AJTMH HINARI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 78(2), 2008, pp. 298-302
Copyright © 2008 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Djogbénou, L.
Right arrow Articles by Chandre, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Djogbénou, L.
Right arrow Articles by Chandre, F.
Related Collections
Right arrow Malaria
Right arrow Medical Entomology
Right arrow Mosquitoes

Identification and Geographic Distribution of the ACE-1R Mutation in the Malaria Vector Anopheles gambiae in South-Western Burkina Faso, West Africa

Luc Djogbénou*, Roch Dabiré, Abdoulaye Diabaté, Pierre Kengne, Martin Akogbéto, Jean Marc Hougard, AND Fabrice Chandre
Centre de Recherches Entomologiques de Cotonou (CREC), Cotonou, Benin; Laboratoire d’Entomologie et de Parasitologie, Centre Muraz, Bobo-Dioulasso, Burkina Faso; Laboratoire de lutte contre les Insectes Nuisibles (LIN), Research Unit 016, Institut de Recherche pour le Développement, Montpellier, France; Institut de Recherche pour le Développement (IRD/CREC), Cotonou, Benin


ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Resistance of Anopheles gambiae to organophosphate and carbamate insecticides was first reported in Côte d’Ivoire, West Africa. Subsequent studies revealed that it resulted from a single point mutation in the oxyanion hole of the acetycholinesterase enzyme (ace-1R mutation). We investigated the distribution and prevalence of the ace-1R mutation in An. gambiae s.l. populations from seven locations in south-western Burkina Faso. The ace-1R mutation was found in both M and S molecular forms of An. gambiae s.s., but it was absent in An. arabiensis. Its frequency ranged from 0.25 to 0.5 in S form and 0.04 to 0.13 in M form, though they were sympatric. The lack of homozygous resistance indicated a strong genetic cost associated with the mutation. These data suggest that organophosphate and carbamate resistance conferred by target site insensitivity is spreading in populations of An. gambiae s.s. from West Africa.


INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Anopheles gambiae Giles, the major malaria vector in West Africa, has been subjected to selection pressure by DDT and, more recently, pyrethroids through use of these insecticides for both agricultural and public health purposes.1,2 The intensive application of these chemical insecticides led to the development of resistance in many insects including Anopheles mosquitoes. The first case of resistance to pyrethroids in An. gambiae was reported in 1993.3 This resistance results from a single point mutation (leucine TTA to phenylalanine TTT) in the gene that encodes the sodium channel, and confers the characteristic "knockdown resistance" or kdr phenotype.4 This mutation is widespread in West Africa and may compromise the use of pyrethroids for public health.1,57 Some alternative solutions to pyrethroids are therefore necessary.8,9

Preliminary experiments have already been done to test organophosphates (OP) or carbamates (CX) as alternatives to pyrethroids on insecticide-treated nets.10 However, insensitivity of wild An. gambiae to both insecticides, which target acetylcholinesterase (AChE), has been recently reported in West Africa.11 Sequencing of this target site identified a single mutation, (glycine to serine at position 119) in the oxy-anion hole of the acetylcholinesterase enzymes that was associated with insensitivity of An. gambiae to OP and CX.12 This mutation, named ace-1_G119S or ace-1R (using the Torpedo nomenclature), was the same described in Anopheles albimanus Weidemann and Culex pipiens Say.13,14 A Polymerase Chain Reaction (PCR)-based assay was devised to detect its presence in An. gambiae, An. Albimanus, and Cx. Pipiens.14

This study is designed to evaluate the presence and extent of the distribution of the ace-1R mutation within and among An. gambiae s.l. populations in south-western Burkina Faso where pyrethroid resistance was also reported in An. gambiae.2,15


MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Study area. The study was carried out in seven locations in south-western Burkina Faso, based on their different patterns of insecticide use: i) VK7, a village located on the outskirts of rice fields (11°24'N; 4°24'E); ii) two cotton-growing areas, Samandeni (11°27'N; 4°27'E) and Seguere (11°30'N; 4°24'E); iii) two sites in the urban area of Bobo-Dioulasso (11°10'N; 4°17'E) where more than 95% of the households use coils frequently to protect themselves against mosquito bites: Dioulassoba (Bobo 1), located in the center of the city and Kuinima (Bobo 2) on the outskirts; iv) Yegueresso (11°09'N; 4°10'E) and Darsalamy (11°02'N; 4°21'E), two villages not far from the urban area of Bobo-Dioulasso. Yegueresso and Darsalamy are sites with limited use of insecticides because agriculture is done at the subsistence level (e.g., beans and maize). All of these sites were located in the same climatic area (annual rainfall 1,000 mm) (Figure 1Go).


Figure 1
View larger version (21K):
[in this window]
[in a new window]

 
FIGURE 1. The study areas map showing the relative frequency of M and S molecular forms of An. gambiae s.s.

 
Mosquito collections. Larvae of An. gambiae s.l. were collected in October 2005 (end of the rainy season) and March 2006 (dry season) and were transferred to the IRSS (Institut Régional des Sciences de Santé) laboratory for adult emergence. An. gambiae adults were visually sorted according to morphologic identification keys and were kept at –20°C for molecular analysis.

DNA extraction and PCR identification of the An. gambiae M and S. Genomic DNA was extracted from individual mosquitoes using the protocol slightly modified from Collins and others.16 Species of the An. gambiae complex and molecular forms of An. gambiae s.s. were identified using the methods of Scott and others and Favia and others, respectively.17,18

PCR identification of ace-1R mutations of acetylcholinesterase gene of An. gambiae. The ace-1 gene was amplified by PCR with Ex3AGdir 5'GATCGTGGACACCGTGTTCG3' and Ex3AGrev 5'AGGATGGCCCGCTGGAACAG3' oligonucleotide primers.14 PCR was performed in 25 µL volumes containing 2.5 µL of 10X Taq DNA polymerase buffer, 200 µM deoxynucleoside triphosphate (dNTP), 0.1 U of Taq DNA polymerase (Qiagen, France), 10 pmol of each primer, and 1 to 10 ng of extracted DNA. PCR conditions included an initial denaturation step at 94°C for 5 min followed by thirty five cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 30 s, and a final extension at 72°C for 5 min. Fifteen microliters of this product were digested with 5 U of AluI restriction enzyme (Promega, France) in a final volume of 25 µL. The PCR amplification products were analyzed by electrophoresis onto a 2% agarose gel stained with ethidium bromide and visualized under UV light.

Statistical analysis. Conformity of ace-1R frequency with Hardy Weinberg expectations was tested for each population using the exact probability test.19


RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
The numbers and species of mosquitoes collected are shown in Table 1Go. A total of 492 mosquitoes were identified to species level and to molecular form (Table 1Go). Two species of the An. gambiae complex were recorded and found in sympatry in six locations out of seven. Overall An. gambiae s.s. was predominant with 61%, but An. arabiensis (Patton) occurred at a significantly higher frequency in Darsalamy, Yegueresso, Bobo Dioulasso, and Seguere (> 58% in these breeding sites) as opposed to Samandeni (4%) and VK7 (0%). The two molecular forms of An. gambiae s.s. were sympatric in all locations, except in Bobo 2 where only S form was identified (Table 1Go). The S form predominated in urban areas at frequencies of 95–100%. The M form was predominant in Darsalamy and Yegueresso.


View this table:
[in this window]
[in a new window]

 
TABLE 1
Frequencies in percentage of Anopheles gambiae s.s., S and M molecular forms, and Anopheles arabiensis at seven sites in southwestern Burkina Faso.
 
The ace-1R mutation was detected in An. gambiae s.s. only and was present in all sites, regardless of the different patterns of insecticide use. Its frequency was higher in the urban, cotton, and rice-growing areas, compared with Yegueresso and Darsalamy where insecticide use is limited (Table 2Go). The ace-1R allele is present in both M and S molecular forms of An. gambiae but is more frequent in the S form (Table 2Go). In addition, few specimens analyzed were homozygous for the ace-1R mutation (only 3 of 131 resistant mosquitoes recorded from all sites). A significant departure from Hardy Weinberg equilibrium was observed in some samples because of a strong deficit of homozygous-resistant individuals (Table 2Go).


View this table:
[in this window]
[in a new window]

 
TABLE 2
Frequencies of the ace-1R allele and genotypes in the Anopheles gambiae s.s. and S and M molecular forms.
 

DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Pyrethroid-treated bednets remain one of the major tools for malaria vector control in tropical areas. However, the spectrum of resistance to pyrethroids calls for alternative and complementary solutions. Even if they are not recommended for bednets impregnation, OP and CX should be considered as some alternatives for indoor residual spraying. Resistance of An. gambiae s.s. to OP and CX has been reported by N’Guessan and others11 using bioassay techniques. This study demonstrated the need to monitor OP and CX resistance among populations of the An. gambiae complex in Africa, to determine its spread and anticipate vector control failure where these insecticides are used. Since the development of a molecular test to detect the ace-1R mutation in An. gambiae,14 this study is the first that reports the distribution of the ace-1R mutation in populations of An. gambiae s.l. across areas with different patterns of insecticide use in Burkina Faso.

The use of insecticides for crop protection may explain the level of OP and CX resistance observed in some of our rural areas. Diabate and others2 showed that agricultural use of insecticides in Burkina Faso was involved in the development of pyrethroid resistance in An. gambiae s.l.. In the cotton-growing areas, farmers use huge amounts of insecticides to avoid substantial yield reduction of their crops. Even if the selection pressure is much lower in rice field areas, a high frequency of resistant individuals was observed in VK7. VK7 is located at the periphery of rice fields and the resistant mosquitoes of the S form found in VK7 might have migrated from surrounding cotton areas as was the case for the kdr mutation in the same village.2 In the urban area of Bobo-Dioulasso the presence of ace-1R should be partly explained by the use of household insecticides, which sometimes contain carbamate. In 1993 in Bouake, Côte d’Ivoire, Elissa and others3 attributed the presence of permethrin resistance to the widespread use of pyrethroids in households. However, during our larval collections in Bobo-Dioulasso, we also noticed important vegetable growing areas within town where farmers apply large amounts of insecticides for crop protection (personal observations). Otherwise the results from the survey conducted in 2002 by Diabate and others2 showed high levels of pyrethroid resistance (kdr mutation) up to 95.6% in the same area of Bobo 1. In Yegueresso and Darsalamy where limited amounts of insecticide is used to protect crops for subsistence, the level of resistance observed (0.11 for Darsalamy and 0.15 for Yegueresso) in mosquitoes may have been due to a migration from the urban areas of Bobo Dioulasso into these villages.

The molecular M and S forms of An. gambiae are incipient species.20 They display a pattern of habitat segregation and a strong assortative mating in nature that results in a strong barrier to gene flow.2123 The ace-1R mutation was detected in both M and S molecular forms of An. gambiae s.s. but at different frequencies. It was significantly higher in the S form, probably reflecting the differences in the insecticide selection pressures the two forms experience in their natural habitats. It is not clear from our data whether the OP and Cx resistance gene was selected in one form and arose later on in the second one through genetic introgression as it has been shown with the kdr mutation. Further studies to clarify this point are needed and eventually that may help to better understand the gene flow pattern between the two forms in natural populations. Although An. arabiensis was found in sympatry with the two molecular forms of An. gambiae, the ace-1R mutation was never found in this mosquito species suggesting that gene flow between An. arabiensis and An. gambiae is strongly reduced.

The high relative frequencies of An. arabiensis in our mosquito samples across the study area were surprising. Previous studies in the same area have recorded a maximum of 8% of An. arabiensis in contrast to the present study where An. arabiensis represented 60% of the total collection.2,21 Coluzzi and others24 first reported the penetration of this mosquito species into urban settings in southern Nigeria. Many other studies confirmed these observations later in different places drawing attention to the rapid extension of An. arabiensis into urban areas.25,26 Further studies are needed to understand the current distribution of An. arabiensis in West African cities.

The insensitivity of acetylcholinesterase to OP and CX leads to a reduction of the normal enzyme function. Several studies have suggested that the biochemical change introduced by G119S results in a fitness reduction on life-history traits associated with the mutation. This phenomenon was observed with Cx. pipiens. Numerous life-history traits are modified in insecticide-resistant individuals as compared with susceptible ones (e.g., an increased larval development time and mortality, a lower male reproductive success, and a lower female survival during overwintering).27,28 The data obtained from the field samples in the present study indicate that the frequency of resistant homozygous individuals (ace-1RR) is extremely low in adult females (1% homozygous resistant versus 45% heterozygous). The Hardy-Weinberg test showed an excess of heterozygotes. This drastic lack of resistant homozygous An. gambiae in the field is consistent with the hypothesis of a high fitness cost associated with the G119S mutation in this species. Additional studies are required to explore this hypothesis through laboratory experiments comparing different life-history traits of the resistant allele, to understand the low frequency of resistant homozygous specimens recorded in the field populations.

In conclusion, we report here that this mutation occurs in many specimens of An. gambiae s.s. found in South-Western Burkina Faso in addition to the case in Bouake in Côte d’Ivoire. All these findings suggest that OP and CX resistance may be widespread throughout West Africa. This wide distribution of ace-1R mutation in West Africa theoretically could result either from the spread of the single mutation or from the independent occurrence of the same or different mutations in many countries. Although the rate of mutations generating resistance genes among mosquitoes is unknown, we can consider that the migration including passive transportation of mosquitoes and gene flow play major roles in the dispersion of resistance genes between distant populations.29 Further genetic studies will be performed on mosquito samples to investigate gene flow between Bouake in Côte d’Ivoire and other towns in Burkina Faso. However mosquitoes with resistance for both kdr and ace-1R mutations were found in the field. The presence of both resistance mechanisms (kdr and ace-1R) in mosquitoes may allow them to be simultaneously resistant to pyrethroids, carbamates, and organophosphates. Although there is no miraculous short-term solution to this resistance problem, it is important for program managers to better understand resistance issues and to promote good practices in chemical-based vector control. Indeed it is essential to use public health insecticides in such a way that they are safe, effective, and affordable, while taking into account resistance problems. This work like others underlines the relationship between vector resistance and the use of agricultural insecticides. It is clear that closer collaboration between resistance experts in agriculture and public health is needed. Public health agencies can definitely benefit from the extensive experience gained by the agricultural sector in promoting integrated pest-management principles as well as disseminating simple and pragmatic guidelines for insecticide resistance management.


Received May 26, 2007. Accepted for publication October 31, 2007.

Acknowledgments: We thank J. B. Ouedraogo, the head of IRSS, for his support during the study. Our thanks also go to A. Ouattara for his participation in mosquitoe sample collection. Finally, we thank Sébastien Koudénoukpo of the Centre de Recherche Entomologique de Cotonou for his help with the genotyping.

Financial support: This study and Luc Djogbénou were supported by a grant from Institut de Recherche pour le Développement (IRD).

* Address correspondence to Luc Djogbénou, Centre de Recherche Entomologique de Cotonou (CREC), 06 BP 2604, Cotonou, Bénin. E-mail: Luc.Djogbenou{at}ird.fr Back

Authors’ addresses: Luc Djogbénou and Martin Akogbéto, Centre de Recherche Entomologique de Cotonou (CREC), 06 BP 2604, Cotonou, Bénin, Tel: +229-21-33-08-25, Fax: +229-21-37-49-81, E-mail: Luc.Djogbenou{at}ird.fr. Roch Dabiré and Abdoulaye Diabaté, Laboratoire d’Entomologie et de Parasitologie, IRSS/Centre Muraz, BP 153, Bobo-Dioulasso, Burkina Faso, Tel: 226- 97-01-02, Fax: 226-97-04-57. Pierre Kengne, Laboratoire de Lutte Contre les Insectes Nuisibles, Institut de Recherche pour le Développement (IRD), 911 Avenue Agropolis, BP 5045, 34032 Montpellier Cedex 1, France, Tel: 33-4-67-04-32- 23, Fax: 33-4-67-54-20-44. Jean-Marc Hougard and Fabrice Chandre, Institut de Recherche pour le Développement (IRD/CREC), 01 BP 4414 RP, Cotonou, Bénin, Tel: +229-21-37-49-82, Fax: +229-21-37-49-81.


REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. Chandre F, Darriet F, Manguin S, Brengues C, Carnevale P, Guillet P, 1999. Pyrethroid cross resistance spectrum among populations of Anopheles gambiae s.s. from Cote d’Ivoire. J Am Mosq Control Assoc 15: 53–59.[Web of Science][Medline]
  2. Diabate A, Baldet T, Chandre F, Akoobeto M, Guiguemde TR, Darriet F, Brengues C, Guillet P, Hemingway J, Small GJ, Hougard JM, 2002. The role of agricultural use of insecticides in resistance to pyrethroids in Anopheles gambiae s.l. in Burkina Faso. Am J Trop Med Hyg 67: 617–622.[Abstract]
  3. Elissa N, Mouchet J, Riviere F, Meunier JY, Yao K, 1993. Resistance of Anopheles gambiae s.s. to pyrethroids in Cote d’Ivoire. Ann Soc Belg Med Trop 73: 291–294.[Web of Science][Medline]
  4. Martinez-Torres D, Chandre F, Williamson MS, Darriet F, Berge JB, Devonshire AL, Guillet P, Pasteur N, Pauron D, 1998. Molecular characterization of pyrethroid knockdown resistance (kdr) in the major malaria vector Anopheles gambiae s.s. Insect Mol Biol 7: 179–184.[Web of Science][Medline]
  5. Awolola TS, Brooke BD, Koekemoer LL, Coetzee M, 2003. Absence of the kdr mutation in the molecular ‘M’ form suggests different pyrethroid resistance mechanisms in the malaria vector mosquito Anopheles gambiae s.s. Trop Med Int Health 8: 420–422.[Web of Science][Medline]
  6. Fanello C, Petrarca V, della Torre A, Santolamazza F, Dolo G, Coulibaly M, Alloueche A, Curtis CF, Toure YT, Coluzzi M, 2003. The pyrethroid knock-down resistance gene in the Anopheles gambiae complex in Mali and further indication of incipient speciation within An. gambiae s.s. Insect Mol Biol 12: 241–245.[Web of Science][Medline]
  7. Yawson AE, McCall PJ, Wilson MD, Donnelly MJ, 2004. Species abundance and insecticide resistance of Anopheles gambiae in selected areas of Ghana and Burkina Faso. Med Vet Entomol 18: 372–377.[Web of Science][Medline]
  8. Curtis CF, Miller JE, Hodjati MH, Kolaczinski JH, Kasumba I, 1998. Can anything be done to maintain the effectiveness of pyrethroid-impregnated bednets against malaria vectors? Philos Trans R Soc Lond B Biol Sci 353: 1769–1775.[Abstract/Free Full Text]
  9. Zaim M, Guillet P, 2002. Alternative insecticides: an urgent need. Trends Parasitol 18: 161–163.[Web of Science][Medline]
  10. Fanello C, Kolaczinski JH, Conway DJ, Carnevale P, Curtis CF, 1999. The kdr pyrethroid resistance gene in Anopheles gambiae: tests of non-pyrethroid insecticides and a new detection method for the gene. Parassitologia 41: 323–326.[Medline]
  11. N’Guessan R, Darriet F, Guillet P, Carnevale P, Traore-Lamizana M, Corbel V, Koffi AA, Chandre F, 2003. Resistance to carbosulfan in Anopheles gambiae from Ivory Coast, based on reduced sensitivity of acetylcholinesterase. Med Vet Entomol 17: 19–25.[Web of Science][Medline]
  12. Weill M, Lutfalla G, Mogensen K, Chandre F, Berthomieu A, Berticat C, Pasteur N, Philips A, Fort P, Raymond M, 2003. Comparative genomics: insecticide resistance in mosquito vectors. Nature 423: 136–137.[Medline]
  13. Ayad H, Georghiou P, 1975. Resistance to organophosphates and carbamates in Anopheles albimanus based on reduced sensitivity of acetylcholinesterase. J Econ Entomol 68: 295–297.[Web of Science][Medline]
  14. Weill M, Malcolm C, Chandre F, Mogensen K, Berthomieu A, Marquine M, Raymond M, 2004. The unique mutation in ace-1 giving high insecticide resistance is easily detectable in mosquito vectors. Insect Mol Biol 13: 1–7.[Web of Science][Medline]
  15. Diabate A, Brengues C, Baldet T, Dabire KR, Hougard JM, Akogbeto M, Kengne P, Simard F, Guillet P, Hemingway J, Chandre F, 2004. The spread of the Leu-Phe kdr mutation through Anopheles gambiae complex in Burkina Faso: genetic introgression and de novo phenomena. Trop Med Int Health 9: 1267–1273.[Web of Science][Medline]
  16. Collins FH, Mendez MA, Rasmussen MO, Mehaffey PC, Besansky NJ, Finnerty V, 1987. A ribosomal RNA gene probe differentiates member species of Anopheles gambiae complex. Am J Trop Med Hyg 37: 37–41.[Abstract/Free Full Text]
  17. Favia G, Dimopoulos G, della Torre A, Toure YT, Coluzzi M, Louis C, 1994. Polymorphisms detected by random PCR distinguish between different chromosomal forms of Anopheles gambiae. Proc Natl Acad Sci USA 91: 10315–10319.[Abstract/Free Full Text]
  18. Scott JA, Brogdon WG, Collins FH, 1993. Identification of single specimens of the Anopheles gambiae complex by the polymerase chain reaction. Am J Trop Med Hyg 49: 520–529.[Abstract/Free Full Text]
  19. Rousset F, Raymond M, 1995. Testing heterozygotes excess and defiency. Genetics 140: 1413–1419.[Abstract]
  20. Della Torre A, Fanello C, Akogbeto M, Dossou-Yovo J, Favia G, Petrarca V, Coluzzi M, 2001. Molecular evidence of incipient speciation within Anopheles gambiae s.s. in West Africa. Insect Mol Biol 10: 9–18.[Web of Science][Medline]
  21. Chandre F, Manguin S, Brengues C, Dossou Yovo J, Darriet F, Diabate A, Carnevale P, Guillet P, 1999. Current distribution of a pyrethroid resistance gene (kdr) in Anopheles gambiae complex from west Africa and further evidence for reproductive isolation of the Mopti form. Parassitologia 41: 319–322.[Medline]
  22. della Torre A, Costantini C, Besansky NJ, Caccone A, Petrarca V, Powell JR, Coluzzi M, 2002. Speciation within Anopheles gambiae–the glass is half full. Science 298: 115–157.[Abstract/Free Full Text]
  23. Weill M, Chandre F, Brengues C, Manguin S, Akogbeto M, Pasteur N, Guillet P, Raymond M, 2000. The kdr mutation occurs in the Mopti form of Anopheles gambiae s.s. through introgression. Insect Mol Biol 9: 451–455.[Web of Science][Medline]
  24. Coluzzi M, Sabatini A, Petrarca V, Di Deco MA, 1979. Chromosomal differentiation and adaptation to human environments in the Anopheles gambiae complex. Trans R Soc Trop Med Hyg 73: 483–497.[Web of Science][Medline]
  25. Kristan M, Fleischmann H, della Torre A, Stich A, Curtis CF, 2003. Pyrethroid resistance/susceptibility and differential urban/rural distribution of Anopheles arabiensis and An. gambiae s.s. malaria vectors in Nigeria and Ghana. Med Vet Entomol 17: 326–332.[Web of Science][Medline]
  26. Lemasson JJ, Fontenille D, Lochouarn L, Dia I, Simard F, Ba K, Diop A, Diatta M, Molez JF, 1997. Comparison of behavior and vector efficiency of Anopheles gambiae and An. Arabiensis (Diptera:Culicidae) in Barkedji, a Sahelian area of Senegal. J Med Entomol 34: 396–403.[Web of Science][Medline]
  27. Raymond M, Berticat C, Weill M, Pasteur N, Chevillon C, 2001. Insecticide resistance in the mosquito culex pipiens: what have we learned about adaptation? Genetica 112–113: 287–296.
  28. Weill M, Labbe P, Duron O, Pasteur N, Fort P, Raymond M, 2005. Insecticide resistance in the mosquito Culex pipiens: towards an understanding of the evolution of ace genes. Felowes MDE, Holloway GJ, and Rolff J, eds. Insect Evol Ecolo. Oxon, UK: CABI Publishing.
  29. Raymond M, Callaghan A, Fort P, Pasteur N, 1991. Worldwide migration of amplified insecticide resistance genes in mosquitoes. Nature 350: 151–153.[Medline]



This article has been cited by other articles:


Home page
Am J Trop Med HygHome page
A. Kazanidou, D. Nikou, M. Grigoriou, J. Vontas, and G. Skavdis
A Multiplex PCR Assay for Simultaneous Genotyping of kdr and ace-1 Loci in Anopheles gambiae
Am J Trop Med Hyg, February 1, 2009; 80(2): 236 - 238.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Erratum
Right arrow An erratum has been published
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Web of Science (9)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Djogbénou, L.
Right arrow Articles by Chandre, F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Djogbénou, L.
Right arrow Articles by Chandre, F.
Related Collections
Right arrow Malaria
Right arrow Medical Entomology
Right arrow Mosquitoes


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS