AJTMH HINARI
HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


Am. J. Trop. Med. Hyg., 75(3), 2006, pp. 491-496
Copyright © 2006 by The American Society of Tropical Medicine and Hygiene

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by ARMSTRONG, P. M.
Right arrow Articles by ANDREADIS, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by ARMSTRONG, P. M.
Right arrow Articles by ANDREADIS, T. G.
Related Collections
Right arrow Bunyaviruses

A NEW GENETIC VARIANT OF LA CROSSE VIRUS (BUNYAVIRIDAE) ISOLATED FROM NEW ENGLAND

PHILIP M. ARMSTRONG* AND THEODORE G. ANDREADIS
The Connecticut Agricultural Experiment Station, New Haven, Connecticut


ABSTRACT
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
La Crosse virus (LACV) is found primarily in the Midwestern and Appalachian regions of the United States where it is a leading cause of mosquito-borne encephalitis in children. To determine whether the distribution of this virus extends further east into New England, we analyzed a bunyavirus that was isolated from a pool of eastern tree-hole mosquitoes, Ochlerotatus triseriatus (= Aedes triseriatus), collected from Fairfield, Connecticut (CT) in 2005. Nucleotide and encoded amino acid sequences from portions of the S, M, and L segments were more similar to the prototype strain of La Crosse virus than that of closely related snowshoe hare virus. Phylogenetic analysis of sequences from the M segment indicated that the CT isolate represents a distinct lineage of La Crosse virus, diverging earliest from other strains found in southeastern, central, and northeastern United States. Despite low sequence homology with other viral strains, the CT isolate was antigenically similar to the prototype strain of LACV by plaque-reduction neutralization tests with polyclonal and monoclonal antibodies. This represents the first isolation of LACV in New England to our knowledge and suggests long-term independent evolution of the CT isolate.


INTRODUCTION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
La Crosse virus (LACV) belongs to the California sero-group of the genus Orthobunyavirus, family Bunyaviridae and is an important cause of mosquito-borne encephalitis in the United States, accounting for about 100 cases reported annually to the Centers for Disease Control and Prevention (CDC).1 LAC encephalitis afflicts mainly children (< 15 years old) with the majority of cases reported from Midwestern and Appalachian regions of the United States.2 Transmission of LACV is associated with hardwood forests that support dense populations of the main vector species, Ochlerotatus triseriatus3,4 (= Aedes triseriatus, see Reinert and others5). (We have adopted the designation of Ochlerotatus to the generic rank on the basis of morphologic characters and recent molecular evidence.6) The virus persists by transovarial transmission (TOT) from female mosquitoes to their progeny7,8 and is amplified in a cycle involving mosquitoes and arboreal rodents (eastern chipmunk and gray squirrel).913

La Crosse virus has been isolated from 13 states in the eastern United States extending west from Texas to Minnesota and east from New York to Georgia.4 Nevertheless, clinical cases of California group encephalitis have been reported from residents of 28 eastern states,1 suggesting a broader distribution of the virus. In northeastern United States, the virus has been found exclusively in New York State,14 despite surveillance efforts in neighboring New England states, New Jersey, and Pennsylvania. Serological evidence of LACV infection, however, has been detected in white-tailed deer, eastern chipmunks, and gray squirrels from western Massachusetts15 and in cottontail rabbits from Pennsylvania.16

In 2005, we isolated a bunyavirus from Oc. triseriatus collected from Fairfield, Connecticut (CT) that was identified as LACV by serological and genetic analysis. It is not clear whether the CT isolate represents a recent introduction of LACV from another locality or constitutes a regionally distinct variant of the virus, suggesting a continued existence of LACV within this area. Accordingly, to evaluate its origins, we compared the CT isolate to 15 other geographic strains of LACV by phylogenetic analysis of M segment sequences.


MATERIALS AND METHODS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mosquito collections. Mosquitoes were trapped at 91 locations statewide from the beginning of June through the end of October 2005.17 Each trapping site was visited every 7–10 days and mosquitoes were sampled using a CO2-baited CDC light trap and a CDC gravid mosquito trap. Adults were transported back to the laboratory alive and sorted by sex, species, and trapping location on chill tables using taxonomic keys of Andreadis and colleagues 2005.18 Mosquitoes were combined into pools of 50 or less and stored at –80°C until virus testing.

Virus isolation and identification. Mosquito pools were placed in 2-mL microcentrifuge tubes containing a copper BB and homogenized in 1 to 1.5 mL of phosphate buffered saline (PBS) containing 30% heat-inactivated rabbit serum, 0.5% gelatin, and 1X antibiotic/antimycotic using a vibration mill as previously described.17 Mosquito homogenates were centrifuged at 4°C for 10 minutes at 520g and a 100-uL aliquot of the supernatant was inoculated onto a monolayer of confluent Vero cells growing in minimal essential media, 5% fetal bovine serum, and 1X antibiotics/antimycotics. Cells were maintained at 37°C in 5% CO2 and examined daily for cytopathic effect (CPE) from day 3 through day 7 post-inoculation. Infected cell supernatants were harvested and stored at –80°C until further testing.

RNA was extracted from viral stocks using the viral RNA Kit (Qiagen, Valencia, CA) and eluted in a final volume of 70 uL. Reverse transcription polymerase chain reaction (RT-PCR) was performed using the Titan One-Tube RT-PCR System (Roche Diagnostics, Indianapolis, IN) and primer pair BUNS+new (TGACCAGTAGTGTACTCCAC) and BUNS-new (CAAGCAGTAGTGTGCTCCAC),19 which target the terminal-ends of the S segment of the Orthobunyavirus genus. For each RT-PCR reaction, 2 uL of extracted RNA was added to Master mix I containing 500 uM ATP, 500 uM GTP, 500 uM CTP, 500 uM TTP, 12.5 uM DTT, 1 uM of each primer in a final volume of 20 uL. This mixture was heated to 85°C for 5 minutes and then quick chilled on ice to denature RNA. Master mix I was added to a second master mix containing 5X RT-PCR buffer (10 uL) and Titan enzyme mix (1 uL) for a final volume of 50 uL. Amplification was performed as follows: 1 cycle of 50°C for 30 minutes and 94°C for 2 minutes, 10 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute, followed by 25 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 1 minute + 5 seconds per cycle, and 1 cycle of 68°C for 7 minutes. S segment amplification products of approximately 950 bp in size were digested with restriction enzymes EcoRV, Cac81, SwaI, and XhoI in separate reactions to identify bunyaviruses known to occur in CT. Predicted restriction fragment polymorphisms for BUNS+/– new amplification products are as follows: EcoRV cuts only Jamestown Canyon virus (fragment sizes 364 and 627 bp) and Keystone virus (356 and 598 bp); Cac81- Potosi virus (256 and 677 bp) and California encephalitis virus (183 and 795 bp); SwaI- Cache Valley virus (411 and 539 bp), and XhoI- Trivittatus virus (233 and 740 bp). Digestion products were separated on a 2% agarose gel and visualized by staining with ethidium-bromide.

Genetic characterization. The CT isolate (6716-05) was further characterized by nucleotide sequencing of amplification products from genomic segments S, M, and L. In addition, a 1,683 nucleotide portion of the M segment, encoding the envelope glycoprotein G2, nonstructural protein NSm, and a portion of the G1 envelope glycoprotein, was sequenced from 8 other isolates of LACV (Table 1Go) to include in phylogenetic analyses. PCR primers M14C (CGGAATTCAGTAGTG-TACTACC) and M4510R (ATCGCGTAGTAGTGTGCT-ACC) were used to amplify the entire M segment (~4,500 bp) using conditions described previously with modifications to the thermal cycling conditions as follows: 1 cycle of 45°C for 30 minutes and 94°C for 2 minutes, 10 cycles of 94°C for 15 seconds, 48°C for 30 seconds, and 68°C for 4 minutes, followed by 25 cycles of 94°C for 15 seconds, 55°C for 30 seconds, and 68°C for 4 minutes + 5 seconds per cycle, and 1 cycle of 68°C for 7 minutes. A portion of the L segment (~650 bp) was amplified using primers L612C (GTGATTTTA-CACTGACAGCACC) and L1254R (CTAAGATGAATT-GTTGTTCCCATAA) and modifying the cycling conditions described for the M segment by reducing the 68°C extension step of 4 minutes to 1 minute. Amplification products of the appropriate size were purified using the PCR purification kit (Qiagen, Valencia, CA) and commercially sequenced (Keck Center, New Haven, CT). Sequence from one of the isolates, W-17258 (ODH102), was derived from plaque-purified virus stocks because sequence chromatograms from the original stock virus could not be interpreted at some nucleotide positions. Viral plaques were developed on Vero cells as described below and a total of 9 plaque-forming units (PFUs) of varying sizes were individually picked, re-passed in Vero cells, and sequenced, all of which yielded identical, unambiguous sequence.


View this table:
[in this window]
[in a new window]
 
TABLE 1
Characteristics of LACV isolates analyzed in this study
 
Overlapping sequence chromatograms were aligned and edited using the ChromasPro editing program (Technelysium Ltd, Tewantin, Australia). Multiple sequence alignments were generated by the ClustalW algorithm using Mega 3.0.20 Phylogenetic relationships were evaluated by maximum likelihood and maximum parsimony analysis of M segment sequences using PAUP 4.0.21 Maximum-likelihood searches were performed by the heuristic search method with the general time reversible model using codon position-specific rates. Maximum parsimony trees were estimated by the heuristic search method and treating characters as equally weighted and unordered. Tahyna, Lumbo, California encephalitis, and San Angelo viruses served as outgroup taxa to root phylogenetic trees. Support for individual nodes was evaluated by performing 1,000 bootstrap replicates in maximum parsimony analysis.

Plaque reduction neutralization (PRN) test. Serum dilution PRN tests were performed on Vero cell monolayers according to standard protocols.22,23 The following immune reagents were used: hyper-immune mouse ascitic fluids raised against LACV, hamster antiserum directed against snowshoe hare virus (SSHV), and a monoclonal antibody (807-18) specific for LACV.24 Approximately 200 PFUs of virus were added to 2-fold dilutions of antibody and this mixture was incubated at 4°C overnight. Each antibody-virus mixture (100 uL) was inoculated onto confluent Vero cells growing in 6-well plates and virus was absorbed at 37°C for 1 hour with periodic rocking. Cell monolayers were then overlaid with 3 mL of 1% Agar in minimal essential medium with 2.5% fetal bovine serum and antibiotics/antimycotics. Monolayers were incubated at 37° C, 5% CO2 for 4 days and then received a second 2.5- mL overlay containing neutral red stain at a final concentration of 1:5,000. Cells were incubated for an additional day before plaques were counted.


RESULTS
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
An unknown virus (6716-05) was isolated from a pool of four Oc. triseriatus collected in Fairfield, CT on 8/15/05. The virus was screened by RT-PCR using primers BUNS+new/ BUNS-new designed to amplify the S-segment of California and Bunyamwera serogroup bunyaviruses. Primers yielded an amplification product of the appropriate size (~950 bp) that could not be cut with any of the diagnostic restriction enzymes (EcoRV, Cac81, SwaI, and XhoI) for identifying Jamestown Canyon, Potosi, Cache Valley, and Trivittatus viruses. The CT isolate was further characterized by nucleotide sequencing of the S-segment amplification product. LACV was the most closely related virus based on comparison of nucleotide and amino acid sequences encoding the nucleocapsid, nonstructural protein NSs, and 3' nontranslated region (Table 2Go). Further sequencing of amplification products from M and L segments indicated a closer relationship with the prototype strain of LACV than sister taxa- SHHV; however, some of the genes were only slightly more similar to LACV, including envelope glycoproteins G1 and G2.


View this table:
[in this window]
[in a new window]
 
TABLE 2
Sequence comparison of the CT isolate (6716-05) with prototype strains of LACV and SSHV
 
To determine whether the CT isolate represented an antigenically distinct bunyavirus, the virus was characterized by PRN tests using polyclonal and monoclonal antibodies (Table 3Go). PRN titers of the isolate were not significantly different from those of the prototype strain of LACV, as defined by a 4-fold or greater difference in titer, and these viruses could be readily distinguished from SSHV using a LACV monoclonal antibody and SSHV antisera. Mouse ascites fluid raised against LACV was broadly reactive against all of the viruses and only a 2-fold difference in titer was observed between LACV and SSHV.


View this table:
[in this window]
[in a new window]
 
TABLE 3
Results of PRN tests using polyclonal and monoclonal antibodies (Mab)
 
Our initial analysis indicated that the CT isolate represents a genetic variant of LACV. To evaluate possible origins of this virus, we compared it to other geographic strains of LACV by phylogenetic analysis of M segment sequences. Trees generated by maximum likelihood (Figure 1Go) and maximum parsimony (data not shown) were essentially identical except the branching order of isolates TN99 and NC78 within lineage 1 could not be fully resolved by parsimony analysis. LACV isolates from the Midwest (OH, MN, MO, WI) and Appalachian regions (NC, TN, WV) formed a genetically distinct clade (mean pairwise distance within group = 3.9%), designated as lineage 1. Substructure within this lineage revealed a homogeneous cluster of variants from Minnesota, western Wisconsin (WI 76, WI 78), and Missouri, and another group from Wisconsin (WI 79, WI 81) and western Ohio that corresponded to types A and B in previous RNA fingerprinting studies.25,26 Our inclusion of additional isolates from the Appalachian region blurred the distinction between these two genetic groups and therefore, we classified them into a single lineage. Lineage 2 comprised strains from the southeastern (AL, GA) and northeastern (NY) United States (mean pairwise difference within group = 2.9%) that corresponded to type C as previously defined.25 The CT isolate represented the sole member of lineage 3 that was ancestral to all of the other LACV strains (mean pairwise distance = 14.6%).


Figure 1
View larger version (15K):
[in this window]
[in a new window]
 
FIGURE 1. Phylogenetic relationships of LACV isolates based on maximum-likelihood analysis of nucleotide sequences from the M segment (1,686 bp). Numbers above branches represent bootstrap support for 1,000 replicates from maximum parsimony analysis. Bootstrap values for nodes within lineages are omitted for clarity. Viruses are designated by the state and year of isolation.

 

DISCUSSION
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
We find that the geographic range of LACV extends further east than previously recognized and includes New England. Our isolate from CT proved to be distantly related to other geographic strains of LACV; nevertheless, neutralization titers were not significantly different from the prototype strain of LACV.

By phylogenetic analysis, we were able to distinguish three lineages of LACV circulating in different geographic regions of the United States. The CT isolate was the only member of a newly recognized lineage that apparently diverged earliest from other LACV strains. This supports the hypothesis that LACV has persisted within this region for a long duration of time but has gone undetected. Alternatively, this lineage may have been recently introduced from another geographic locale that was not included in our analysis. Prior RNA fingerprinting studies included an additional 22 strains to those represented here and all were assigned to one of the established genetic types—A, B, or C—which correspond to lineages 1 and 2 in this study.25,26 Thus we believe that lineage 3 is sufficiently different from the other genotypic groups that its presence would have been apparent by genetic fingerprinting techniques. A final possibility is that lineage 3 was recently introduced from another geographic region outside of the known distribution of LACV. Indeed, the recent description of another virus related to SSHV and LACV from Russia suggests a wider diversity and distribution of these viruses than previously recognized.27

Despite long-term independent evolution of the CT isolate, its antigenic features appear to be highly conserved and characteristic of LACV. Neutralization titers of the CT isolate were similar to the prototype strain of LACV yet distinct from closely related SSHV. This relationship was most apparent when using a monoclonal antibody targeting the G1 surface glycoprotein of LACV.24 These results indicate shared antigenicity with the prototype strain, yet further probing with monoclonal antibodies may reveal neutralization determinants that are specific for the CT isolate. Moreover, given the extent of genetic differentiation between the CT isolate and other geographic strains of LACV, it is possible that these viruses exhibit differences in other phenotypic traits such as viral replication rates, infectivity, host-specificity, and virulence. This possibility merits further investigation because such differences in viral phenotype could be relevant to the epidemiology of LACV within different regions of the United States.

We had previously suspected that LACV may circulate in CT because of its geographic proximity to enzootic sites in New York and because of the similar ecological conditions for maintaining LACV transmission in southern New England. This region is characterized by fragmented woodlands that support Oc. triseriatus and the main amplification hosts (eastern chipmunk and gray squirrel). Nevertheless, transmission appears to be less intense within this region than in other parts of eastern US. Of 19,023 Oc. triseriatus sampled in CT, only one pool yielded LACV (minimal infection rate- MIR per 1,000 mosquitoes = 0.05), representing our sole isolate of the virus during statewide surveillance from 1997–2005. The comparable statewide MIR for Oc. triseriatus sampled from New York and Ohio was 0.15 and 0.92 respectively,14,28 suggesting qualitative differences in transmission intensity. Nonetheless, entomological estimates of transmission risk must also consider other parameters including the relative abundance of the vector. While our study establishes the presence of LACV in New England, additional sampling of Oc. triseriatus and other vector species is required to accurately determine the local transmission risk of this virus.

Our infrequent detection of LACV in CT may also stem from under-sampling of Oc. triseriatus by our trapping methods. Mosquitoes were collected using CO2-baited CDC light traps and gravid traps, which are not efficient for luring and trapping Oc. triseritatus.29 Collection of Oc. triseriatus by means of human bait or vacuuming the vegetation may be more effective,30,31 but these methods are relatively time consuming and impractical for operational surveillance at a large number of trapping locations. The problems associated with conventional trapping methods has led to the adoption of ovitraps as the principle method for monitoring Oc. triseriatus populations.32 Ovitraps were used to estimate the prevalence of LACV infection in mosquitoes sampled from emerging foci in North Carolina,33,34 Tennessee,33 West Virginia,35 and Virginia36 and these traps were shown to be highly effective and selective for Oc. triseriatus sampled in CT.37 This approach, however, detects LACV infections acquired solely by TOT and may be less effective for surveillance in New England when considering vector competence studies. Geographic strains of Oc. triseriatus from CT and Massachusetts were shown to be less permissive to TOT than those from midwestern United States,38 perhaps resulting in lower infection rates among field-collected mosquito eggs. These findings must be extended using the CT isolate of LACV to evaluate whether TOT is more efficient in sympatric viral-vector pairs.

Our isolation of LACV from New England mosquitoes has important public health implications. The isolate was derived from a densely populated region of CT and it is possible that this virus is more broadly distributed throughout this region. To date, only 2 cases of California group encephalitis have been documented among residents of CT. One case was attributed to Jamestown Canyon virus infection39 and the other was probably acquired outside of the state (CT Department of Health, personal communication). Despite the paucity of human cases in this region, health care providers should consider LAC encephalitis as a possibility among residents of New England when arboviral etiology is suspected.


Received March 7, 2006. Accepted for publication May 2, 2006.

Acknowledgments: We are grateful for the technical assistance of our support staff: Shannon Finan, John Sheppard, and Michael Thomas in the collection, identification, and processing of mosquitoes for virus isolation. The authors thank Drs. Barbara Johnson, Roger Nasci, and Robert Tesh for kindly sharing their LACV isolates for sequencing and Drs. John Anderson, Andrew Main, and Brandy Russell for providing us immune reagents for PRN tests. We also thank Drs. Louis Magnarelli and Charles Vossbrinck for critically reviewing this manuscript. This work was supported in part by grants from the Centers for Disease Control (U50/CCU116806-01-1) and the US Department of Agriculture (58-6615-1-218 and CONH00768).

Financial support: This work was supported in part by grants from the Centers for Disease Control (U50/CCU116806-01-1) and the US Department of Agriculture (58-6615-1-218 and CONH00768).

* Address correspondence to: Philip M. Armstrong, The Connecticut Agricultural Experiment Station, 123 Huntington St., P.O. Box 1106, New Haven, CT 06504. E-mail: philip.armstrong{at}po.state.ct.us Back

Authors’ addresses: Dr. Philip M. Armstrong and Theodore G. Andreadis. The Connecticut Agricultural Experiment Station, 123 Huntington St., P.O. Box 1106, New Haven, CT 06504, Telephone: 203-974-8461, Fax: 203-974-8502, E-mails: philip.armstrong{at}po.state.ct.us and Theodore.Andreadis{at}po.state.ct.us.


REFERENCES
 TOP
 ABSTRACT
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

  1. CDC, 2005. Historical summaries of notifiable diseases in the United States, 1993–2003. Morb Mortal Wkly Rep 52: 69–85.
  2. Kappus KD, Monath TP, Kaminski RM, Calisher CE, 1983. Reported encephalitis associated with California serogroup virus infections in United States, 1963 to 1981. Calisher CE, Thompson WH, eds. California Serogroup Viruses. New York: Liss, 31–41.
  3. Grimstad PR, 1988. California group virus disease. Monath TP, ed. The Arboviruses: Epidemiology and Ecology. Boca Raton, FL: CRC, 99–136.
  4. Calisher CH, 1994. Medically important arboviruses of the United States and Canada. Clin Microbiol Rev 7: 89–116.[Abstract/Free Full Text]
  5. Reinert JF, 2000. New classification for the composite genus Aedes (Diptera: Culicidae: Aedini), elevation of subgenus Ochlerotatus to generic rank, reclassification of the other subgenera, and notes on certain subgenera and species. J Am Mosq Control Assoc 16: 175–188.[Web of Science][Medline]
  6. Shepard JJ, Andreadis TG, Vossbrinck CR, 2006. Molecular phylogeny and evolutionary relationships among mosquitoes (Diptera: Culicidae) from the northeastern United States based on small subunit ribosomal DNA (18S rDNA) sequences. J Med Entomol 43: 443–454.[Medline]
  7. Watts DM, Thompson WH, Yuill TM, DeFoliart GR, Hanson RP, 1974. Overwintering of La Crosse virus in Aedes triseriatus. Am J Trop Med Hyg 23: 694–700.[Abstract/Free Full Text]
  8. Watts DM, Pantuwatana S, DeFoliart GR, Yuill TM, Thompson WH, 1973. Transovarial transmission of La Crosse virus (California encephalitis group) in the mosquito, Aedes triseriatus. Science 182: 1140–1141.[Abstract/Free Full Text]
  9. Gauld LW, Hanson RP, Thompson WH, Sinha SK, 1974. Observations on a natural cycle of La Crosse virus (California group) in Southwestern Wisconsin. Am J Trop Med Hyg 23: 983–992.[Abstract/Free Full Text]
  10. Gauld LW, Yuill TM, Hanson RP, Sinha SK, 1975. Isolation of La Crosse virus (California encephalitis group) from the chipmunk (Tamias striatus), an amplifier host. Am J Trop Med Hyg 24: 999–1005.[Web of Science][Medline]
  11. Ksiazek TG, Yuill TM, 1977. Viremia and antibody response to La Crosse virus in sentinel gray squirrels (Sciuris carolinensis) and chipmunks (Tamias striatus). Am J Trop Med Hyg 26: 815–821.[Abstract/Free Full Text]
  12. Moulton DW, Thompson WH, 1971. California group virus infections in small, forest-dwelling mammals of Wisconsin. Some ecological considerations. Am J Trop Med Hyg 20: 474–482.[Abstract/Free Full Text]
  13. Pantuwatana S, Thompson WH, Watts DM, Hanson RP, 1972. Experimental infection of chipmunks and squirrels with La Crosse and Trivittatus viruses and biological transmission of La Crosse virus by Aedes triseriatus. Am J Trop Med Hyg 21: 476–481.[Abstract/Free Full Text]
  14. Grayson MA, Calisher CH, 1983. California serogroup viruses in New York State: a retrospective analysis of subtype distribution patterns and their epidemiologic significance, 1965–1981. Calisher CH, Thompson WH, eds. California Serogroup Viruses. New York: Liss, 257–267.
  15. Walker ED, Grayson MA, Edman JD, 1993. Isolation of Jamestown Canyon and snowshoe hare viruses (California serogroup) from Aedes mosquitoes in western Massachusetts. J Am Mosq Control Assoc 9: 131–134.[Web of Science][Medline]
  16. Dressler RL, Ganaway JR, Storm GL, Tzilkowski WM, 1988. Serum antibody prevalence for Herpesvirus sylvilagus, Bacillus piliformis and California serogroup arboviruses in cottontail rabbits from Pennsylvania. J Wildl Dis 24: 352–355.[Abstract]
  17. Andreadis TG, Anderson JF, Vossbrinck CR, Main AJ, 2004. Epidemiology of West Nile virus in Connecticut, USA: a five year analysis of mosquito data 1999–2003. Vector Borne Zoonotic Dis 4: 360–378.[Web of Science][Medline]
  18. Andreadis TG, Thomas MC, Shepard JJ, 2005. Identification Guide to the Mosquitoes of Connecticut. New Haven, CT: The Connecticut Agricultural Experiment Station.
  19. Dunn EF, Pritlove DC, Elliott RM, 1994. The S RNA genome segments of Batai, Cache Valley, Guaroa, Kairi, Lumbo, Main Drain and Northway bunyaviruses: sequence determination and analysis. J Gen Virol 75: 597–608.[Abstract/Free Full Text]
  20. Kumar S, Tamura K, Nei M, 2004. MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5: 150–163.[Abstract/Free Full Text]
  21. Swofford D, 2001. PAUP* 4.0, Phylogenetic Analysis Using Parsimony and Other Methods. Sunderland, MA: Sinauer Associates.
  22. Russell PK, Nisalak A, Sukhavachana P, Vivona S, 1967. A plaque reduction test for dengue virus neutralizing antibodies. J Immunol 99: 285–290.[Abstract/Free Full Text]
  23. Hunt AR, Calisher CH, 1979. Relationships of bunyamwera group viruses by neutralization. Am J Trop Med Hyg 28: 740–749.[Abstract/Free Full Text]
  24. Gonzalez-Scarano F, Shope RE, Calisher CE, Nathanson N, 1982. Characterization of monoclonal antibodies against the G1 and N proteins of LaCrosse and Tahyna, two California serogroup bunyaviruses. Virology 120: 42–53.[Web of Science][Medline]
  25. Klimas RA, Thompson WH, Calisher CH, Clark GG, Grimstad PR, Bishop DH, 1981. Genotypic varieties of La Crosse virus isolated from different geographic regions of the continental United States and evidence for a naturally occurring intertypic recombinant La Crosse virus. Am J Epidemiol 114: 112–131.[Abstract/Free Full Text]
  26. El Said LH, Vorndam V, Gentsch JR, Clewley JP, Calisher CH, Klimas RA, Thompson WH, Grayson M, Trent DW, Bishop DH, 1979. A comparison of La Crosse virus isolated obtained from different ecological niches and an analysis of the structural components of California encephalitis serogroup viruses and other bunyaviruses. Am J Trop Med Hyg 28: 364–386.[Abstract/Free Full Text]
  27. Vanlandingham DL, Davis BS, Lvov DK, Samokhvalov E, Lvov SD, Black WC, Higgs S, Beaty BJ, 2002. Molecular characterization of California serogroup viruses isolated in Russia. Am J Trop Med Hyg 67: 306–309.[Abstract]
  28. Berry RL, Parsons MA, Restifo RA, Peterson ED, Gordon SW, Reed MR, Calisher CH, Bear GT, Halpin HJ, 1983. California serogroup virus infections in Ohio: an 18 year retrospective summary. Calisher CH, Thompson WH, eds. California Serogroup Viruses. New York: Liss, 215–223.
  29. Craig GB Jr, 1983. Biology of Aedes triseriatus: some factors affecting control. Calisher CH, Thompson WH, eds. California Serogroup Viruses. New York: Liss, 329–341.
  30. Nasci RS, 1981. A lightweight battery-powered aspirator for collecting resting mosquitoes in the field. Mosquito News 41: 808–811.[Web of Science]
  31. Beier JC, Berry WJ, Craig GB Jr, 1982. Horizontal distribution of adult Aedes triseriatus (Diptera: Culicidae) in relation to habitat structure, oviposition, and other mosquito species. J Med Entomol 19: 239–247.[Web of Science][Medline]
  32. Loor KA, DeFoliart GR, 1969. An oviposition trap for detecting the presence of Aedes triseriatus. Mosquito News 29: 487–488.
  33. Gerhardt RR, Gottfried KL, Apperson CS, Davis BS, Erwin PC, Smith AB, Panella NA, Powell EE, Nasci RS, 2001. First isolation of La Crosse virus from naturally infected Aedes albopictus. Emerg Infect Dis 7: 807–811.[Web of Science][Medline]
  34. Szumlas DE, Apperson CS, Powell EE, Hartig P, Francy DB, Karabotsos N, 1996. Relative abundance and species composition of mosquito populations (Diptera:Culicidae) in a La Crosse virus-endemic area in western North Carolina. J Med Entomol 33: 598–607.[Web of Science][Medline]
  35. Nasci RS, Moore CG, Biggerstaff BJ, Panella NA, Liu HQ, Karabatsos N, Davis BS, Brannon ES, 2000. La Crosse encephalitis virus habitat associations in Nicholas County, West Virginia. J Med Entomol 37: 559–570.[Web of Science][Medline]
  36. Barker CM, Paulson SL, Cantrell S, Davis BS, 2003. Habitat preferences and phenology of Ochlerotatus triseriatus and Aedes albopictus (Diptera: Culicidae) in southwestern Virginia. J Med Entomol 40: 403–410.[Web of Science][Medline]
  37. Andreadis TG, Anderson JF, Munstermann LE, Wolfe RJ, Florin DA, 2001. Discovery, distribution, and abundance of the newly introduced mosquito Ochlerotatus japonicus (Diptera: Culicidae) in Connecticut, USA. J Med Entomol 38: 774–779.[Web of Science][Medline]
  38. Miller BR, Beaty BJ, Lorenz LH, 1982. Variation of La Crosse virus filial infection rates in geographic strains of Aedes triseriatus (Diptera: Culicidae). J Med Entomol 19: 213–214.[Web of Science][Medline]
  39. Nelson R, Wilcox L, Brennan T, Mayo D, 2002. Surveillance for arbovirus infections. Connecticut Epidemiologist 22: 5–8.
  40. Huang C, Thompson WH, Campbell WP, 1995. Comparison of the M RNA genome segments of two human isolates of La Crosse virus. Virus Res 36: 177–185.[Web of Science][Medline]
  41. Grady LJ, Sanders ML, Campbell WP, 1987. The sequence of the M RNA of an isolate of La Crosse virus. J Gen Virol 68: 3057–3071.[Abstract/Free Full Text]
  42. Huang C, Thompson WH, Karabatsos N, Grady L, Campbell WP, 1997. Evidence that fatal human infections with La Crosse virus may be associated with a narrow range of genotypes. Virus Res 48: 143–148.[Web of Science][Medline]




This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Similar articles in this journal
Right arrow Similar articles in Web of Science
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Web of Science (3)
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by ARMSTRONG, P. M.
Right arrow Articles by ANDREADIS, T. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by ARMSTRONG, P. M.
Right arrow Articles by ANDREADIS, T. G.
Related Collections
Right arrow Bunyaviruses


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS