroquine-resistance locus on Plasmodium falciparum chromosome 7. Proc Natl Acad Sci USA 88: 3382–3386.[Abstract/Free Full Text]
  15. Basco LK, Ringwald P, 2002. Molecular epidemiology of malaria in Cameroon. X. Evolution of pfmdr1 mutations as genetic markers for resistance to amino alcohols and artemisinin derivatives. Am J Trop Med Hyg 66: 667–671.[Abstract]
  16. Reed MB, Saliba KJ, Caruana SR, Kirk K, Cowman AF, 2000. Pgh1 modulates sensitivity and resistance to multiple anti-malarials in Plasmodium falciparum. Nature 403: 906–909.[Medline]
  17. Cowman AF, 1991. The P-glycoprotein homologs of Plasmodium falciparum: are they involved in chloroquine resistance? Parasitol Today 7: 70–76.[Web of Science][Medline]
  18. Schneider AG, Premji Z, Feleger I, 2002. A point mutation in codon 76 of pfcrt of P. falciparum is positively selected for by chloroquine resistance in Tanzania. Infect Genet Evol 1: 183–189.[Medline]
  19. Pillai DR, Hijar G, Montoya Y, 2003. Lack of prediction of mefloquine and mefloquine– artesunate treatment outcome by mutation in Plasmodium falciparum multidrug resistance 1 (pfmdr 1) gene for P. falciparum malaria in Peru. Am J Trop Med Hyg 68: 107–110.[Abstract/Free Full Text]
  20. Huaman MC, Roncal N, Nakazawa S, Long TT, Gerena L, Garcia C, 2004. Polymorphism of the Plasmodium falciparum multidrug resistance and chloroquine resistance transporter genes and in vitro susceptibility to aminoquinolines in isolates from the Peruvian Amazon. Am J Trop Med Hyg 70: 461–466.[Abstract/Free Full Text]
  21. Pickard AL, Wongsrichanalai C, Purfield A, Kamwendo D, Emery K, Zalewski C, 2003. Resistance to anti-malarials in Southeast Asia and genetic polymorphisms in pfmdr1. Antimicrob Agents Chemother 47: 2418–2423.[Abstract/Free Full Text]
  22. Price RN, Cassar C, Brockman A, Duraisingh M, Van-Vugt M, White NJ, Nosten F, Krishna S, 2004. The pfmdr1 gene is associated with a multidrug-resistant phenotype in Plasmodium falciparum from the western border of Thailand. Antimicrob Agents Chemother 43: 2943–2949.
  23. Wellems TE, Plowe CV, 2001. Chloroquine-resistant malaria. J Infect Dis 184: 770–776.[Web of Science][Medline]
  24. Djimdé A, Doumbo OK, Cortese JF, Kayentao K, Doumbo S, Diourté Y, Dicko A, Su X, Nomura T, Fidock DA, Wellems TE, Plowe CV, 2001. A molecular marker for chloroquine-resistant falciparum malaria. N Engl J Med 344: 257–263.[Abstract/Free Full Text]
  25. Durand R, Jafari S, Vauzelle J, Delabre JF, Jesic Z, Le Bras J, 2001. Analysis of pfcrt point mutations and chloroquine susceptibility in isolates of Plasmodium falciparum. Mol Biochem Parasitol 114: 95–102.[Web of Science][Medline]
  26. Sanchez C, Lanzer M, 2000. Changing ideas on chloroquine in Plasmodium falciparum. Curr Opin Infect Dis 13: 653–658.[Web of Science][Medline]
  27. Babiker HA, Pringle SJ, Abdel-Muhsin A, Mackinnon M, Hunt P, Walliker D, 2001. High-level chloroquine resistance in Sudanese isolates of Plasmodium falciparum is associated with mutations in the chloroquine resistance transporter gene pfcrt and the multidrug resistance gene pfmdr1. J Infect Dis 183: 1535–1538.[Web of Science][Medline]
  28. Mackinnon MJ, Hastings IM, 1998. The evolution of multiple drug resistance in malaria parasites. Trans R Soc Trop Med Hyg 92: 188–195.[Web of Science][Medline]
  29. Basco LK, Ringwald P, 1998. Molecular epidemiology of malaria in Yaounde, Cameroon. III. Analysis of chloroquine resistance and point mutations in the multidrug resistance 1 (pfmdr1) gene of Plasmodium falciparum. Am J Trop Med Hyg 59: 577–581.[Abstract]
  30. Wootton JC, Feng X, Ferdig MT, Cooper RA, Mu J, Baruch DI, Magill AJ, Su XZ, 2002. Genetic diversity and chloroquine selective sweeps in Plasmodium falciparum. Nature 418: 320–323.[Medline]
  31. Lim P, Chy S, Ariey F, Incardona S, Chim P, Sem R, Denis MB, Hewitt S, Hoyer S, Socheat D, Merecreau-Puijalon O, Fandeur T, 2003. pfcrt polymorphism and chloroquine resistance in Plasmodium falciparum strains isolated in Cambodia. Antimicrob Agents Chemother 47: 87–94.[Abstract/Free Full Text]
  32. Uhleman AC, Yuthavong Y, Fidock DA, 2005. Mechanisms of anti-malarial drug action and resistance. Sherman IW, ed. Molecular Approaches to Malaria. Washington, DC: ASM Press, 429–461.
  33. Chen N, Kyle DE, Pasay C, Fowler EV, Baker J, Peters JM, Cheng Q, 2003. pfcrt allelic types with two novel amino acid mutations in chloroquine-resistant Plasmodium falciparum isolates from the Philippines. Antimicrob Agents Chemother 47: 3500–3505.[Abstract/Free Full Text]
  34. Durand V, Berry A, Sem R, Glaziou P, Beaudou J, Fandeur T, 2004. Variations in the sequence and expression of the Plasmodium falciparum chloroquine resistance transporter (Pfcrt) and their relationship to chloroquine resistance in vitro. Mol Biochem Parasitol 136: 273–285.[Web of Science][Medline]
  35. Mehlotra RK, Fujioka H, Roepe PD, Janneh O, Ursos LM, Jacobs-Lorena V, McNamara DT, Bockarie MJ, Kazura JW, Kyle DE, Fidock DA, Zimmerman PA, 2001. Evolution of a unique Plasmodium falciparum chloroquine-resistance phenotype in association with pfcrt polymorphism in Papua New Guinea and South America. Proc Natl Acad Sci USA 98: 12689–12694.[Abstract/Free Full Text]
  36. Chen N, Russell B, Staley J, Kotecka B, Nasveld P, Cheng Q, 2001. Sequence polymorphisms in pfcrt are strongly associated with chloroquine resistance in Plasmodium falciparum. J Infect Dis 183: 1543–1545.[Web of Science][Medline]
  37. Ursing J, Zakeri S, Gil JP, Bjorkman A, 2006. Quinoline resistance associated polymorphisms in the pfcrt, pfmdr1 and pfmrp genes of Plasmodium falciparum in Iran. Acta Trop 97: 352–356.[Web of Science][Medline]
  38. Zakeri S, Gil JP, Bereckzy S, Djadid ND, Bjorkman A, 2003. High prevalence of double Plasmodium falciparum dhfr mutations at codons 108 and 59 in the Sistan–Baluchistan province, Iran. J Infect Dis 187: 1828–1829.[Web of Science][Medline]
  39. Zakeri S, Najajabadi S, Zare A, Djadid N, 2002. Detection of malaria parasites by nested PCR in south-eastern, Iran: evidence of highly mixed infections in Chabahar district. Malar J 1: 2.[Medline]
  40. Heidari A, Dittrich S, Jelinek T, Kheirandish A, Banihashemi K, Keshavarz H, 2007. Genotypes and in vivo resistance of Plasmodium falciparum isolates in an endemic region of Iran. Parasitol Res 100: 589–592.[Web of Science][Medline]
  41. Jafari S, Le Bras J, Asmar M, Durand R, 2003. Molecular survey of Plasmodium falciparum resistance in south-eastern Iran. Ann Trop Med Parasitol 97: 119–124.[Web of Science][Medline]
  42. Wernsdorfer WH, Payne D, 1998. Drug sensitivity tests in malaria parasites. Wernsdorfer WH, MacGregor I, eds. Principles and Practice of Malariolology. London: Churchill Livingstone, 1765–1794.
  43. Snounou G, Zhu X, Siripoon N, Jarra W, Thaithong S, Brown KN, Viriyakosol S, 1999. Biased distribution of msp1 and msp2 allelic variants in Plasmodium falciparum populations in Thailand. Trans R Soc Trop Med Hyg 93: 369–374.[Web of Science][Medline]
  44. Snounou G, Viriyakosol S, Zhu XP, Jarra W, Pinheiro L, do Rosario VE, Thaithong S, Brown KN, 1993. High sensitivity of detection of human malaria parasites by the use of nested polymerase chain reaction. Mol Biochem Parasitol 61: 315–320.[Web of Science][Medline]
  45. Duraisingh MT, Jones P, Sambou I, von Seidlein L, Pinder M, Warhurst DC, 2000. The tyrosine-86 allele of the pfmdr1 gene of Plasmodium falciparum is associated with increased sensitivity to the anti-malarials mefloquine and artemisinin. Mol Biochem Parasitol 108: 13–23.[Web of Science][Medline]
  46. University of Maryland Center for Vaccine Development. http://medschool.umaryland.edu/cvd/nejm2001djimde.asp.
  47. Purfield A, Nelson A, Laoboonchai A, Congpuong K, McDaniel P, Miller RS, Welch K, Wongsrichanalai C, Meshnick SR, 2004. A new method for detection of pfmdr1 mutations in Plasmodium falciparum DNA using real-time PCR. Malar J 7: 91.
  48. Congpuong K, Bangchang KN, Mungthin M, Bualombai P, Wernsdorfer WH, 2005. Molecular epidemiology of drug resistance markers of Plasmodium falciparum malaria in Thailand. Trop Med Int Health 10: 717–722.[Web of Science][Medline]
  49. McCutcheon KRG, Freese JA, Frean JA, Sharp BL, Markus MB, 1999. Two mutations in the multidrug-resistance gene homologue of Plasmodium falciparum, pfmdr1, are not useful predictors of in vivo or in vitro chloroquine resistance in southern Africa. Trans R Soc Trop Med Hyg 93: 300–302.[Web of Science][Medline]
  50. Dorsey G, Kamya MR, Singh A, Rosenthal PJ, 2001. Polymorphisms in the Plasmodium falciparum pfcrt and pfmdr-1 genes and clinical response to chloroquine in Kampala, Uganda. J Infect Dis 183: 1417–1420.[Web of Science][Medline]
  51. Pillai DR, Labbe AC, Vanisaveth V, Hongvangthong B, Pomphida S, Inkathone S, 2001. Plasmodium falciparum malaria in Laos: chloroquine treatment outcome and predictive value of molecular markers. J Infect Dis 183: 789–795.[Web of Science][Medline]
  52. Zalis MG, Pang L, Silveira MS, Milhous WK, Wirth DF, 1998. Characterization of Plasmodium falciparum isolated from the Amazon region of Brazil: evidence for quinine resistance. Am J Trop Med Hyg 58: 630–637.[Abstract]
  53. Nagesha HS, Casey GJ, Rieckmann KH, Fryauff DJ, Laksana BS, Reeder JC, Maguire JD, Baird JK, 2003. New haplotypes of the Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene among chloroquine resistant parasite isolates. Am J Trop Med Hyg 68: 398–402.[Abstract/Free Full Text]
  54. Plummer WB, Pereira LMP, Carrington CVF, 2004. pfcrt and pfmdr1 alleles associated with chloroquine resistance in Plasmodium falciparum from Guyana, South America. Mem Inst Oswaldo Cruz 99: 389–392.[Web of Science][Medline]
  55. Chen N, Wilson DW, Pasay C, Bell D, Martin LB, Kyle D, Cheng Q, 2005. Origin and dissemination of chloroquine-resistant Plasmodium falciparum with mutant pfcrt alleles in the Philippines. Antimicrob Agent Chemother 49: 2102–2105.[Abstract/Free Full Text]
  56. Vathsala PG, Pramanik A, Dhanasekaran S, Devi CU, Pillai CR, Subbarao SK, Ghosh SK, Tiwari SN, Sathyanarayan TS, Deshpande PR, Mishra GC, Ranjit MR, Dash AP, Rangarajan PN, Padmanaban G, 2004. Widespread occurrence of the Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene haplotype SVMNT in P. falciparum malaria in India. Am J Trop Med Hyg 70: 256–259.[Abstract/Free Full Text]
  57. Alifrangis M, Dalgaad MB, Lusingu JP, Vestergaad LS, Staalsoe T, Jensen ATR, Enevold A, Ronn AM, Khalil IF, Warhurst DC, Lemnge MM, Theander TG, Bygbjerg C, 2006. Occurrence of the Southeast Asian/South American SVMNT haplotype of the chloroquine-resistance transporter gene in Plasmodium falciparum in Tanzania. J Infect Dis 193: 1738–1741.[Web of Science][Medline]
  58. Dittrich S, Alifrangis M, Stohrer MJ, Thongpaseuth V, Vanisaveth V, Phetsouvanh R, Phompida S, Khalil IF, Jelinek T, 2005. Falciparum malaria in the north of Laos: the occurrence and implications of the Plasmodium falciparum chloroquine resistance transporter (pfcrt) gene haplotype SVMNT. Trop Med Int Health 10: 1267–1270.[Web of Science][Medline]
  59. Keen J, Farcas GA, Zhong K, Yohanna S, Dunne MW, Kain KC, 2007. Real time PCR assay for rapid detection and analysis of PFCRT haplotypes of chloroquine-resistant Plasmodium falciparum isolates from India. J Clin Microbiol 45: 2889–2893.[Abstract/Free Full Text]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in ISI Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Zakeri, S.
Right arrow Articles by Djadid, N. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Zakeri, S.
Right arrow Articles by Djadid, N. D.
Related Collections
Right arrow Drug-Resistance
Right arrow Malaria


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS